The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP016395	Bacillus velezensis strain M75 chromosome, complete genome	4007450	647724	657615	4007450		Synechococcus_phage(50.0%)	9	NA	NA
WP_003155764.1|647724_649017_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	27.3	4.5e-19
WP_003155762.1|649092_649812_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3G7P8	Synechococcus_phage	45.2	5.2e-49
WP_003155758.1|649811_650066_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	M4QPE7	Synechococcus_phage	33.3	4.7e-05
WP_014304545.1|650062_650746_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_069473179.1|650729_652958_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.5	1.5e-158
WP_015388589.1|652933_654364_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.9	1.6e-54
WP_069473180.1|654455_655496_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	41.1	5.3e-63
WP_003155752.1|655492_656080_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	39.3	1.0e-26
WP_043866892.1|656076_657615_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	50.8	8.7e-78
>prophage 2
NZ_CP016395	Bacillus velezensis strain M75 chromosome, complete genome	4007450	1101087	1157045	4007450	integrase,coat,tRNA	Bacillus_phage(42.11%)	65	1140562:1140577	1156269:1156284
WP_060386866.1|1101087_1102080_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_012117282.1|1102823_1104458_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003155043.1|1104564_1105500_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003155041.1|1105503_1106421_+	oligopeptide ABC transporter permease OppC	NA	NA	NA	NA	NA
WP_003155039.1|1106433_1107510_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.9	1.7e-16
WP_003155037.1|1107502_1108420_+	oligopeptide ABC transporter ATP-binding protein OppF	NA	M1HP82	Acanthocystis_turfacea_Chlorella_virus	24.6	1.5e-05
WP_003155036.1|1108526_1109714_+	putative glycoside hydrolase	NA	NA	NA	NA	NA
WP_003155035.1|1109831_1110410_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003155034.1|1110588_1110984_+	transcriptional regulator Spx	NA	NA	NA	NA	NA
WP_003155033.1|1111041_1111698_-	TerC family protein	NA	A0A0S4KZH7	Pseudomonas_phage	40.4	3.8e-30
WP_003155032.1|1111973_1112630_+	adaptor protein MecA	NA	NA	NA	NA	NA
WP_060386867.1|1112780_1113941_+	competence protein CoiA	NA	NA	NA	NA	NA
WP_003155028.1|1114168_1115998_+	oligoendopeptidase F	NA	NA	NA	NA	NA
WP_003155026.1|1116035_1116203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024085126.1|1116488_1117391_-	DsbA family protein	NA	NA	NA	NA	NA
WP_003155023.1|1117387_1117786_-	thiol management oxidoreductase	NA	NA	NA	NA	NA
WP_003155022.1|1118014_1118701_-	lytic transglycosylase domain-containing protein	NA	A0A1P8CWQ1	Bacillus_phage	71.2	7.9e-39
WP_015388447.1|1118705_1119281_-	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_015388446.1|1119405_1119771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003155019.1|1119798_1120434_+	GTP diphosphokinase	NA	NA	NA	NA	NA
WP_003155018.1|1120455_1121256_+	NAD kinase	NA	NA	NA	NA	NA
WP_003155017.1|1121270_1122164_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	29.3	1.0e-06
WP_057080088.1|1122197_1122947_-	bis(5'-nucleosyl)-tetraphosphatase PrpE	NA	A0A1V0SJW2	Klosneuvirus	26.7	1.2e-11
WP_003155014.1|1123174_1125019_+	monovalent cation:proton antiporter family protein	NA	NA	NA	NA	NA
WP_003155011.1|1125268_1125976_+	thiaminase II	NA	NA	NA	NA	NA
WP_003155010.1|1125953_1126571_+	thiazole tautomerase TenI	NA	NA	NA	NA	NA
WP_052585697.1|1126554_1127664_+	glycine oxidase ThiO	NA	NA	NA	NA	NA
WP_003155008.1|1127660_1127864_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_088005363.1|1127860_1128631_+	thiazole synthase	NA	NA	NA	NA	NA
WP_003155005.1|1128627_1129638_+	thiazole biosynthesis adenylyltransferase ThiF	NA	NA	NA	NA	NA
WP_003155003.1|1129660_1130473_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_003155001.1|1130603_1131380_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_171463468.1|1131471_1132086_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_003154997.1|1132144_1132588_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_003154995.1|1132733_1133216_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_003154994.1|1133366_1133867_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_003154993.1|1133959_1134274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069473262.1|1134311_1134698_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_069473263.1|1134868_1135225_+	DUF1360 domain-containing protein	NA	NA	NA	NA	NA
WP_003154990.1|1135512_1135710_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003154988.1|1135802_1135970_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_003154986.1|1136132_1136387_+	stage VI sporulation protein F	NA	NA	NA	NA	NA
WP_069473264.1|1136455_1138741_-	ATP-dependent helicase	NA	A0A068EQC7	Bacillus_phage	33.3	6.4e-85
WP_069473265.1|1138861_1139116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032858453.1|1139184_1139934_+	subclass B1 metallo-beta-lactamase	NA	NA	NA	NA	NA
WP_014304806.1|1139975_1140698_-	ABC transporter permease	NA	NA	NA	NA	NA
1140562:1140577	attL	TTAAAGGTATCAAGCG	NA	NA	NA	NA
WP_003154975.1|1140690_1141428_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	33.8	5.2e-28
WP_003154973.1|1141428_1141662_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003154971.1|1141822_1142254_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003154969.1|1142258_1142774_-	2'-5' RNA ligase family protein	NA	NA	NA	NA	NA
WP_014304808.1|1142799_1143522_-	esterase family protein	NA	NA	NA	NA	NA
WP_069473266.1|1143889_1145011_+	methionine biosynthesis PLP-dependent protein	NA	NA	NA	NA	NA
WP_052585711.1|1145003_1146179_+	cystathionine beta-lyase	NA	NA	NA	NA	NA
WP_069473267.1|1146549_1147596_+|integrase	tyrosine-type recombinase/integrase	integrase	Q938N9	Temperate_phage	27.0	1.1e-07
WP_025851674.1|1147737_1148157_+	helix-turn-helix domain-containing protein	NA	A0A2H4IZR0	uncultured_Caudovirales_phage	58.7	2.7e-34
WP_069473269.1|1148566_1148890_+	hypothetical protein	NA	A0A0S2MUA3	Bacillus_phage	36.8	1.7e-07
WP_069473270.1|1149302_1149671_+	hypothetical protein	NA	A0A142F1P2	Bacillus_phage	41.9	1.7e-27
WP_069473271.1|1149887_1150976_+	hypothetical protein	NA	R4JEY6	Bacillus_phage	47.8	3.7e-75
WP_069473272.1|1150972_1151185_+	hypothetical protein	NA	U5Q038	Bacillus_phage	68.1	1.3e-19
WP_069473273.1|1151204_1151984_+	DNA replication protein	NA	A0A0N7GFF0	Paenibacillus_phage	55.2	8.3e-77
WP_069473274.1|1151980_1152508_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025851649.1|1152725_1154120_+	DNA helicase	NA	A0A2H4IZL9	uncultured_Caudovirales_phage	51.9	2.6e-129
WP_069473276.1|1154254_1155250_+	toprim domain-containing protein	NA	A0A2H4J6E6	uncultured_Caudovirales_phage	46.2	1.8e-71
WP_079890901.1|1155266_1155506_-	helix-turn-helix transcriptional regulator	NA	O64102	Bacillus_phage	39.7	8.0e-07
WP_069473278.1|1155866_1157045_+	hypothetical protein	NA	A0A288WGM1	Bacillus_phage	31.3	2.5e-48
1156269:1156284	attR	TTAAAGGTATCAAGCG	NA	NA	NA	NA
>prophage 3
NZ_CP016395	Bacillus velezensis strain M75 chromosome, complete genome	4007450	1166810	1216326	4007450	terminase,plate,capsid,tail,integrase,protease,portal,holin	Bacillus_phage(42.86%)	62	1177780:1177799	1210178:1210197
WP_069473291.1|1166810_1167173_+	hypothetical protein	NA	A0A140HLL8	Bacillus_phage	36.8	3.3e-12
WP_025851616.1|1167419_1167605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069473292.1|1167609_1167966_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	54.2	2.1e-27
WP_154021543.1|1169148_1169763_+	GIY-YIG nuclease family protein	NA	A0A249XZW2	Enterococcus_phage	67.0	1.4e-66
WP_069473294.1|1170943_1171456_+	HNH endonuclease	NA	A0A1V0DYB1	Dinoroseobacter_phage	42.9	3.3e-13
WP_076982823.1|1171490_1172456_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	F8WQ21	Bacillus_phage	77.7	1.7e-143
WP_154021544.1|1172566_1172713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069473295.1|1172709_1173333_+	deoxyuridine 5'-triphosphate nucleotidohydrolase	NA	D2XR49	Bacillus_phage	54.8	2.8e-43
WP_069473297.1|1173556_1173835_+	hypothetical protein	NA	A0A2D0YUP5	Vibrio_phage	47.8	7.1e-15
WP_069473676.1|1173850_1174600_+	FAD-dependent thymidylate synthase	NA	A0A142F1S2	Bacillus_phage	69.6	2.6e-88
WP_069473298.1|1174626_1175193_+	3D domain-containing protein	NA	A0A142F1S8	Bacillus_phage	61.8	6.8e-28
WP_069473299.1|1175211_1175757_+	SprT-like domain-containing protein	NA	NA	NA	NA	NA
WP_155759827.1|1175698_1175869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069473300.1|1175869_1176682_+	hypothetical protein	NA	A0A1P8CWY7	Bacillus_phage	53.7	3.2e-31
WP_069473301.1|1176779_1177355_+	hypothetical protein	NA	M4HPU2	Bacillus_phage	38.9	9.2e-33
WP_128969811.1|1177337_1177730_-	hypothetical protein	NA	NA	NA	NA	NA
1177780:1177799	attL	AAACGAAAAGGGGACGATTT	NA	NA	NA	NA
WP_069473302.1|1177846_1179025_+	N-6 DNA methylase	NA	A0A0N9ST12	Paenibacillus_phage	65.3	2.0e-146
WP_069473304.1|1179441_1179984_+	hypothetical protein	NA	A0A0N7GFF4	Paenibacillus_phage	45.6	8.5e-20
WP_069473305.1|1180071_1180872_+	hypothetical protein	NA	A0A0N9S810	Paenibacillus_phage	54.6	9.1e-71
WP_154021545.1|1180985_1181147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013351549.1|1181172_1181352_-	hypothetical protein	NA	A0A1P8CWV7	Bacillus_phage	81.4	1.3e-22
WP_069473306.1|1181482_1181920_-	hypothetical protein	NA	A0A2H4J8A0	uncultured_Caudovirales_phage	72.3	4.7e-53
WP_069473307.1|1182025_1182229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079890902.1|1182590_1184354_-	right-handed parallel beta-helix repeat-containing protein	NA	F8WPS8	Bacillus_phage	47.7	2.6e-150
WP_069473308.1|1184353_1185151_-	poly-gamma-glutamate hydrolase family protein	NA	O64134	Bacillus_phage	48.5	1.2e-54
WP_069473309.1|1185281_1185506_+	helix-turn-helix transcriptional regulator	NA	D0R7I7	Paenibacillus_phage	71.8	6.2e-09
WP_069473310.1|1185604_1186627_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	44.1	2.5e-12
WP_154021546.1|1187615_1187777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069473311.1|1188009_1188279_+	hypothetical protein	NA	A0A1S5SBT9	Streptococcus_phage	53.6	6.7e-18
WP_069473312.1|1188361_1188562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069473313.1|1188581_1188845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069473314.1|1189042_1189591_-|integrase	site-specific integrase	integrase	A0A2H4J6I5	uncultured_Caudovirales_phage	51.6	2.4e-38
WP_014470950.1|1189673_1191428_+|terminase	phage terminase large subunit	terminase	A0A2H4J484	uncultured_Caudovirales_phage	71.6	5.7e-251
WP_069473315.1|1191444_1191876_+	hypothetical protein	NA	A0A2H4J6Z8	uncultured_Caudovirales_phage	50.4	1.7e-31
WP_069473316.1|1191878_1193510_+|portal	phage portal protein	portal	A0A2H4J180	uncultured_Caudovirales_phage	58.4	1.5e-168
WP_069473317.1|1193509_1194334_+|capsid	minor capsid protein	capsid	A0A0N9SJR1	Paenibacillus_phage	52.7	3.1e-74
WP_069473318.1|1194423_1195095_+|protease	Clp protease ClpB	protease	A0A2H4IZP8	uncultured_Caudovirales_phage	46.0	7.8e-15
WP_069473319.1|1195106_1196210_+	DUF5309 family protein	NA	A0A2I7S650	Vibrio_phage	27.0	1.4e-29
WP_069473320.1|1196518_1196737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069473321.1|1196751_1197138_+	hypothetical protein	NA	A0A0N9SGG4	Paenibacillus_phage	39.8	2.1e-20
WP_069473322.1|1197138_1197474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069473323.1|1197470_1197878_+	hypothetical protein	NA	A0A0N9SJT1	Paenibacillus_phage	53.7	8.0e-31
WP_069473324.1|1197884_1198274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013351570.1|1198298_1198853_+	hypothetical protein	NA	A0A0N9SHI3	Paenibacillus_phage	58.4	4.0e-49
WP_069473325.1|1198910_1199282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079890903.1|1199614_1202413_+|tail	phage tail tape measure protein	tail	A0A0N9SJR9	Paenibacillus_phage	39.1	7.3e-99
WP_069473326.1|1202419_1203844_+|tail	phage tail family protein	tail	A0A2H4JBY6	uncultured_Caudovirales_phage	44.0	1.1e-61
WP_069473327.1|1203855_1205256_+|tail	phage tail protein	tail	A6M966	Geobacillus_virus	31.2	8.6e-40
WP_069473328.1|1205270_1207835_+	peptidase G2	NA	D6R401	Bacillus_phage	74.6	0.0e+00
WP_076982805.1|1207847_1209431_+|plate	BppU family phage baseplate upper protein	plate	M4ZRP1	Bacillus_phage	52.8	6.0e-58
WP_014470931.1|1209445_1209715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069473329.1|1209715_1209904_+	XkdX family protein	NA	NA	NA	NA	NA
WP_045509347.1|1209907_1210117_+	hypothetical protein	NA	A0A290GDY2	Caldibacillus_phage	45.1	3.4e-09
WP_069473330.1|1210198_1211137_+	N-acetylmuramoyl-L-alanine amidase	NA	Q9ZXD7	Bacillus_phage	62.3	5.6e-96
1210178:1210197	attR	AAACGAAAAGGGGACGATTT	NA	NA	NA	NA
WP_069473331.1|1211158_1211416_+|holin	holin	holin	A0A0U4JE55	Bacillus_phage	57.6	5.0e-23
WP_069473332.1|1211543_1211909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069473333.1|1211923_1212259_-	YolD-like family protein	NA	O64030	Bacillus_phage	33.7	9.9e-11
WP_069473334.1|1212318_1212564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069473335.1|1212588_1212795_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_069473336.1|1212926_1213712_+	helix-turn-helix domain-containing protein	NA	A0A288WFX2	Bacillus_phage	29.5	8.2e-16
WP_060386872.1|1214143_1214500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069473337.1|1214496_1216326_-	EndoU domain-containing protein	NA	A0A1P8CWI7	Bacillus_phage	60.2	8.3e-128
>prophage 4
NZ_CP016395	Bacillus velezensis strain M75 chromosome, complete genome	4007450	1272092	1303898	4007450	terminase,plate,capsid,tail,portal,holin	Bacillus_phage(32.26%)	44	NA	NA
WP_087920760.1|1272092_1273229_+	S9 family peptidase	NA	A0A1P8CWN8	Bacillus_phage	47.9	1.3e-94
WP_003154881.1|1273218_1273353_+	PhrA family phosphatase inhibitor	NA	NA	NA	NA	NA
WP_003154880.1|1273495_1274449_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A218KC88	Bacillus_phage	69.3	1.1e-62
WP_003154878.1|1274486_1274864_-	PH domain-containing protein	NA	A5GYQ0	Lactococcus_phage	40.6	1.1e-15
WP_003154876.1|1274963_1275569_+	poly-gamma-glutamate hydrolase family protein	NA	A0A0Y0AJU6	Bacillus_phage	46.8	7.4e-41
WP_003154875.1|1275558_1275708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003154873.1|1275723_1276314_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	51.7	3.0e-39
WP_003154871.1|1276462_1276801_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	45.8	8.4e-18
WP_003154869.1|1276992_1277172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003154867.1|1277161_1277989_+|portal	phage portal protein	portal	S6BFM4	Thermus_phage	27.9	6.4e-19
WP_003154865.1|1277888_1278689_+	ATP-binding protein	NA	A6XMI1	Bacillus_virus	45.1	3.6e-59
WP_003154863.1|1278688_1278856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003154861.1|1278953_1279295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003154859.1|1279284_1279488_+	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	48.5	5.4e-12
WP_069473351.1|1279601_1280114_+	sigma-70 family RNA polymerase sigma factor	NA	A0A0K2CNQ1	Brevibacillus_phage	43.9	2.9e-22
WP_069473352.1|1280226_1281024_+|terminase	terminase small subunit	terminase	A0A0S2MVB6	Bacillus_phage	49.8	7.2e-60
WP_069473353.1|1281020_1282319_+|terminase	PBSX family phage terminase large subunit	terminase	M4ZRM5	Bacillus_phage	58.9	1.6e-149
WP_154021550.1|1282367_1283759_+|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	55.4	5.2e-138
WP_015417286.1|1283778_1284624_+	hypothetical protein	NA	A0A1B1P7E4	Bacillus_phage	57.6	4.3e-55
WP_007407274.1|1284650_1285586_+|capsid	phage major capsid protein	capsid	A0A1B1P7E3	Bacillus_phage	62.8	3.3e-104
WP_069473355.1|1285602_1285986_+	DUF3199 family protein	NA	NA	NA	NA	NA
WP_007610806.1|1285982_1286339_+	DUF3599 family protein	NA	NA	NA	NA	NA
WP_069473356.1|1286335_1286839_+	HK97 gp10 family phage protein	NA	A0A249XXA4	Clostridium_phage	41.0	3.2e-37
WP_069473357.1|1286835_1287282_+|portal	phage portal protein	portal	NA	NA	NA	NA
WP_063095512.1|1287278_1287488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069473358.1|1287487_1288885_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A0A7RTT5	Clostridium_phage	40.2	2.0e-81
WP_003154837.1|1288886_1289330_+|tail	phage tail tube protein	tail	A0A0K2CNG3	Brevibacillus_phage	45.2	8.4e-26
WP_032874591.1|1289405_1289852_+|portal	phage portal protein	portal	A0A0A7RTY8	Clostridium_phage	35.8	1.0e-10
WP_015239684.1|1289893_1290046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069473359.1|1290033_1295076_+	transglycosylase SLT domain-containing protein	NA	A0A1L2JY60	Aeribacillus_phage	46.6	1.9e-41
WP_024085190.1|1295068_1295728_+	LysM peptidoglycan-binding domain-containing protein	NA	G3MBQ1	Bacillus_virus	45.3	1.8e-08
WP_058905959.1|1295741_1296719_+	hypothetical protein	NA	A0A1L6BY20	Clostridium_phage	30.6	1.9e-33
WP_003154827.1|1296718_1296985_+	DUF2577 family protein	NA	S6C459	Thermus_phage	37.5	3.4e-06
WP_003154825.1|1297088_1297514_+	DUF2634 domain-containing protein	NA	A0A2H4J6K5	uncultured_Caudovirales_phage	35.9	1.5e-11
WP_003154824.1|1297506_1298553_+|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	44.1	7.7e-70
WP_007407262.1|1298536_1299115_+	YmfQ family protein	NA	A0A2H4J717	uncultured_Caudovirales_phage	31.0	3.1e-12
WP_069473360.1|1299111_1299384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069473361.1|1299386_1301009_+	hypothetical protein	NA	A0A1P8CWR7	Bacillus_phage	39.3	4.0e-41
WP_014304856.1|1301021_1301393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003154819.1|1301398_1301596_+	XkdX family protein	NA	A0A2H4JAA1	uncultured_Caudovirales_phage	61.8	4.3e-14
WP_033575307.1|1301652_1302414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003154815.1|1302465_1302729_+	hemolysin XhlA family protein	NA	A0A2H4JD40	uncultured_Caudovirales_phage	63.1	8.8e-23
WP_003154813.1|1302742_1303006_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	65.5	2.3e-23
WP_024085195.1|1303019_1303898_+	N-acetylmuramoyl-L-alanine amidase	NA	Q9ZXD7	Bacillus_phage	60.5	4.8e-81
>prophage 5
NZ_CP016395	Bacillus velezensis strain M75 chromosome, complete genome	4007450	1858411	1864625	4007450		Bacillus_phage(50.0%)	6	NA	NA
WP_014305044.1|1858411_1858804_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	G3MBF1	Bacillus_virus	59.1	6.5e-30
WP_003154060.1|1858763_1860866_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	U5PY35	Bacillus_phage	86.0	0.0e+00
WP_024085331.1|1860883_1861873_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	F8WQ21	Bacillus_phage	83.3	2.5e-155
WP_046341259.1|1861921_1862542_+	hypothetical protein	NA	A0A127AYS1	Bacillus_phage	46.9	7.9e-46
WP_015388201.1|1862591_1863350_-	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	50.4	1.1e-52
WP_015417523.1|1863656_1864625_+	stage V sporulation protein K	NA	G3MAX6	Bacillus_virus	40.9	8.0e-53
>prophage 6
NZ_CP016395	Bacillus velezensis strain M75 chromosome, complete genome	4007450	2048707	2090989	4007450	terminase,head,plate,capsid,tail,integrase,protease,portal,holin	Bacillus_phage(51.43%)	53	2089375:2089390	2091346:2091361
WP_069473450.1|2048707_2050534_+	HNH endonuclease	NA	A0A1P8CWI7	Bacillus_phage	41.0	9.9e-105
WP_041481866.1|2050549_2050990_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_014305124.1|2051182_2051875_+	hypothetical protein	NA	Q9AZW5	Lactococcus_phage	31.9	4.1e-11
WP_044053296.1|2051981_2052995_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1J0MS59	Bacillus_phage	96.1	4.1e-185
WP_014305126.1|2053051_2053315_-|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	69.0	1.1e-25
WP_003220204.1|2053329_2053542_-	hypothetical protein	NA	A0A290GDY2	Caldibacillus_phage	59.4	1.4e-15
WP_014305127.1|2053593_2053782_-	XkdX family protein	NA	Q9ZXD9	Bacillus_phage	96.8	4.1e-30
WP_014305128.1|2053778_2054141_-	hypothetical protein	NA	Q9ZXE0	Bacillus_phage	90.8	7.1e-55
WP_044053297.1|2054137_2055415_-|plate	BppU family phage baseplate upper protein	plate	D6R402	Bacillus_phage	78.1	8.9e-145
WP_044053298.1|2055427_2057992_-	peptidase G2	NA	D6R401	Bacillus_phage	56.9	2.8e-286
WP_044053299.1|2058042_2059746_-|tail	phage tail protein	tail	D6R400	Bacillus_phage	56.9	1.6e-181
WP_044053300.1|2059760_2060600_-|tail	phage tail family protein	tail	D6R3Z9	Bacillus_phage	58.3	6.2e-94
WP_044053301.1|2060593_2065081_-|tail	phage tail tape measure protein	tail	A0A1Q1PVX7	Staphylococcus_phage	42.5	1.1e-64
WP_014305136.1|2065286_2065655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014305137.1|2065713_2066328_-|tail	tail protein	tail	A0A2H4J8F3	uncultured_Caudovirales_phage	34.4	2.9e-24
WP_014305138.1|2066342_2066726_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_014305139.1|2066722_2067121_-	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_044053302.1|2067117_2067435_-|head	phage head closure protein	head	A0A2H4JCB1	uncultured_Caudovirales_phage	34.3	4.6e-10
WP_014305141.1|2067424_2067727_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0S2GLH6	Bacillus_phage	40.5	2.6e-10
WP_044053303.1|2067744_2068143_-	collagen-like protein	NA	D6R3Z0	Bacillus_phage	44.5	1.1e-11
WP_044053304.1|2068170_2069463_-|capsid	phage major capsid protein	capsid	A0A0A7RTL2	Clostridium_phage	46.9	1.7e-90
WP_014305144.1|2069501_2070131_-|head,protease	HK97 family phage prohead protease	head,protease	Q9ZXF7	Bacillus_phage	75.8	3.1e-82
WP_044053305.1|2070093_2071374_-|portal	phage portal protein	portal	D6R3Y6	Bacillus_phage	63.1	2.6e-152
WP_044053306.1|2071562_2073272_-|terminase	terminase large subunit	terminase	A0A0S2GLF0	Bacillus_phage	62.4	3.0e-204
WP_014305148.1|2073268_2073784_-|terminase	phage terminase small subunit P27 family	terminase	A6M947	Geobacillus_virus	44.0	2.2e-33
WP_044053595.1|2074010_2074376_-	HNH endonuclease	NA	A0A1U7Q1S7	Geobacillus_virus	52.5	9.7e-28
WP_044053307.1|2074457_2074988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044053308.1|2074987_2076322_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_044053309.1|2076595_2077099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038458303.1|2077336_2077879_-|integrase	tyrosine-type recombinase/integrase	integrase	D2XR58	Bacillus_phage	65.6	1.2e-61
WP_044053596.1|2077875_2078328_-	ArpU family transcriptional regulator	NA	S6AVV9	Thermus_phage	57.4	5.7e-38
WP_164691645.1|2078382_2078559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044053310.1|2078650_2079109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044053311.1|2079618_2079984_-	hypothetical protein	NA	H6WU17	Pseudomonas_phage	59.5	6.8e-05
WP_044053312.1|2080090_2080435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044053313.1|2080532_2081357_-	DNA adenine methylase	NA	Q8W5X3	Listeria_phage	48.4	2.2e-64
WP_043867112.1|2081361_2081619_-	hypothetical protein	NA	F8WQ54	Bacillus_phage	42.3	9.6e-06
WP_044053314.1|2081615_2081990_-	hypothetical protein	NA	K4I239	Lactobacillus_phage	41.7	9.0e-05
WP_024085436.1|2082654_2082858_-	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	55.4	7.5e-14
WP_024085437.1|2082937_2083093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024085438.1|2083105_2083246_-	BH0509 family protein	NA	NA	NA	NA	NA
WP_024085439.1|2083353_2083902_-	hypothetical protein	NA	A0A0K2CYJ0	Paenibacillus_phage	36.5	2.0e-05
WP_024085440.1|2083898_2084057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024085441.1|2084053_2084203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038458325.1|2084217_2085051_-	ATP-binding protein	NA	Q2I8C8	Bacillus_phage	34.8	3.5e-33
WP_024085443.1|2085034_2085907_-	phage replisome organizer N-terminal domain-containing protein	NA	V5UQV4	Oenococcus_phage	45.2	8.5e-46
WP_024085444.1|2085893_2086118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014305165.1|2086135_2086459_-	DUF771 domain-containing protein	NA	Q9MC19	Lactococcus_phage	40.7	4.6e-13
WP_044053315.1|2086525_2086729_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014305167.1|2086893_2087292_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_044053316.1|2087720_2088821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044053317.1|2089063_2090170_+|integrase	site-specific integrase	integrase	Q5YAA6	Bacillus_phage	57.8	3.9e-112
2089375:2089390	attL	TCAAGAGTTTTTAAAT	NA	NA	NA	NA
WP_003153850.1|2090443_2090989_-|integrase	site-specific integrase	integrase	A0A0S2GLG4	Bacillus_phage	48.6	2.1e-42
WP_003153850.1|2090443_2090989_-|integrase	site-specific integrase	integrase	A0A0S2GLG4	Bacillus_phage	48.6	2.1e-42
2091346:2091361	attR	ATTTAAAAACTCTTGA	NA	NA	NA	NA
>prophage 7
NZ_CP016395	Bacillus velezensis strain M75 chromosome, complete genome	4007450	2197409	2210557	4007450		Bacillus_phage(90.91%)	15	NA	NA
WP_024085504.1|2197409_2197784_+	hypothetical protein	NA	A0A1P8CWZ2	Bacillus_phage	52.8	2.8e-30
WP_025852486.1|2198030_2198483_-	hypothetical protein	NA	O64117	Bacillus_phage	77.3	3.7e-61
WP_043867220.1|2198846_2199983_+	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	76.4	3.1e-165
WP_003153655.1|2199972_2200155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043867221.1|2200480_2201500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014305240.1|2201560_2201920_-	hypothetical protein	NA	O64028	Bacillus_phage	60.5	3.7e-32
WP_024085506.1|2201925_2202393_-	DUF4879 domain-containing protein	NA	O64027	Bacillus_phage	57.1	1.0e-42
WP_014305242.1|2202951_2203290_-	hypothetical protein	NA	A0A1P8CWM9	Bacillus_phage	56.2	1.1e-25
WP_014305245.1|2204051_2204648_-	SMI1/KNR4 family protein	NA	O64025	Bacillus_phage	84.6	9.4e-89
WP_014305246.1|2204702_2205161_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_043867222.1|2205175_2206975_-	ribonuclease YeeF family protein	NA	A0A1P8CWI7	Bacillus_phage	64.8	1.7e-170
WP_043867641.1|2207073_2207631_-	SMI1/KNR4 family protein	NA	O64022	Bacillus_phage	82.7	1.4e-89
WP_041482372.1|2207910_2208219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069473456.1|2208276_2209944_+	recombinase family protein	NA	O64015	Bacillus_phage	89.2	6.6e-273
WP_032857070.1|2209966_2210557_+	polysaccharide biosynthesis protein	NA	A0A2P1ELS8	Moumouvirus	31.1	2.9e-13
>prophage 8
NZ_CP016395	Bacillus velezensis strain M75 chromosome, complete genome	4007450	2344332	2350585	4007450		Staphylococcus_phage(66.67%)	9	NA	NA
WP_003153378.1|2344332_2344926_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	36.6	2.6e-14
WP_003153377.1|2344915_2345671_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	25.3	6.5e-10
WP_003153376.1|2345878_2345968_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_012117889.1|2346055_2346577_+	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_003153373.1|2346642_2347017_-	GNAT family N-acetyltransferase RibT	NA	NA	NA	NA	NA
WP_003153372.1|2347133_2347598_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	59.3	1.2e-43
WP_032857112.1|2347630_2348827_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	54.9	8.2e-116
WP_032857114.1|2348841_2349489_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	44.3	3.3e-39
WP_024085544.1|2349469_2350585_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	36.9	5.2e-56
>prophage 9
NZ_CP016395	Bacillus velezensis strain M75 chromosome, complete genome	4007450	2701980	2761863	4007450	protease,coat,tRNA	uncultured_Mediterranean_phage(25.0%)	60	NA	NA
WP_007408194.1|2701980_2702424_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_003152716.1|2702436_2704641_-	GTP diphosphokinase	NA	A0A2I2L310	Orpheovirus	34.8	1.5e-09
WP_003152714.1|2704798_2705311_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.2	5.5e-29
WP_058906213.1|2705316_2707677_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	34.8	1.1e-90
WP_003152709.1|2707732_2708059_-	DUF1049 domain-containing protein	NA	NA	NA	NA	NA
WP_003152707.1|2708122_2708620_-	cation:proton antiporter regulatory subunit	NA	NA	NA	NA	NA
WP_003152704.1|2708750_2710970_-	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	31.7	2.0e-27
WP_003152702.1|2711006_2711303_-	post-transcriptional regulator	NA	NA	NA	NA	NA
WP_003152700.1|2711418_2712975_+	stage V sporulation protein B	NA	NA	NA	NA	NA
WP_003152699.1|2712982_2713639_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_003152697.1|2713805_2714192_+	TIGR04086 family membrane protein	NA	NA	NA	NA	NA
WP_003152695.1|2714243_2714504_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	46.9	1.5e-06
WP_014305500.1|2714534_2715680_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	44.8	8.1e-89
WP_003152692.1|2715707_2716736_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_003152687.1|2716761_2716962_-	DUF2905 domain-containing protein	NA	NA	NA	NA	NA
WP_003152685.1|2716954_2717959_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	30.0	4.0e-07
WP_003152683.1|2717969_2718575_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_046559922.1|2718709_2719219_-	BofC C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_046559923.1|2719349_2719589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003152677.1|2719602_2720196_-	YhcN/YlaJ family sporulation lipoprotein	NA	NA	NA	NA	NA
WP_069473523.1|2720343_2721534_-|coat	SafA/ExsA family spore coat assembly protein	coat	NA	NA	NA	NA
WP_024085652.1|2721660_2722764_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_060657406.1|2722765_2723614_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_069473524.1|2723595_2725161_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_003152670.1|2725266_2726418_+	IscS subfamily cysteine desulfurase	NA	A0A1X7C038	Faustovirus	27.2	4.6e-31
WP_014305508.1|2726414_2726957_+	transcription repressor NadR	NA	NA	NA	NA	NA
WP_003152668.1|2726985_2727843_-	prephenate dehydratase	NA	NA	NA	NA	NA
WP_007408173.1|2727856_2728300_-	transcriptional regulator ThrR	NA	NA	NA	NA	NA
WP_003152665.1|2728353_2729640_-	GTPase ObgE	NA	NA	NA	NA	NA
WP_003152664.1|2729671_2730250_-	Spo0B domain-containing protein	NA	NA	NA	NA	NA
WP_003152662.1|2730567_2730852_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_012118103.1|2730864_2731206_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_003152660.1|2731208_2731517_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_003152659.1|2731662_2732529_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003152657.1|2732521_2733325_-	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_003152655.1|2733452_2734256_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_032856922.1|2734258_2734939_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_003152650.1|2734992_2735511_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_032856925.1|2735507_2736371_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_003152647.1|2736401_2737415_-	rod shape-determining protein MreB	NA	NA	NA	NA	NA
WP_003152646.1|2737506_2738202_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_014305513.1|2738233_2738803_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_003152644.1|2738943_2739945_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_003152643.1|2740071_2740824_-	prepilin peptidase	NA	NA	NA	NA	NA
WP_069473525.1|2740963_2742256_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_003152640.1|2742314_2744957_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	42.2	3.7e-161
WP_003152639.1|2745409_2745601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012118110.1|2745615_2746638_-|coat	spore coat protein YsxE	coat	NA	NA	NA	NA
WP_069473526.1|2746671_2748585_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003152633.1|2748717_2750007_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_003152632.1|2750035_2751010_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_014305519.1|2751012_2751795_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_003152630.1|2751784_2752726_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_003152629.1|2752760_2753591_-	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_003152628.1|2753598_2754966_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_003152627.1|2755160_2755652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003152626.1|2755684_2756272_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_003152624.1|2756268_2758593_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	44.3	8.0e-184
WP_003152622.1|2758792_2760451_-|protease	ATP-dependent protease LonB	protease	A0A167RA83	Powai_lake_megavirus	32.7	1.9e-14
WP_003152620.1|2760600_2761863_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	65.3	4.2e-147
