The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP017107	Ligilactobacillus salivarius strain CICC 23174 chromosome, complete genome	1746897	141010	152917	1746897		Catovirus(12.5%)	13	NA	NA
WP_069468635.1|141010_141937_+	YegS/Rv2252/BmrU family lipid kinase	NA	A0A1V0SBJ0	Catovirus	26.8	1.0e-09
WP_069468636.1|141985_142702_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_069468637.1|142804_143215_+	peptide deformylase	NA	A0A2I7S809	Vibrio_phage	35.6	2.2e-12
WP_069468638.1|143228_144320_+	phosphoesterase	NA	NA	NA	NA	NA
WP_069468639.1|144337_145174_+	DUF72 domain-containing protein	NA	A0A1V0CNL1	Kaumoebavirus	30.1	2.6e-12
WP_003708339.1|145215_145584_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	A0A2P0ZKX3	Lactobacillus_phage	35.1	7.5e-12
WP_069468640.1|145599_145848_-	antitoxin	NA	NA	NA	NA	NA
WP_069468641.1|145894_147010_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	32.1	5.6e-34
WP_003705727.1|147028_147436_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_003710747.1|147565_149044_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	36.8	1.4e-64
WP_069468642.1|149179_150550_-	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
WP_069469482.1|150687_151458_-	TIGR02452 family protein	NA	G3MBH6	Bacillus_virus	31.2	2.0e-22
WP_003704255.1|151603_152917_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	33.7	2.5e-49
>prophage 2
NZ_CP017107	Ligilactobacillus salivarius strain CICC 23174 chromosome, complete genome	1746897	515143	528364	1746897	transposase	Bacillus_virus(25.0%)	11	NA	NA
WP_044004262.1|515143_517066_-	asparagine synthase (glutamine-hydrolyzing)	NA	R4TIC1	Phaeocystis_globosa_virus	27.3	3.9e-27
WP_069469490.1|517304_518087_-	M23 family metallopeptidase	NA	A0A7K9	Microcystis_virus	37.5	2.6e-06
WP_069468837.1|518314_519328_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_069468838.1|519542_520820_-|transposase	transposase	transposase	A0A286QQE5	Streptococcus_phage	35.7	1.5e-54
WP_003706986.1|520919_521351_+|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	48.0	6.1e-29
WP_034982741.1|521543_522407_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	26.8	5.5e-21
WP_003701427.1|522457_522694_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_003703384.1|522715_523267_-	single-stranded DNA-binding protein	NA	A8ASP5	Listeria_phage	53.6	1.1e-43
WP_003703382.1|523307_523598_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_069468839.1|523816_526369_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	34.7	2.5e-114
WP_069468840.1|526405_528364_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	44.8	1.2e-140
>prophage 3
NZ_CP017107	Ligilactobacillus salivarius strain CICC 23174 chromosome, complete genome	1746897	806994	811048	1746897		Staphylococcus_phage(50.0%)	7	NA	NA
WP_003705375.1|806994_807318_+	thioredoxin	NA	A0A1X9I9P5	Staphylococcus_phage	39.4	2.5e-19
WP_069469495.1|807375_807765_+	CrcB family protein	NA	A0A2H4PQR0	Staphylococcus_phage	33.3	4.2e-05
WP_069469009.1|807761_808106_+	fluoride efflux transporter CrcB	NA	A0A2H4PQR0	Staphylococcus_phage	37.1	1.2e-08
WP_069469010.1|808177_809050_+	DegV family protein	NA	NA	NA	NA	NA
WP_003701672.1|809551_810049_+	QueT transporter family protein	NA	E7DN70	Pneumococcus_phage	36.7	1.3e-14
WP_003701248.1|810062_810290_+	DUF2829 domain-containing protein	NA	G3MBC9	Bacillus_virus	37.0	2.2e-06
WP_003705371.1|810289_811048_+	3-oxoacyl-ACP reductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	30.0	1.8e-12
>prophage 4
NZ_CP017107	Ligilactobacillus salivarius strain CICC 23174 chromosome, complete genome	1746897	1056323	1065345	1746897		Enterococcus_phage(33.33%)	11	NA	NA
WP_003703365.1|1056323_1058495_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	64.0	7.0e-267
WP_003700671.1|1058475_1058859_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	R4JF54	Bacillus_phage	38.7	5.8e-15
WP_003700670.1|1058855_1059086_-	glutaredoxin-like protein NrdH	NA	X2KRY7	Enterococcus_phage	40.3	2.7e-12
WP_069469117.1|1059287_1059899_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_044005603.1|1059945_1060413_+	nucleoside deaminase	NA	NA	NA	NA	NA
WP_069469118.1|1060618_1062358_+	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	38.9	3.9e-58
WP_080550229.1|1062375_1062690_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_003700665.1|1062716_1063316_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_011476227.1|1063329_1063569_+	YaaL family protein	NA	NA	NA	NA	NA
WP_069469119.1|1063688_1064315_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	51.5	1.2e-49
WP_069469120.1|1064349_1065345_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	30.6	5.0e-34
>prophage 5
NZ_CP017107	Ligilactobacillus salivarius strain CICC 23174 chromosome, complete genome	1746897	1448918	1529437	1746897	protease,portal,integrase,tail,capsid,tRNA,head,terminase,plate	Lactobacillus_phage(17.95%)	92	1471191:1471236	1520923:1520968
WP_003700152.1|1448918_1449365_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_003710060.1|1449379_1451599_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	U5J9N6	Bacillus_phage	40.6	7.5e-14
WP_003700150.1|1451638_1452370_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_069469309.1|1452369_1453260_-	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_069469310.1|1453276_1453789_-	DUF3013 family protein	NA	NA	NA	NA	NA
WP_069469311.1|1454043_1455006_+	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_003700144.1|1455512_1455983_-	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_003700143.1|1455999_1456641_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	39.6	1.3e-35
WP_069469313.1|1456663_1457803_-	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_069469314.1|1457955_1460373_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_069469315.1|1460379_1461426_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	37.4	3.1e-26
WP_003700136.1|1461771_1462119_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003700135.1|1462260_1462785_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_069469316.1|1462890_1463652_-	RNA methyltransferase	NA	NA	NA	NA	NA
WP_014568368.1|1463786_1464275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041822761.1|1464271_1464454_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081325489.1|1464792_1464999_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_034982471.1|1465180_1465606_+	helix-turn-helix domain-containing protein	NA	A0A2P1JU09	Anoxybacillus_phage	43.3	4.4e-24
WP_034982470.1|1465619_1466045_+	ImmA/IrrE family metallo-endopeptidase	NA	Q9T201	Bacillus_phage	36.7	1.7e-07
WP_101494843.1|1466109_1466721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069469319.1|1466746_1467277_+	PH domain-containing protein	NA	A0A0F6N4L7	Staphylococcus_phage	45.5	1.1e-27
WP_069469507.1|1467323_1467887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034982467.1|1467892_1468090_+	hypothetical protein	NA	Q9T1Z0	Lactococcus_phage	64.5	1.1e-14
WP_069469320.1|1468091_1469186_+	NINE protein	NA	A0A0A8WJ41	Clostridium_phage	31.3	1.2e-17
1471191:1471236	attL	AAAATCACCTATAAACGTTATTATATCAACGTTTATAGGTGATTTT	NA	NA	NA	NA
WP_069469321.1|1471450_1472719_-	LysM peptidoglycan-binding domain-containing protein	NA	Q6EVN0	Oenoccocus_phage	57.1	2.1e-125
WP_069469322.1|1472731_1473058_-	hypothetical protein	NA	A0A2H4PBB2	Lactobacillus_phage	51.9	2.6e-08
WP_069469323.1|1473054_1473384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069469324.1|1473434_1476344_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_069469325.1|1476358_1477441_-|plate	BppU family phage baseplate upper protein	plate	NA	NA	NA	NA
WP_069469326.1|1477440_1477869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069469327.1|1477849_1478056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069469328.1|1478059_1479922_-|tail	phage tail protein	tail	E9LUJ4	Lactobacillus_phage	32.7	1.2e-97
WP_069469329.1|1479921_1480737_-|tail	phage tail family protein	tail	E9LUJ3	Lactobacillus_phage	41.2	3.0e-45
WP_069469330.1|1486210_1486600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069469331.1|1486599_1487232_-|tail	phage tail protein	tail	A0A060AKE9	Staphylococcus_phage	28.8	9.6e-15
WP_069469332.1|1487243_1487615_-|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
WP_069469509.1|1487611_1488043_-	HK97 gp10 family phage protein	NA	A0A0S2MY48	Enterococcus_phage	31.7	4.1e-09
WP_069469333.1|1488054_1488399_-|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
WP_069469334.1|1488388_1488709_-|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_069469335.1|1488927_1490055_-|capsid	phage major capsid protein	capsid	A0A0K2CZ99	Paenibacillus_phage	49.1	1.0e-88
WP_069469510.1|1490051_1490756_-|protease	Clp protease ClpP	protease	A0A0K2CZ28	Paenibacillus_phage	58.9	2.1e-71
WP_069469336.1|1490727_1491981_-|portal	phage portal protein	portal	A0A0K2CZB0	Paenibacillus_phage	45.7	3.1e-97
WP_081325461.1|1491995_1493762_-|terminase	terminase large subunit	terminase	F8J1B1	Lactobacillus_phage	59.4	1.7e-202
WP_069469337.1|1493751_1494204_-|terminase	phage terminase small subunit P27 family	terminase	A6M947	Geobacillus_virus	38.3	1.6e-19
WP_069469338.1|1494327_1494657_-	HNH endonuclease	NA	A0A2K9VBV6	Staphylococcus_phage	53.3	1.3e-18
WP_069469339.1|1494658_1494868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081325462.1|1495102_1495513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069469340.1|1496117_1496435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069469341.1|1496452_1496758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069469342.1|1496761_1497421_-	methylase	NA	NA	NA	NA	NA
WP_155762315.1|1497437_1497599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069469344.1|1497755_1498082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081325463.1|1498441_1498645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069469345.1|1498662_1498965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069469347.1|1499144_1499378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069469348.1|1499427_1499676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069469349.1|1499728_1500037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069469350.1|1500075_1500729_-	N-6 DNA methylase	NA	B7T0H3	Staphylococcus_virus	47.6	5.2e-48
WP_069469351.1|1500741_1501674_-|integrase	site-specific integrase	integrase	A8ATM2	Listeria_phage	45.5	1.9e-75
WP_069469352.1|1501696_1502149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069469353.1|1502145_1503093_-|integrase	site-specific integrase	integrase	A8ATM2	Listeria_phage	39.1	3.7e-55
WP_069469354.1|1503094_1503706_-	HNH endonuclease	NA	A0A1S5SDS7	Streptococcus_phage	37.7	3.4e-25
WP_069469355.1|1503674_1503929_-	hypothetical protein	NA	A0A0E3TAK6	Staphylococcus_phage	41.0	8.0e-05
WP_069469356.1|1504083_1504311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069469357.1|1504297_1504555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069469358.1|1504538_1504799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069469359.1|1504791_1505088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069469360.1|1505087_1506992_-	DNA primase family protein	NA	A0A1B1P7L5	Bacillus_phage	45.0	4.4e-148
WP_069469361.1|1506992_1508690_-	hypothetical protein	NA	A0A1B1P7M5	Bacillus_phage	55.6	1.5e-179
WP_069469362.1|1508872_1509340_-	DUF669 domain-containing protein	NA	A0A2H4J1S8	uncultured_Caudovirales_phage	46.8	3.4e-33
WP_081325464.1|1509360_1511106_-	AAA family ATPase	NA	A0A2H4J7Q2	uncultured_Caudovirales_phage	48.5	7.2e-129
WP_069469363.1|1511027_1511441_-	VRR-NUC domain-containing protein	NA	NA	NA	NA	NA
WP_069469364.1|1511440_1511755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069469365.1|1511751_1511985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069469515.1|1511956_1513180_-	DEAD/DEAH box helicase	NA	A0A2H4J064	uncultured_Caudovirales_phage	52.5	1.6e-114
WP_069469366.1|1513253_1513841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069469368.1|1514058_1514232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069469369.1|1514334_1514646_-	DUF771 domain-containing protein	NA	Q37943	Lactococcus_phage	37.5	3.7e-12
WP_191981189.1|1514824_1515394_-	Rha family transcriptional regulator	NA	A0A0A7DN29	Lactobacillus_phage	65.1	2.8e-29
WP_069469371.1|1515399_1515600_-	helix-turn-helix transcriptional regulator	NA	A0A1S5SDM7	Streptococcus_phage	56.7	2.4e-12
WP_069469372.1|1515638_1515836_-	phage repressor protein	NA	E8ZDN3	Streptococcus_phage	60.6	6.6e-15
WP_069469373.1|1516014_1516740_+	LexA family transcriptional regulator	NA	Q6J1W4	Lactobacillus_phage	36.7	8.1e-34
WP_069469374.1|1516778_1517444_+	Ltp family lipoprotein	NA	A0A2H4J5B8	uncultured_Caudovirales_phage	57.1	2.5e-05
WP_069469375.1|1517465_1517936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069469376.1|1518001_1518280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034982464.1|1519465_1519648_+	hypothetical protein	NA	A0A286QNA2	Streptococcus_phage	67.3	1.6e-10
WP_069469377.1|1519666_1520791_+|integrase	site-specific integrase	integrase	A0A0M9JJ77	Lactobacillus_phage	55.2	2.0e-111
WP_069469378.1|1521185_1523660_-	ATP-dependent RecD-like DNA helicase	NA	A0A0K2FLP8	Brevibacillus_phage	28.0	1.6e-57
1520923:1520968	attR	AAAATCACCTATAAACGTTGATATAATAACGTTTATAGGTGATTTT	NA	NA	NA	NA
WP_069469379.1|1523652_1524321_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_003700129.1|1524336_1524993_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_069469380.1|1526605_1528009_-	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_003700111.1|1528126_1529437_-|tRNA	FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))- methyltransferase TrmFO	tRNA	NA	NA	NA	NA
>prophage 6
NZ_CP017107	Ligilactobacillus salivarius strain CICC 23174 chromosome, complete genome	1746897	1587657	1596429	1746897		Synechococcus_phage(33.33%)	9	NA	NA
WP_049163641.1|1587657_1588245_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	36.9	1.1e-25
WP_069469417.1|1588257_1589295_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	41.7	2.9e-61
WP_069469418.1|1589295_1590747_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.6	1.2e-63
WP_069469419.1|1590722_1592948_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	39.8	5.0e-143
WP_069469420.1|1592949_1593624_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_041822741.1|1593623_1593872_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_003706102.1|1593890_1594604_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4R1E8	Synechococcus_phage	37.8	8.2e-39
WP_069469421.1|1594915_1595950_-	PDZ domain-containing protein	NA	NA	NA	NA	NA
WP_069469422.1|1595946_1596429_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	37.9	2.8e-22
>prophage 1
NZ_CP017108	Ligilactobacillus salivarius strain CICC 23174 plasmid pLS_1	279615	77040	89680	279615	bacteriocin,integrase	Bacillus_phage(100.0%)	16	73740:73755	77899:77914
73740:73755	attL	TAAAAAAATATTTATT	NA	NA	NA	NA
WP_034983677.1|77040_77862_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_049153699.1|78667_79744_-	hypothetical protein	NA	NA	NA	NA	NA
77899:77914	attR	TAAAAAAATATTTATT	NA	NA	NA	NA
WP_143453799.1|79748_80246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034983622.1|80722_81127_-	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_034983620.1|81126_81348_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_049153697.1|81790_82939_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_034983618.1|82954_85114_-	peptide cleavage/export ABC transporter	NA	W8CYL7	Bacillus_phage	27.8	4.0e-44
WP_034983617.1|85324_85522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034983616.1|85766_86006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034983615.1|86042_86837_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_034983613.1|86850_88143_-	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_034983611.1|88144_88264_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_034983610.1|88695_88902_-|bacteriocin	Blp family class II bacteriocin	bacteriocin	NA	NA	NA	NA
WP_003703435.1|88919_89114_-|bacteriocin	Blp family class II bacteriocin	bacteriocin	NA	NA	NA	NA
WP_034983609.1|89119_89377_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_034983607.1|89506_89680_-|bacteriocin	ComC/BlpC family leader-containing pheromone/bacteriocin	bacteriocin	NA	NA	NA	NA
>prophage 2
NZ_CP017108	Ligilactobacillus salivarius strain CICC 23174 plasmid pLS_1	279615	93653	153344	279615	transposase,integrase	Streptococcus_phage(11.76%)	55	102142:102159	155381:155398
WP_044005746.1|93653_94931_-|transposase	transposase	transposase	A0A286QQE5	Streptococcus_phage	35.9	6.6e-55
WP_044005747.1|95030_95462_+|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	45.7	2.0e-27
WP_069469561.1|95503_96709_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_069469562.1|96726_97512_-	carbon-nitrogen family hydrolase	NA	NA	NA	NA	NA
WP_003708605.1|97628_98120_-	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
WP_003703477.1|98146_98461_-	metal-sulfur cluster assembly factor	NA	NA	NA	NA	NA
WP_003703459.1|98477_99359_-	L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha	NA	NA	NA	NA	NA
WP_003703470.1|99371_100034_-	serine dehydratase	NA	NA	NA	NA	NA
WP_003699397.1|100211_101717_-	sodium:solute symporter	NA	NA	NA	NA	NA
WP_069469641.1|101736_102918_-	cation:proton antiporter	NA	NA	NA	NA	NA
102142:102159	attL	CAATTTCTCTTTAAATTT	NA	NA	NA	NA
WP_069469563.1|102927_103659_-	TIM barrel protein	NA	NA	NA	NA	NA
WP_003699392.1|103957_104395_-	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	40.7	3.9e-23
WP_003699389.1|104479_105343_-	ROK family protein	NA	NA	NA	NA	NA
WP_172399972.1|105573_106449_+	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_003699384.1|106469_107159_+	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_003703447.1|107204_108029_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003699382.1|108085_108706_+	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_003703444.1|108876_110358_+	glutamate/gamma-aminobutyrate family transporter YjeM	NA	NA	NA	NA	NA
WP_003708625.1|110413_110521_-	putative metal homeostasis protein	NA	NA	NA	NA	NA
WP_003703463.1|110540_110810_-	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_069469564.1|110997_112932_+	TetM/TetW/TetO/TetS family tetracycline resistance ribosomal protection protein	NA	E4ZFJ7	Streptococcus_phage	29.9	1.5e-63
WP_044005750.1|113089_115081_-	transketolase	NA	NA	NA	NA	NA
WP_069469565.1|115098_115752_-	fructose-6-phosphate aldolase	NA	A0A0E3F5V4	Synechococcus_phage	47.9	3.4e-47
WP_034982945.1|116260_117334_-	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_044005751.1|117356_118406_-	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_034982942.1|118419_119691_-	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_034982941.1|119717_120014_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_003699364.1|120048_120501_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_069469566.1|120682_121483_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.2	1.1e-20
WP_069469567.1|121606_123973_+	phosphoketolase family protein	NA	NA	NA	NA	NA
WP_155762320.1|124253_124682_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	40.1	1.9e-22
WP_069469568.1|125152_125671_-|transposase	transposase	transposase	A0A1B1P776	Bacillus_phage	33.3	1.3e-12
WP_011476690.1|125724_126129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003708637.1|126947_127712_+	replication initiation protein	NA	NA	NA	NA	NA
WP_044005672.1|127997_128990_+	replication initiator protein A	NA	NA	NA	NA	NA
WP_081325498.1|129391_130735_-	IS200/IS605 family accessory protein TnpB-related protein	NA	G3MB42	Bacillus_virus	39.1	3.8e-69
WP_034990560.1|130727_131333_-|transposase	IS607 family transposase	transposase	A0A1V0SJI5	Klosneuvirus	45.5	2.4e-39
WP_034990591.1|131378_131717_-	CAT RNA binding domain-containing protein	NA	NA	NA	NA	NA
WP_003699336.1|132084_132897_+	AAA family ATPase	NA	F0PIG8	Enterococcus_phage	61.0	8.6e-85
WP_003699335.1|132896_133232_+	DUF5388 domain-containing protein	NA	F0PIG7	Enterococcus_phage	34.2	1.3e-07
WP_069469569.1|134019_136554_-	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	26.9	3.0e-67
WP_069469570.1|137256_138111_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	40.7	2.7e-52
WP_069469571.1|138315_138906_-	MarC family protein	NA	NA	NA	NA	NA
WP_069469572.1|139158_140556_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_003710828.1|140621_141062_+|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	62.0	1.1e-41
WP_003708662.1|141486_142608_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	27.0	2.5e-13
WP_069469573.1|142713_143331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003708666.1|143333_144353_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_081325500.1|145900_147358_+	rhamnulokinase	NA	NA	NA	NA	NA
WP_003699292.1|147362_147689_+	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_069469574.1|147701_148967_+	L-rhamnose isomerase	NA	NA	NA	NA	NA
WP_003710833.1|149054_149870_+	rhamnulose-1-phosphate aldolase	NA	NA	NA	NA	NA
WP_069469575.1|150175_151891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003699286.1|152041_152251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069469576.1|152417_153344_-|integrase	site-specific integrase	integrase	A8ATM2	Listeria_phage	44.1	1.5e-72
155381:155398	attR	AAATTTAAAGAGAAATTG	NA	NA	NA	NA
>prophage 3
NZ_CP017108	Ligilactobacillus salivarius strain CICC 23174 plasmid pLS_1	279615	167315	228284	279615	protease,transposase,integrase,bacteriocin	Streptococcus_phage(26.67%)	55	225577:225592	231848:231863
WP_069469585.1|167315_169382_+|protease	protease Lon-related BREX system protein BrxL	protease	NA	NA	NA	NA
WP_047036118.1|169470_170577_+	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_069469586.1|170580_171246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047036120.1|171220_172003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069469587.1|172053_175236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069469588.1|175336_177676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069469589.1|177699_178263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069469590.1|178519_179914_-	amino acid permease	NA	NA	NA	NA	NA
WP_069469591.1|179953_181057_-	alanine dehydrogenase	NA	NA	NA	NA	NA
WP_035149309.1|181444_182212_-	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_069469592.1|182307_182817_-	DUF1836 domain-containing protein	NA	NA	NA	NA	NA
WP_081325502.1|182965_183811_+	DegV family protein	NA	A0A1X9I5J4	Streptococcus_phage	35.0	1.1e-42
WP_069469594.1|183953_184304_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_069469595.1|184324_184561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081325503.1|184467_185247_+	MFS transporter	NA	NA	NA	NA	NA
WP_069469597.1|185637_185946_+	MazG-like protein	NA	NA	NA	NA	NA
WP_003699254.1|186213_186489_-	HU family DNA-binding protein	NA	A0A0H3UZA0	Geobacillus_virus	62.9	4.1e-23
WP_069469598.1|186793_191428_+	S8 family serine peptidase	NA	A0A1B0T6A2	Bacillus_phage	31.2	5.2e-17
WP_003703258.1|191556_191916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003706971.1|191931_192744_+	SPFH domain-containing protein	NA	S4VT23	Pandoravirus	29.7	1.1e-15
WP_034983646.1|193078_193774_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003706982.1|194284_194857_+	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	42.6	3.9e-23
WP_003706984.1|195001_195706_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_003706986.1|195880_196312_-|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	48.0	6.1e-29
WP_069469599.1|196411_197689_+|transposase	transposase	transposase	A0A286QQE5	Streptococcus_phage	36.2	3.0e-55
WP_069469600.1|198073_198307_+	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_069469601.1|198625_200530_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	34.8	1.4e-98
WP_069469602.1|202379_203579_-	MFS transporter	NA	NA	NA	NA	NA
WP_069469603.1|203892_205113_+	MFS transporter	NA	NA	NA	NA	NA
WP_069469604.1|205163_206060_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_069469605.1|206218_207055_+	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_003699078.1|207083_207911_+	SDR family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	26.9	2.4e-18
WP_069469606.1|207929_209645_+	FAD-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	25.3	5.4e-36
WP_034982230.1|209665_210541_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_069469607.1|210553_211312_+	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	30.4	2.2e-21
WP_003703247.1|211361_212459_-	tyrosine recombinase XerS	NA	NA	NA	NA	NA
WP_003710894.1|213008_213221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069469608.1|213839_214079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069469609.1|214119_214344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069469610.1|214435_215410_+	choloylglycine hydrolase family protein	NA	M1HWD6	Paramecium_bursaria_Chlorella_virus	32.2	2.3e-23
WP_003706768.1|215531_216329_-	tyrosine-protein phosphatase	NA	NA	NA	NA	NA
WP_069469611.1|216401_217007_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_069469612.1|217009_218119_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_069469613.1|218118_218868_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_069469614.1|218870_219746_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.8	3.0e-19
WP_069469615.1|220103_220703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069469616.1|221194_221761_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_069469618.1|223250_223577_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_081325506.1|223791_224019_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_191981205.1|224189_224315_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_069469619.1|224307_224550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081325507.1|224739_225102_+|integrase	tyrosine-type recombinase/integrase	integrase	P97010	Streptococcus_pyogenes_phage	40.4	2.1e-14
WP_044005727.1|225362_226046_+	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
225577:225592	attL	ATATTGATGAAGTTGA	NA	NA	NA	NA
WP_011476680.1|226063_226711_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_081325515.1|227171_228284_-|integrase	site-specific integrase	integrase	Q938N9	Temperate_phage	38.7	2.7e-52
231848:231863	attR	TCAACTTCATCAATAT	NA	NA	NA	NA
