The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP016163	Enterococcus faecium strain ISMMS_VRE_11 chromosome, complete genome	2823158	265721	287205	2823158	integrase	Streptococcus_phage(88.24%)	23	262678:262693	274294:274309
262678:262693	attL	TCGGAACTTTTCTTTG	NA	NA	NA	NA
WP_002298578.1|265721_267287_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	30.6	3.5e-18
WP_000237797.1|267354_268548_-|integrase	site-specific integrase	integrase	A0A0S2MV79	Bacillus_phage	34.2	8.3e-44
WP_000633907.1|268574_268775_-	DUF3173 family protein	NA	NA	NA	NA	NA
WP_000845143.1|269272_269503_-	helix-turn-helix domain-containing protein	NA	A0A1S5SEX1	Streptococcus_phage	78.9	1.0e-27
WP_000804879.1|269499_269922_-	sigma-70 family RNA polymerase sigma factor	NA	A0A1S5SEW0	Streptococcus_phage	68.6	7.5e-48
WP_001227350.1|270452_270806_+	helix-turn-helix transcriptional regulator	NA	A0A1S5SFA6	Streptococcus_phage	89.7	2.2e-53
WP_032506803.1|270863_271052_-	conjugal transfer protein	NA	D0R0F6	Streptococcus_phage	61.4	7.4e-16
WP_000691737.1|271149_273069_-	tetracycline resistance ribosomal protection protein Tet(M)	NA	A0A1S5SF82	Streptococcus_phage	97.2	0.0e+00
WP_001791010.1|273084_273201_-	tetracycline resistance determinant leader peptide	NA	NA	NA	NA	NA
WP_000584387.1|273445_274375_-	conjugal transfer protein	NA	A0A1S5SF22	Streptococcus_phage	56.6	1.1e-83
274294:274309	attR	TCGGAACTTTTCTTTG	NA	NA	NA	NA
WP_010729454.1|274391_275414_-	lipoprotein	NA	A0A1S5SEZ8	Streptococcus_phage	75.2	9.1e-132
WP_000192393.1|275410_277438_-	membrane protein	NA	A0A1S5SF30	Streptococcus_phage	65.3	5.1e-195
WP_000331165.1|277434_279888_-	ATP-binding protein	NA	A0A1S5SF64	Streptococcus_phage	78.9	0.0e+00
WP_000723887.1|279871_280267_-	conjugal transfer protein	NA	A0A1S5SEX7	Streptococcus_phage	72.6	5.9e-47
WP_000248477.1|280338_280977_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000870467.1|281032_281527_-	antirestriction protein ArdA	NA	A0A1S5SF25	Streptococcus_phage	63.4	2.8e-54
WP_000675717.1|281593_282373_-	abortive infection family protein	NA	NA	NA	NA	NA
WP_001009054.1|282414_282636_-	hypothetical protein	NA	A0A1S5SEY0	Streptococcus_phage	93.2	3.1e-29
WP_000055376.1|282632_282923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000426689.1|282919_284104_-	XRE family transcriptional regulator	NA	A0A1S5SEX3	Streptococcus_phage	68.1	6.3e-161
WP_000185761.1|285709_286483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001234191.1|286492_286870_-	YdcP family protein	NA	A0A1S5SF96	Streptococcus_phage	76.4	9.6e-47
WP_000421279.1|286890_287205_-	YdcP family protein	NA	A0A1S5SF38	Streptococcus_phage	77.7	1.2e-42
>prophage 2
NZ_CP016163	Enterococcus faecium strain ISMMS_VRE_11 chromosome, complete genome	2823158	356935	432634	2823158	integrase,protease,transposase	Bacillus_phage(23.08%)	60	356746:356761	432715:432730
356746:356761	attL	GAAAAATGCTTTTGCT	NA	NA	NA	NA
WP_002289035.1|356935_359428_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A0A8J958	Klebsiella_phage	38.3	9.0e-125
WP_002289033.1|359648_360572_+	U32 family peptidase	NA	NA	NA	NA	NA
WP_021415055.1|360589_361831_+	U32 family peptidase	NA	Q6DW11	Phage_TP	32.9	1.2e-42
WP_002289031.1|361964_363311_+	glutathione-disulfide reductase	NA	NA	NA	NA	NA
WP_002304806.1|364245_365199_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_002294811.1|365211_366315_-	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_002289025.1|366404_367340_-	FMN-binding protein	NA	NA	NA	NA	NA
WP_002289023.1|367641_369576_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002294810.1|370032_370449_+	NusG domain II-containing protein	NA	NA	NA	NA	NA
WP_002304808.1|370462_371029_+	Gx transporter family protein	NA	NA	NA	NA	NA
WP_002289380.1|371051_372038_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_058703336.1|373692_375645_-	collagen-binding MSCRAMM adhesin Scm	NA	NA	NA	NA	NA
WP_002289384.1|375931_376456_+	DUF664 domain-containing protein	NA	NA	NA	NA	NA
WP_002297289.1|376772_377741_-	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_002289388.1|377897_378704_-	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.1	1.3e-08
WP_002289390.1|378700_379606_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002289394.1|379623_380592_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002295964.1|381319_384937_+	DNA-directed RNA polymerase subunit beta	NA	A0A1B1ISA9	uncultured_Mediterranean_phage	24.7	1.5e-48
WP_002295965.1|385015_388669_+	DNA-directed RNA polymerase subunit beta'	NA	R4TQM7	Phaeocystis_globosa_virus	24.9	8.4e-63
WP_002288139.1|389263_390289_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_002288137.1|390563_392249_+	sucrose phosphorylase	NA	NA	NA	NA	NA
WP_002288135.1|392262_393546_+	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002288134.1|393615_394485_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_002288133.1|394481_395318_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_002288131.1|395343_396411_+	zinc-binding alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_002288129.1|396407_397235_+	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_002288127.1|397279_398305_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_002288124.1|398301_400485_+	glycoside hydrolase family 65 protein	NA	NA	NA	NA	NA
WP_002288122.1|400484_401615_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	51.6	1.6e-73
WP_002288121.1|401611_402289_+	beta-phosphoglucomutase	NA	A0A1D8KNV9	Synechococcus_phage	23.2	1.6e-07
WP_002288119.1|402372_402900_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_002288144.1|403100_403787_-	prepilin peptidase	NA	NA	NA	NA	NA
WP_002288118.1|403866_405405_+	gluconokinase	NA	NA	NA	NA	NA
WP_002297290.1|405524_405992_+	DNA starvation/stationary phase protection protein	NA	NA	NA	NA	NA
WP_002295975.1|406510_406954_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_002287505.1|406969_407362_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_002297291.1|407450_408677_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_002320809.1|408748_408907_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002297292.1|409594_410335_+	metal ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	33.2	5.7e-19
WP_002297295.1|412772_413723_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002297302.1|413737_413971_+	iron-dependent repressor	NA	NA	NA	NA	NA
WP_071858995.1|414301_414886_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002311663.1|415685_417110_+	energy-coupling factor ABC transporter ATP-binding protein	NA	A0A1V0SGN0	Hokovirus	26.4	5.9e-20
WP_002297308.1|417127_417697_+	MptD family putative ECF transporter S component	NA	NA	NA	NA	NA
WP_002297309.1|417806_419561_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	24.8	1.3e-24
WP_033582393.1|419514_421287_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.1	3.5e-30
WP_002297316.1|421809_422079_+	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_002297318.1|422093_422273_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_002297319.1|422304_422682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002297320.1|422702_422852_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_002304819.1|422875_423859_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_002322279.1|423888_424011_+	putative metal homeostasis protein	NA	NA	NA	NA	NA
WP_002297324.1|424028_425552_+	zinc ABC transporter substrate-binding protein AdcA	NA	NA	NA	NA	NA
WP_002304820.1|425575_425815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002297325.1|426007_426469_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.0	1.5e-12
WP_002297293.1|426623_427811_-|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	28.7	4.6e-26
WP_002317220.1|428283_428502_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002297326.1|428619_430236_+	cobalamin biosynthesis protein	NA	NA	NA	NA	NA
WP_077828743.1|432092_432248_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_002297332.1|432439_432634_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
432715:432730	attR	AGCAAAAGCATTTTTC	NA	NA	NA	NA
>prophage 3
NZ_CP016163	Enterococcus faecium strain ISMMS_VRE_11 chromosome, complete genome	2823158	471788	532679	2823158	integrase,transposase,tRNA	Streptococcus_phage(40.0%)	59	468790:468805	488040:488055
468790:468805	attL	TTCAAAAGCTTCCTTA	NA	NA	NA	NA
WP_002318021.1|471788_472955_-|integrase	site-specific integrase	integrase	A0A172LN96	Lactococcus_phage	34.0	3.3e-45
WP_002321715.1|472979_473306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002321717.1|473458_474511_+	replication initiator protein A	NA	NA	NA	NA	NA
WP_023043245.1|474586_474805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084812591.1|474791_477377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002322532.1|477354_477552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002321374.1|477555_478167_+	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_002321375.1|478151_479543_+	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_002331273.1|479758_480073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002331274.1|480065_480560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002331275.1|480627_480942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002331276.1|481040_481286_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_086956687.1|481326_482488_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	51.3	1.6e-79
WP_080019252.1|484653_486117_-|transposase	IS1182-like element ISEfa7 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	47.5	1.1e-122
WP_002298774.1|486324_487299_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_002312606.1|487280_487742_+	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002298777.1|487791_488256_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
488040:488055	attR	TAAGGAAGCTTTTGAA	NA	NA	NA	NA
WP_002298779.1|488269_489019_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002298780.1|489018_489849_+	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_002298781.1|489848_490496_+	HAD family phosphatase	NA	M1I5S4	Acanthocystis_turfacea_Chlorella_virus	27.4	4.5e-12
WP_002364278.1|492918_493329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002321568.1|493409_494030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002287509.1|494730_495015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002287502.1|495017_495935_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	43.8	4.6e-42
WP_002287500.1|495927_496710_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_002287499.1|496710_497391_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	30.8	1.1e-24
WP_002287497.1|497383_498280_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_002287495.1|498474_500124_+	DNA mismatch repair protein MutS	NA	F2QAF9	Pyramimonas_orientalis_virus	25.7	4.9e-18
WP_002287494.1|500717_501653_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	35.1	6.1e-26
WP_002287492.1|501645_502416_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002287490.1|502831_503815_+|tRNA	tRNA-dihydrouridine synthase	tRNA	NA	NA	NA	NA
WP_002322833.1|504261_505296_+	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_002287484.1|505384_505708_-	AzlD domain-containing protein	NA	NA	NA	NA	NA
WP_002287482.1|505694_506402_-	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_002301008.1|506487_506829_+	xylulose kinase	NA	NA	NA	NA	NA
WP_002287480.1|506999_507848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296840.1|508235_509423_+|transposase	IS256-like element IS16 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.3	8.2e-92
WP_002287479.1|509919_510783_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_002287478.1|510882_511365_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_002287477.1|511627_512095_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_002287475.1|512217_513069_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002287473.1|513319_515278_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_002287471.1|515274_516147_-	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_002287470.1|516488_517361_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002287468.1|517488_518058_+	acetyltransferase	NA	NA	NA	NA	NA
WP_002287466.1|518124_518862_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002287463.1|519092_520361_+	glycoside hydrolase family 73 protein	NA	A0A0K2CP65	Brevibacillus_phage	37.6	1.6e-16
WP_000122610.1|520574_521867_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	38.9	3.2e-57
WP_002287461.1|522354_522819_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002287459.1|522802_523432_+	nitroreductase family protein	NA	NA	NA	NA	NA
WP_002287458.1|523785_525264_+	Msr family ABC-F type ribosomal protection protein	NA	A0A1B0RXA0	Streptococcus_phage	42.8	4.3e-90
WP_002287457.1|525310_525757_+	DUF2798 domain-containing protein	NA	NA	NA	NA	NA
WP_002287456.1|525955_526471_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002296013.1|526587_527790_+	MFS transporter	NA	NA	NA	NA	NA
WP_002287453.1|528162_528489_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002287507.1|528605_528950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002287452.1|529025_530273_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	57.7	2.7e-114
WP_002287451.1|530269_531076_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	3.0e-45
WP_002287107.1|531428_532679_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
>prophage 4
NZ_CP016163	Enterococcus faecium strain ISMMS_VRE_11 chromosome, complete genome	2823158	576093	635918	2823158	protease,tRNA,holin,transposase	Bacillus_phage(12.5%)	42	NA	NA
WP_002287372.1|576093_577032_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	29.7	5.2e-09
WP_002287374.1|577031_578390_+	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_002287376.1|578402_579143_+	Stp1/IreP family PP2C-type Ser/Thr phosphatase	NA	NA	NA	NA	NA
WP_002287377.1|579139_581209_+	Stk1 family PASTA domain-containing Ser/Thr kinase	NA	A0A1V0SDC3	Indivirus	30.3	3.5e-21
WP_002287379.1|581373_582273_+	ribosome small subunit-dependent GTPase A	NA	NA	NA	NA	NA
WP_002287380.1|582285_582936_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_002287382.1|582936_583575_+	thiamine diphosphokinase	NA	NA	NA	NA	NA
WP_002296044.1|583729_584584_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_002287385.1|584587_585097_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_002287386.1|585351_586926_+	hypothetical protein	NA	B5LJD6	Mycobacterium_phage	50.5	2.3e-17
WP_002287387.1|586993_588793_-	M3 family oligoendopeptidase	NA	NA	NA	NA	NA
WP_002287389.1|588915_589422_+	membrane protein	NA	NA	NA	NA	NA
WP_002287391.1|589500_590223_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_002287397.1|590300_591701_-	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_002287399.1|591870_592845_-	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_002287401.1|593197_593758_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_002287403.1|593774_597296_+	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_002287405.1|597310_598906_+	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_002287407.1|598916_599186_+	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_002287409.1|599252_599678_+	septum formation initiator family protein	NA	NA	NA	NA	NA
WP_002287412.1|599723_600194_+	RNA-binding protein S1	NA	NA	NA	NA	NA
WP_002287414.1|600313_601759_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	E3T4I1	Cafeteria_roenbergensis_virus	24.5	6.8e-08
WP_002287415.1|601758_602304_+	hypoxanthine phosphoribosyltransferase	NA	A0A1V0SEQ1	Hokovirus	25.3	4.1e-06
WP_002287418.1|602393_604505_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	C7U047	Ostreococcus_tauri_virus	50.3	9.1e-110
WP_002296053.1|604721_605609_+	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_002290055.1|605609_606614_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_002301217.1|606724_608221_+|tRNA	lysine--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	40.9	6.7e-91
WP_002326809.1|608330_609626_-|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	5.0e-10
WP_002289731.1|618051_619245_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	72.0	1.3e-150
WP_002295566.1|619374_620847_+	MFS transporter	NA	NA	NA	NA	NA
WP_002295567.1|620929_621718_+	esterase family protein	NA	NA	NA	NA	NA
WP_002285876.1|621784_622453_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002285883.1|622567_624280_+	ABC transporter ATP-binding protein	NA	F2Y302	Organic_Lake_phycodnavirus	25.4	1.2e-14
WP_002301355.1|624282_626055_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.4	1.2e-54
WP_086953915.1|626180_627519_+|transposase	IS3-like element ISEnfa3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.7	2.6e-78
WP_010729461.1|628390_629569_-|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_002341521.1|629666_630023_-	hypothetical protein	NA	U4KJ82	Streptococcus_phage	42.2	9.2e-15
WP_002304713.1|630094_631027_-	DUF4041 domain-containing protein	NA	M1NRY5	Streptococcus_phage	53.8	1.8e-57
WP_002301818.1|632320_632527_+|holin	holin	holin	NA	NA	NA	NA
WP_002303477.1|632537_633557_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1G5SA77	Enterococcus_phage	66.1	2.4e-60
WP_025479400.1|634331_634634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296840.1|634730_635918_+|transposase	IS256-like element IS16 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.3	8.2e-92
>prophage 5
NZ_CP016163	Enterococcus faecium strain ISMMS_VRE_11 chromosome, complete genome	2823158	777423	837737	2823158	transposase,protease,tRNA,bacteriocin	Streptococcus_phage(15.38%)	58	NA	NA
WP_002296623.1|777423_778719_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	37.5	3.9e-55
WP_002289850.1|778853_779531_-	DsbA family protein	NA	NA	NA	NA	NA
WP_002289849.1|779648_780224_-	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_002289848.1|780354_781059_+	GTP pyrophosphokinase family protein	NA	NA	NA	NA	NA
WP_002289847.1|781036_781834_+	NAD kinase	NA	NA	NA	NA	NA
WP_002294562.1|781835_782735_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_002294561.1|782752_784114_+	magnesium transporter	NA	NA	NA	NA	NA
WP_002294560.1|784175_784817_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_002294559.1|784925_785792_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_002289592.1|786012_786516_+|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_002289593.1|786564_787224_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_002289596.1|789933_790161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002289597.1|790270_790900_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_002289599.1|790896_791976_-	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_002324227.1|792092_793025_+	ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	33.2	5.9e-21
WP_002294551.1|793038_794184_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002296167.1|794170_795343_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002294549.1|795441_796407_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_002294548.1|797003_797507_+	QueT transporter family protein	NA	E7DN70	Pneumococcus_phage	34.3	3.4e-07
WP_002294577.1|797562_798207_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_002294578.1|798368_798521_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_002294579.1|798544_798715_+	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_002294580.1|798815_799361_+	transcription termination/antitermination protein NusG	NA	NA	NA	NA	NA
WP_002294581.1|799437_800325_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_002294584.1|801606_802479_-	L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha	NA	NA	NA	NA	NA
WP_002294585.1|802491_803160_-	L-serine ammonia-lyase, iron-sulfur-dependent, subunit beta	NA	NA	NA	NA	NA
WP_002291638.1|803502_803925_+	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_002294587.1|804028_804718_+	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_002291634.1|805127_805631_+	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_002294588.1|805683_806052_+	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_002296327.1|806157_806847_+	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_002295743.1|808071_808980_+|transposase	IS982-like element ISEfm1 family transposase	transposase	NA	NA	NA	NA
WP_002290558.1|809369_810902_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	28.0	3.3e-45
WP_002287787.1|811135_811837_+	glucosamine-6-phosphate deaminase	NA	NA	NA	NA	NA
WP_002287788.1|812090_812804_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	43.7	6.5e-20
WP_002287791.1|813112_814252_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_002287792.1|814340_815306_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A096XT60	Enterococcus_phage	70.4	3.4e-128
WP_002287793.1|815355_817515_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	63.2	3.8e-265
WP_002287795.1|817673_817898_-	glutaredoxin-like protein NrdH	NA	A0A0M7REK7	Lactobacillus_phage	42.7	1.7e-11
WP_002287797.1|818298_818772_+	ferrous iron transport protein A	NA	NA	NA	NA	NA
WP_002290587.1|820901_821036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002287801.1|821129_821774_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002287805.1|821960_823154_+	glycine betaine/L-proline ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.0	1.2e-29
WP_002287807.1|823146_824874_+	ABC transporter permease/substrate binding protein	NA	NA	NA	NA	NA
WP_002304799.1|825267_825465_+	enterocin	NA	NA	NA	NA	NA
WP_002287810.1|825466_825778_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_002321654.1|825881_826028_+|bacteriocin	EntF family bacteriocin induction factor	bacteriocin	NA	NA	NA	NA
WP_000222572.1|826024_826978_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002322652.1|827607_828177_+	DUF1836 domain-containing protein	NA	NA	NA	NA	NA
WP_002288847.1|828163_829024_+	DegV family protein	NA	A0A1X9I5J4	Streptococcus_phage	24.4	2.7e-12
WP_002288850.1|829213_829918_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	41.6	5.8e-45
WP_002288851.1|829922_831758_+	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	37.7	4.0e-37
WP_002288852.1|831754_833071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288853.1|833071_833941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288854.1|833995_834805_+	MBL fold metallo-hydrolase	NA	A0A0C5AJ83	Bacteriophage	33.6	3.1e-34
WP_002288856.1|834907_835537_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_002288858.1|835706_836999_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002288860.1|837074_837737_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 6
NZ_CP016163	Enterococcus faecium strain ISMMS_VRE_11 chromosome, complete genome	2823158	958808	1121259	2823158	tail,integrase,plate,holin,portal,transposase,capsid,terminase,tRNA	Enterococcus_phage(19.61%)	161	1109698:1109724	1124506:1124532
WP_000122610.1|958808_960101_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	38.9	3.2e-57
WP_002287121.1|960763_961783_+	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_002287122.1|961825_962707_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	50.3	1.3e-73
WP_002294021.1|963006_963384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002285758.1|963699_963894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002287659.1|963883_964237_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_002296127.1|964338_965886_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_002287124.1|966342_966957_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_002294022.1|967729_969469_+	putative basic amino acid antiporter YfcC	NA	NA	NA	NA	NA
WP_002287126.1|969625_970810_+	beta-aspartyl-peptidase	NA	NA	NA	NA	NA
WP_002287127.1|970920_971124_+	CsbD family protein	NA	NA	NA	NA	NA
WP_002287128.1|971224_971887_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.7	2.5e-21
WP_010729442.1|971899_973402_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002287130.1|973949_975629_+	ribonuclease J	NA	NA	NA	NA	NA
WP_002297218.1|975784_977080_-|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002287132.1|977277_977757_+|tRNA	aminoacyl-tRNA deacylase	tRNA	NA	NA	NA	NA
WP_002287133.1|977975_978656_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_002287134.1|978663_979995_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_002287137.1|981081_981420_+	alkylphosphonate utilization protein	NA	NA	NA	NA	NA
WP_002287139.1|981498_982206_+	zinc metallopeptidase	NA	NA	NA	NA	NA
WP_002287143.1|984097_984634_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002287145.1|984711_986082_+	NOL1/NOP2/sun family putative RNA methylase	NA	NA	NA	NA	NA
WP_002287147.1|986148_986484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002287150.1|986564_987422_-	Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_002287154.1|987528_988044_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_002287235.1|988137_988392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002287155.1|988360_989746_+	multifunctional 2',3'-cyclic-nucleotide 2'-phosphodiesterase/5'-nucleotidase/3'-nucleotidase	NA	NA	NA	NA	NA
WP_002287156.1|989782_990460_+	YutD family protein	NA	NA	NA	NA	NA
WP_002287159.1|990467_991232_+	TIGR01457 family HAD-type hydrolase	NA	NA	NA	NA	NA
WP_129531707.1|991233_991848_+	TIGR01906 family membrane protein	NA	NA	NA	NA	NA
WP_002287163.1|991921_992431_-	phosphatidylglycerophosphatase A	NA	G3MBC5	Bacillus_virus	56.1	1.5e-39
WP_002287165.1|992542_993541_-	NAD(P)/FAD-dependent oxidoreductase	NA	Q9JRK7	Streptococcus_phage	54.1	2.6e-30
WP_002287107.1|993865_995116_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002287167.1|995524_996109_+	peptidylprolyl isomerase	NA	A0A1V0S9I2	Catovirus	43.4	2.0e-27
WP_002296072.1|996185_997361_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_002287231.1|997442_997823_+	S1 RNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_002287172.1|997896_998259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296127.1|1004333_1005881_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_002287659.1|1005982_1006336_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_002285758.1|1006325_1006520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002297218.1|1006662_1007958_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_086956687.1|1008305_1009468_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	51.3	1.6e-79
WP_002287966.1|1009676_1010051_+	iron-sulfur cluster biosynthesis family protein	NA	NA	NA	NA	NA
WP_002287965.1|1010164_1010794_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_002294080.1|1011883_1013212_+	aminopeptidase C	NA	R4TV59	Phaeocystis_globosa_virus	38.1	7.3e-73
WP_002287963.1|1013413_1014247_+	phosphotransferase	NA	NA	NA	NA	NA
WP_002287962.1|1014262_1015000_+	acyl-ACP thioesterase	NA	NA	NA	NA	NA
WP_002287961.1|1015154_1016123_-	asparaginase	NA	NA	NA	NA	NA
WP_002287960.1|1016354_1017188_+	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_002287959.1|1017221_1018061_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_002287958.1|1018086_1018647_+	haloacid dehalogenase	NA	A0A0H3UZF4	Geobacillus_virus	45.1	2.3e-28
WP_002287957.1|1018845_1020567_+	septation ring formation regulator EzrA	NA	NA	NA	NA	NA
WP_002287956.1|1020731_1021874_+	cysteine desulfurase	NA	NA	NA	NA	NA
WP_002287955.1|1021889_1023101_+|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
WP_002287954.1|1023673_1024321_+	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_002287953.1|1024713_1027359_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	42.9	4.0e-163
WP_002294071.1|1027668_1028982_+	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_002287951.1|1028971_1029625_+	HAD family phosphatase	NA	NA	NA	NA	NA
WP_002304462.1|1029679_1030351_+	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_002303264.1|1031662_1032952_-	DUF4041 domain-containing protein	NA	M1NRY5	Streptococcus_phage	74.0	5.6e-46
WP_002303265.1|1033038_1033743_-	LexA family transcriptional regulator	NA	D7RWF2	Brochothrix_phage	42.4	6.2e-39
WP_002303266.1|1033942_1034209_+	helix-turn-helix transcriptional regulator	NA	A0A1W6JP54	Staphylococcus_phage	52.7	5.4e-12
WP_002304464.1|1034376_1034607_-	DUF2188 domain-containing protein	NA	E8ZD70	Streptococcus_phage	49.3	4.4e-10
WP_002299038.1|1034678_1034834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002299325.1|1035141_1035366_-	DUF2188 domain-containing protein	NA	E8ZD70	Streptococcus_phage	81.1	2.2e-27
WP_002303273.1|1035632_1035968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002303275.1|1036200_1037142_+	endonuclease	NA	D2IZK1	Enterococcus_phage	78.9	2.7e-146
WP_002303277.1|1037143_1038034_+	hypothetical protein	NA	D2IYT9	Enterococcus_phage	84.5	6.2e-137
WP_002303278.1|1038076_1038877_+	hypothetical protein	NA	B4XYS6	Lactobacillus_phage	54.5	8.9e-58
WP_002299339.1|1038891_1039743_+	ATP-binding protein	NA	A0A0P0I3L9	Lactobacillus_phage	30.2	2.3e-27
WP_002317474.1|1039739_1040057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305847.1|1040049_1040232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002303279.1|1040233_1040704_+	hypothetical protein	NA	A0A0A7RWK2	Clostridium_phage	33.8	9.6e-12
WP_002303280.1|1040700_1041243_+	DUF1642 domain-containing protein	NA	Q8W5X2	Listeria_phage	40.7	3.9e-17
WP_002303281.1|1041239_1041623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002303282.1|1041619_1041850_+	hypothetical protein	NA	A0A0S2MYD2	Enterococcus_phage	52.1	1.6e-12
WP_002303283.1|1041856_1042060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002303285.1|1042056_1042353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002303286.1|1042429_1042843_+	autolysin	NA	C9E2P5	Enterococcus_phage	81.0	5.6e-56
WP_002303288.1|1042855_1043242_+	hypothetical protein	NA	O34053	Streptococcus_phage	53.5	1.6e-28
WP_002303289.1|1044191_1044452_+	hypothetical protein	NA	A0A0S2MYE7	Enterococcus_phage	51.1	7.9e-16
WP_002303291.1|1045056_1045890_+|terminase	small subunit of terminase	terminase	D2IYW0	Enterococcus_phage	68.8	1.5e-79
WP_002298064.1|1045882_1047298_+	hypothetical protein	NA	C9E2I7	Enterococcus_phage	79.7	1.0e-218
WP_002303292.1|1047309_1048839_+|portal	phage portal protein	portal	A0A0S2MVB2	Bacillus_phage	25.0	1.3e-28
WP_002298060.1|1048930_1049809_+|capsid	minor capsid protein	capsid	NA	NA	NA	NA
WP_002298058.1|1049810_1050128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002349163.1|1050176_1050878_+	DUF4355 domain-containing protein	NA	NA	NA	NA	NA
WP_002303293.1|1050892_1051783_+	DUF5309 domain-containing protein	NA	NA	NA	NA	NA
WP_002311614.1|1051805_1052021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002298050.1|1052032_1052374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002298048.1|1052373_1052745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002298046.1|1052737_1053133_+	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_002298045.1|1053134_1053512_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002303295.1|1053512_1054121_+|tail	tail protein	tail	NA	NA	NA	NA
WP_002303297.1|1054120_1054462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305859.1|1054703_1057493_+	tape measure protein	NA	D7RWD8	Brochothrix_phage	40.2	8.4e-71
WP_002303299.1|1057482_1058223_+|tail	tail protein	tail	NA	NA	NA	NA
WP_002347081.1|1058219_1060982_+	CHAP domain-containing protein	NA	Q9AZX5	Lactococcus_phage	39.1	6.0e-138
WP_002347082.1|1060994_1061903_+|plate	phage baseplate upper protein	plate	A0A1P8BLW0	Lactococcus_phage	25.2	7.8e-10
WP_002303306.1|1061902_1062523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002319918.1|1062526_1062976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002347378.1|1062975_1063470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002332774.1|1063483_1063831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002302750.1|1063823_1063964_+	XkdX family protein	NA	A0A2H4JD72	uncultured_Caudovirales_phage	54.8	1.1e-08
WP_002349260.1|1064063_1064453_+|holin	phage holin family protein	holin	F0PIJ6	Enterococcus_phage	69.7	9.0e-40
WP_002302753.1|1064449_1065460_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1G5SA77	Enterococcus_phage	66.1	2.8e-61
WP_002302755.1|1065574_1066783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002303667.1|1067071_1068412_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	36.0	5.1e-66
WP_025477679.1|1069319_1069622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002347085.1|1069600_1070008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305550.1|1069994_1070447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002347086.1|1070439_1070838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002294067.1|1071913_1072114_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	71.2	3.7e-21
WP_002287948.1|1073888_1075568_-	ribonuclease J	NA	NA	NA	NA	NA
WP_002287947.1|1075569_1075782_-	DNA-dependent RNA polymerase auxiliary subunit epsilon family protein	NA	NA	NA	NA	NA
WP_002296290.1|1076174_1077905_+	multidrug efflux ABC transporter subunit EfrA	NA	W8CYL7	Bacillus_phage	27.6	2.1e-43
WP_002289400.1|1077901_1079662_+	multidrug efflux ABC transporter subunit EfrB	NA	W8CYL7	Bacillus_phage	28.6	2.5e-52
WP_002296291.1|1079756_1079954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002289401.1|1080106_1080592_+	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_002289402.1|1080695_1081289_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.6	8.9e-55
WP_002289403.1|1081468_1081996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002289404.1|1082086_1082824_+	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	40.0	2.3e-12
WP_002289406.1|1083745_1084975_+	GTPase HflX	NA	NA	NA	NA	NA
WP_000222572.1|1085008_1085962_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002287759.1|1086612_1088226_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002296511.1|1088366_1089275_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002287757.1|1089457_1090582_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_002287756.1|1090606_1090786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002287755.1|1090808_1091726_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_002287754.1|1091718_1092552_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_002287753.1|1092634_1093753_+	glycosyl hydrolase family 88	NA	NA	NA	NA	NA
WP_002321415.1|1093746_1095645_+	DUF2264 domain-containing protein	NA	NA	NA	NA	NA
WP_002321414.1|1095638_1096862_+	glucuronyl hydrolase	NA	NA	NA	NA	NA
WP_002287747.1|1096946_1098881_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	31.9	1.1e-58
WP_002287746.1|1099106_1099763_+	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_002287745.1|1099836_1100190_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_002287744.1|1100381_1101311_+	permease	NA	NA	NA	NA	NA
WP_002287743.1|1101321_1102158_+	TIGR03943 family protein	NA	NA	NA	NA	NA
WP_002287741.1|1103356_1104100_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.9	3.6e-29
WP_002296509.1|1104092_1105673_+	ABC transporter	NA	NA	NA	NA	NA
WP_002289868.1|1105923_1106403_-	threonine/serine exporter	NA	NA	NA	NA	NA
WP_002289867.1|1106418_1107171_-	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_002296505.1|1107718_1108444_+	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
WP_002290885.1|1108698_1108965_+	IreB family regulatory phosphoprotein	NA	NA	NA	NA	NA
WP_002296503.1|1108961_1109393_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_002290887.1|1109417_1109723_+	DUF1292 domain-containing protein	NA	NA	NA	NA	NA
1109698:1109724	attL	CATTCATGGCGGAAGAAGAAGAATAGA	NA	NA	NA	NA
WP_002296502.1|1109803_1110949_-|integrase	site-specific integrase	integrase	A0A1S5S7K9	Streptococcus_phage	33.3	2.0e-50
WP_002296501.1|1111009_1111657_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002296500.1|1111850_1112144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296499.1|1112187_1112499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296495.1|1113419_1113782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296494.1|1113818_1114667_+	DNA replication protein	NA	A0A222ZGI2	Arthrobacter_phage	28.3	5.2e-08
WP_002296493.1|1114656_1116132_+	helicase	NA	Q4ZD27	Staphylococcus_phage	34.9	7.3e-66
WP_002296492.1|1116397_1116805_+	DUF3206 domain-containing protein	NA	NA	NA	NA	NA
WP_002296491.1|1116807_1117023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002304527.1|1117026_1117407_+	endonuclease	NA	A0A2I7S865	Vibrio_phage	47.9	1.7e-11
WP_002296489.1|1117540_1117696_+	DUF2292 domain-containing protein	NA	NA	NA	NA	NA
WP_002296488.1|1117764_1118238_+|terminase	phage terminase small subunit P27 family	terminase	NA	NA	NA	NA
WP_002296487.1|1118234_1119929_+|terminase	terminase large subunit	terminase	A0A2H4JBN3	uncultured_Caudovirales_phage	43.8	9.1e-129
WP_002317249.1|1119894_1120080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296486.1|1120083_1121259_+|portal	phage portal protein	portal	A0A2H4J5A4	uncultured_Caudovirales_phage	35.6	3.2e-64
1124506:1124532	attR	CATTCATGGCGGAAGAAGAAGAATAGA	NA	NA	NA	NA
>prophage 7
NZ_CP016163	Enterococcus faecium strain ISMMS_VRE_11 chromosome, complete genome	2823158	1268884	1334877	2823158	transposase,tRNA	Lysinibacillus_phage(28.57%)	48	NA	NA
WP_002296623.1|1268884_1270180_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	37.5	3.9e-55
WP_002326809.1|1270437_1271733_-|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	5.0e-10
WP_002288744.1|1271916_1273296_-	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_002299470.1|1274994_1277187_+	HDIG domain-containing protein	NA	NA	NA	NA	NA
WP_002288749.1|1277203_1277680_+	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_002299471.1|1277657_1278059_+	diacylglycerol kinase family protein	NA	NA	NA	NA	NA
WP_002304617.1|1278073_1278973_+	GTPase Era	NA	NA	NA	NA	NA
WP_002288755.1|1279115_1279928_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_002304619.1|1280311_1281229_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_002340445.1|1281230_1283306_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_058703318.1|1283760_1284669_+|transposase	IS982-like element ISEfm1 family transposase	transposase	NA	NA	NA	NA
WP_002304624.1|1285808_1286588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002317861.1|1286633_1287578_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_002304627.1|1287593_1288373_+	tyrosine protein kinase	NA	NA	NA	NA	NA
WP_002304628.1|1288384_1289083_+	CpsD/CapB family tyrosine-protein kinase	NA	A0A1X9I5D6	Streptococcus_phage	37.1	3.5e-26
WP_002304630.1|1289110_1289875_+	tyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_002304631.1|1289919_1290609_+	sugar transferase	NA	NA	NA	NA	NA
WP_002304633.1|1291834_1292515_+	sugar transferase	NA	NA	NA	NA	NA
WP_002332538.1|1292543_1293857_+	cupin domain-containing protein	NA	A0A1V0SH58	Hokovirus	27.9	8.0e-40
WP_002350623.1|1294662_1295430_+	WecB/TagA/CpsF family glycosyltransferase	NA	NA	NA	NA	NA
WP_002304640.1|1295456_1296458_+	kinase	NA	A0A222YW25	Synechococcus_phage	26.7	1.5e-30
WP_002332534.1|1296480_1297767_+	HAD-IIIA family hydrolase	NA	NA	NA	NA	NA
WP_002304643.1|1297800_1298454_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_002304645.1|1298486_1299692_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_002350624.1|1299821_1301147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002340448.1|1301163_1302294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002340449.1|1302319_1303405_+	polysaccharide pyruvyl transferase family protein	NA	NA	NA	NA	NA
WP_002340450.1|1303427_1304243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002304655.1|1304226_1305945_+	decarboxylase	NA	NA	NA	NA	NA
WP_002304656.1|1305970_1306807_+	SDR family oxidoreductase	NA	A0A2P0VP75	Tetraselmis_virus	29.7	9.1e-05
WP_002304657.1|1306811_1308245_+	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_002350625.1|1308261_1309923_+	hypothetical protein	NA	M4QT73	Synechococcus_phage	30.6	1.5e-30
WP_002304663.1|1310010_1310409_+	hypothetical protein	NA	M4QRS4	Synechococcus_phage	45.8	3.3e-21
WP_002350626.1|1310433_1311150_+	hypothetical protein	NA	M1I5S4	Acanthocystis_turfacea_Chlorella_virus	34.9	4.2e-27
WP_002340451.1|1313019_1314672_+	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	38.6	6.6e-100
WP_002350629.1|1315015_1315381_+	acyltransferase family protein	NA	NA	NA	NA	NA
WP_002304670.1|1315468_1315912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002304673.1|1318524_1319454_-	membrane protein insertase YidC	NA	NA	NA	NA	NA
WP_002289550.1|1319621_1319969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002289551.1|1320169_1320445_-	acylphosphatase	NA	NA	NA	NA	NA
WP_002327792.1|1320552_1321317_+	RNA methyltransferase	NA	A0A2D1A6G0	Rhodococcus_phage	26.8	7.5e-06
WP_002289559.1|1321439_1321943_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_002297218.1|1322204_1323500_-|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002289561.1|1323872_1324520_+	elongation factor G-binding protein	NA	NA	NA	NA	NA
WP_002297218.1|1328843_1330139_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002304680.1|1330233_1331541_-	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_002288760.1|1332011_1333130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002297185.1|1333581_1334877_-|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	3.8e-10
>prophage 8
NZ_CP016163	Enterococcus faecium strain ISMMS_VRE_11 chromosome, complete genome	2823158	1340886	1392293	2823158	transposase,tRNA	Streptococcus_phage(18.75%)	45	NA	NA
WP_002288767.1|1340886_1342185_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	30.3	1.2e-59
WP_002304684.1|1343237_1343912_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_002326717.1|1343908_1344250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288776.1|1344279_1344639_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_002304688.1|1345162_1347244_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	35.6	2.4e-115
WP_002288779.1|1347554_1349021_+	amino acid permease	NA	NA	NA	NA	NA
WP_002304690.1|1349635_1350175_+	topology modulation protein	NA	A0A097BYE2	Leuconostoc_phage	34.5	3.8e-20
WP_002294855.1|1350248_1350689_+	CopY/TcrY family copper transport repressor	NA	NA	NA	NA	NA
WP_002289040.1|1350701_1350911_+	copper chaperone CopZ	NA	NA	NA	NA	NA
WP_002312937.1|1350910_1353097_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	38.6	5.3e-121
WP_002299539.1|1353116_1355288_+	copper/silver-translocating P-type ATPase CopB	NA	A0A218MNH6	uncultured_virus	32.3	5.0e-71
WP_002304699.1|1359082_1360024_-	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_002304700.1|1360168_1361017_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_002294839.1|1361370_1362183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002304701.1|1362336_1362660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002294835.1|1362733_1363303_+	prevent-host-death protein	NA	NA	NA	NA	NA
WP_002301695.1|1363739_1364432_+	hypothetical protein	NA	Q9MCC6	Lactobacillus_phage	43.4	4.0e-30
WP_086953915.1|1364471_1365811_-|transposase	IS3-like element ISEnfa3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.7	2.6e-78
WP_099098442.1|1365915_1367077_+|transposase	IS3-like element ISEfa8 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	54.2	1.8e-80
WP_002295743.1|1367379_1368288_+|transposase	IS982-like element ISEfm1 family transposase	transposase	NA	NA	NA	NA
WP_002326711.1|1368448_1369627_-|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_008266934.1|1369883_1370297_+	DUF4231 domain-containing protein	NA	NA	NA	NA	NA
WP_002295273.1|1370528_1370786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002297404.1|1371071_1372322_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002301623.1|1372731_1373706_+	choloylglycine hydrolase family protein	NA	M1HVK5	Paramecium_bursaria_Chlorella_virus	31.8	7.1e-25
WP_002301399.1|1373828_1374788_-|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	26.8	2.2e-10
WP_002326708.1|1375529_1375847_+	SdpI family protein	NA	NA	NA	NA	NA
WP_002289810.1|1375937_1376303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002300070.1|1376510_1376993_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002289807.1|1377189_1378080_+	phosphate ABC transporter substrate-binding protein PstS family protein	NA	NA	NA	NA	NA
WP_002326707.1|1378366_1379641_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	35.9	9.5e-54
WP_002297196.1|1379913_1382385_+	cation-translocating P-type ATPase	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	28.8	7.0e-45
WP_002303966.1|1382487_1384224_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	34.1	1.2e-27
WP_002293705.1|1384220_1384925_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.2	1.4e-38
WP_002297194.1|1385055_1385559_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_002293708.1|1385518_1385857_+	putative DNA-binding protein	NA	NA	NA	NA	NA
WP_002293709.1|1385877_1387296_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_002293710.1|1387407_1387986_+	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_002297192.1|1387989_1388511_+	dihydrofolate reductase	NA	NA	NA	NA	NA
WP_002293714.1|1388589_1389144_-	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	29.3	2.3e-12
WP_002290274.1|1389396_1389672_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_002290277.1|1389683_1389935_+	KH domain-containing protein	NA	NA	NA	NA	NA
WP_002297190.1|1390059_1390851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002293716.1|1391020_1391542_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_002293717.1|1391531_1392293_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 9
NZ_CP016163	Enterococcus faecium strain ISMMS_VRE_11 chromosome, complete genome	2823158	1411641	1464662	2823158	transposase,tRNA	Streptococcus_phage(16.67%)	50	NA	NA
WP_000997695.1|1411641_1412820_-|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_002302293.1|1413101_1413404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002288592.1|1414160_1414934_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_002288595.1|1415077_1415428_+	SdpI family protein	NA	NA	NA	NA	NA
WP_002288590.1|1415408_1416125_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.7	1.0e-33
WP_002288588.1|1416124_1417573_+	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	29.3	1.7e-19
WP_002288586.1|1417642_1418152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296838.1|1418141_1418867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002303943.1|1419089_1421210_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	58.0	8.2e-220
WP_002288579.1|1422632_1423391_+	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	36.4	1.9e-25
WP_002288577.1|1423413_1423899_+|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
WP_002288576.1|1423969_1425223_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4PQX1	Staphylococcus_phage	55.3	7.7e-24
WP_002288575.1|1425339_1426689_+	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_002288574.1|1426800_1428147_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_002288573.1|1428454_1428841_-	YxeA family protein	NA	NA	NA	NA	NA
WP_002326704.1|1428889_1429798_-|transposase	IS982-like element ISEfm1 family transposase	transposase	NA	NA	NA	NA
WP_002311774.1|1430010_1430970_+|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	27.2	7.5e-11
WP_002297633.1|1431833_1432046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002287775.1|1432323_1434123_-	glycerophosphoryl diester phosphodiesterase	NA	I6XE30	Staphylococcus_phage	26.5	5.3e-10
WP_002287776.1|1434246_1434843_-	TVP38/TMEM64 family protein	NA	M1Q152	Streptococcus_phage	41.7	8.7e-34
WP_002301399.1|1435032_1435992_-|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	26.8	2.2e-10
WP_002296337.1|1436257_1436602_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_002297629.1|1436602_1437022_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_002296335.1|1437113_1437464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296334.1|1437429_1438761_-	DUF1576 domain-containing protein	NA	NA	NA	NA	NA
WP_002303934.1|1440146_1441121_+	choloylglycine hydrolase family protein	NA	M1H001	Paramecium_bursaria_Chlorella_virus	29.7	3.0e-23
WP_002288533.1|1441445_1443341_+	asparagine synthase (glutamine-hydrolyzing)	NA	F2Y2L7	Organic_Lake_phycodnavirus	26.2	6.0e-20
WP_002288531.1|1443535_1443982_-	DUF2188 domain-containing protein	NA	NA	NA	NA	NA
WP_002296119.1|1444209_1444359_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_002296121.1|1444446_1444965_+	dihydrofolate reductase	NA	G3MBI7	Bacillus_virus	39.1	7.1e-24
WP_002293906.1|1445041_1445998_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002293905.1|1446163_1446970_+	ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	32.1	1.0e-13
WP_002293904.1|1446966_1447956_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_002301321.1|1447952_1448957_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_002289886.1|1449088_1449631_+	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_002293902.1|1450368_1450581_+	YqgQ family protein	NA	NA	NA	NA	NA
WP_002288462.1|1450580_1451543_+	ROK family glucokinase	NA	NA	NA	NA	NA
WP_002288461.1|1451560_1451956_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_002288459.1|1452118_1452484_+	DUF488 family protein	NA	NA	NA	NA	NA
WP_002288458.1|1452480_1454292_+	FAD/NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_002288457.1|1454353_1454521_-	DUF3042 family protein	NA	NA	NA	NA	NA
WP_002288452.1|1454768_1455758_+	UDP-glucose 4-epimerase GalE	NA	A0A1V0SG19	Hokovirus	36.8	2.1e-48
WP_002288451.1|1455769_1457254_+	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_002288449.1|1457277_1458258_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.9	5.8e-19
WP_002297185.1|1458387_1459683_-|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	3.8e-10
WP_002288447.1|1459868_1460693_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_002288446.1|1460676_1461219_+	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_002288445.1|1461225_1461690_+	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_002301319.1|1461686_1462703_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	41.0	5.4e-60
WP_002297185.1|1463366_1464662_-|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	3.8e-10
>prophage 10
NZ_CP016163	Enterococcus faecium strain ISMMS_VRE_11 chromosome, complete genome	2823158	1469815	1538342	2823158	protease,tRNA,transposase	Streptococcus_phage(26.67%)	56	NA	NA
WP_002288432.1|1469815_1471507_+|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	32.6	2.9e-74
WP_002288430.1|1471960_1472506_-	phosphonoacetaldehyde hydrolase	NA	NA	NA	NA	NA
WP_002296514.1|1472509_1472638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002326698.1|1472630_1473722_-	2-aminoethylphosphonate--pyruvate transaminase	NA	NA	NA	NA	NA
WP_002293881.1|1473938_1474418_-	ArgR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002293880.1|1474776_1475559_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_002293878.1|1475657_1476539_+	elongation factor Ts	NA	NA	NA	NA	NA
WP_002293877.1|1476674_1477397_+	UMP kinase	NA	NA	NA	NA	NA
WP_002293875.1|1477399_1477957_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_002294134.1|1479933_1480746_+	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	46.8	2.0e-25
WP_002294135.1|1480742_1481543_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_002294136.1|1481703_1482972_+|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_002294137.1|1483039_1484749_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_084812597.1|1484960_1489313_+	PolC-type DNA polymerase III	NA	A0A0K2SUJ2	Clostridium_phage	41.4	3.9e-22
WP_002288499.1|1489456_1489930_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_002301262.1|1489953_1491129_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_002288501.1|1491150_1491444_+	YlxR family protein	NA	NA	NA	NA	NA
WP_002288509.1|1491440_1491752_+	YlxQ-related RNA-binding protein	NA	NA	NA	NA	NA
WP_002294141.1|1491764_1494071_+	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	23.7	3.6e-19
WP_002294142.1|1494097_1494445_+	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_002294143.1|1494552_1494774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002340394.1|1495221_1497585_+	phosphoketolase family protein	NA	NA	NA	NA	NA
WP_002301259.1|1497952_1498876_+|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_002301258.1|1498879_1499821_+	riboflavin biosynthesis protein RibF	NA	NA	NA	NA	NA
WP_080105260.1|1500000_1501506_+|transposase	IS1182-like element ISEfa7 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	48.2	5.4e-125
WP_002294471.1|1501780_1502566_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002288523.1|1502578_1503430_+	sugar transporter	NA	NA	NA	NA	NA
WP_002300528.1|1503553_1504006_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002294467.1|1504470_1504839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002300920.1|1504988_1505471_+|tRNA	prolyl-tRNA editing protein	tRNA	NA	NA	NA	NA
WP_002300917.1|1505507_1506518_+	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_002300915.1|1506632_1507346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002300913.1|1507535_1508126_-	glutamine amidotransferase	NA	NA	NA	NA	NA
WP_002300911.1|1508648_1509320_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_002340391.1|1509961_1510732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002331707.1|1510765_1511644_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_002296623.1|1512936_1514232_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	37.5	3.9e-55
WP_002300943.1|1514532_1514760_+	adenosine deaminase	NA	NA	NA	NA	NA
WP_002300945.1|1514775_1515942_+	oxygen-independent coproporphyrinogen III oxidase	NA	A0A0N7G7K6	Chrysochromulina_ericina_virus	33.6	5.0e-09
WP_002294449.1|1516176_1517220_+	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
WP_002294448.1|1517313_1517877_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_002292134.1|1517927_1519757_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	48.8	2.2e-136
WP_002289374.1|1519907_1521074_+	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	25.7	1.9e-24
WP_002292113.1|1521441_1522179_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	44.7	2.8e-34
WP_002294446.1|1522180_1523683_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_002294444.1|1523941_1525936_+	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_002296519.1|1525945_1528762_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	57.4	3.6e-311
WP_002294441.1|1529024_1530290_+	D-aspartate ligase	NA	NA	NA	NA	NA
WP_002296517.1|1530293_1531025_+	aspartate racemase	NA	NA	NA	NA	NA
WP_002289695.1|1531159_1532044_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	31.4	5.4e-08
WP_002289697.1|1532040_1533039_+	YvcK family protein	NA	A1IMD5	Streptococcus_phage	62.9	2.6e-115
WP_002289698.1|1533072_1534008_+	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	39.1	2.0e-53
WP_002321528.1|1534550_1535201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129531708.1|1535387_1535969_+	DUF443 family protein	NA	NA	NA	NA	NA
WP_000222572.1|1535965_1536919_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002296840.1|1537154_1538342_+|transposase	IS256-like element IS16 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.3	8.2e-92
>prophage 11
NZ_CP016163	Enterococcus faecium strain ISMMS_VRE_11 chromosome, complete genome	2823158	1609092	1654463	2823158	integrase,transposase,tRNA	Streptococcus_phage(23.08%)	43	1628813:1628830	1661969:1661986
WP_002296623.1|1609092_1610388_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	37.5	3.9e-55
WP_002296405.1|1610673_1611615_+	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
WP_002296404.1|1611683_1612415_+	serine/threonine protein phosphatase	NA	A7KV25	Bacillus_phage	30.8	1.7e-15
WP_002296403.1|1612558_1614739_+	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_002296402.1|1614758_1615241_+	SprT family protein	NA	NA	NA	NA	NA
WP_002296401.1|1615256_1616018_+	YdcF family protein	NA	NA	NA	NA	NA
WP_002296400.1|1616148_1617483_+	UDP-N-acetylmuramate--L-alanine ligase	NA	NA	NA	NA	NA
WP_002297185.1|1617619_1618915_-|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	3.8e-10
WP_002296398.1|1619311_1619797_+	dehydratase	NA	NA	NA	NA	NA
WP_002303538.1|1620597_1623243_+	DNA polymerase I	NA	F8WQ35	Bacillus_phage	35.7	3.0e-54
WP_002288323.1|1623287_1624124_+	DNA-formamidopyrimidine glycosylase	NA	A0A127AWE5	Bacillus_phage	30.2	1.8e-24
WP_002288324.1|1624087_1624717_+	dephospho-CoA kinase	NA	NA	NA	NA	NA
WP_002303537.1|1624768_1625101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288327.1|1625412_1625904_+	transcriptional repressor NrdR	NA	NA	NA	NA	NA
WP_002288329.1|1625926_1627300_+	Replication initiation and membrane attachment	NA	NA	NA	NA	NA
WP_002288331.1|1627299_1628226_+	primosomal protein DnaI	NA	S5MU12	Brevibacillus_phage	41.3	5.1e-33
WP_002288333.1|1628354_1628795_+	lipoprotein	NA	NA	NA	NA	NA
1628813:1628830	attL	AAAATAAGAAAATGTTGT	NA	NA	NA	NA
WP_002288335.1|1628938_1629640_+|tRNA	tRNA (adenine-N(1))-methyltransferase	tRNA	NA	NA	NA	NA
WP_002288338.1|1629636_1630758_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_002288340.1|1630772_1632005_+	peptidase T	NA	NA	NA	NA	NA
WP_002288343.1|1632136_1633045_+	YegS/Rv2252/BmrU family lipid kinase	NA	NA	NA	NA	NA
WP_002305633.1|1633079_1633352_+	DUF1294 domain-containing protein	NA	NA	NA	NA	NA
WP_002288347.1|1633362_1634409_+	flippase-like domain-containing protein	NA	NA	NA	NA	NA
WP_002301554.1|1634659_1637269_+	ATP-dependent chaperone ClpB	NA	A0A2I7SAX5	Vibrio_phage	35.0	1.6e-132
WP_002288350.1|1637419_1638091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002288352.1|1638083_1638578_-	nucleoside deoxyribosyltransferase	NA	A0A1W6JK28	Lactococcus_phage	56.5	7.2e-42
WP_002288353.1|1638597_1639818_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002288355.1|1639964_1641800_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.4	3.4e-20
WP_002288357.1|1641893_1643021_-|integrase	site-specific integrase	integrase	A0A2I7SCV1	Paenibacillus_phage	55.5	1.8e-109
WP_000222572.1|1643077_1644031_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_000997695.1|1644186_1645365_-|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_033795113.1|1645621_1645900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002322258.1|1646017_1646278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002289415.1|1646414_1646828_-	Hsp20/alpha crystallin family protein	NA	A0A1B2LRT2	Wolbachia_phage	31.5	2.1e-07
WP_002303864.1|1647283_1647769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002305631.1|1647907_1648153_-	DUF378 domain-containing protein	NA	NA	NA	NA	NA
WP_002289420.1|1648345_1649146_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	26.2	2.6e-09
WP_084812599.1|1649164_1650319_+	HTH domain-containing protein	NA	NA	NA	NA	NA
WP_050396533.1|1650510_1651032_+	PTS transporter subunit EIIA	NA	NA	NA	NA	NA
WP_002289422.1|1651024_1651516_+	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002289423.1|1651503_1652058_+	PTS sorbitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_002289425.1|1652075_1653071_+	PTS glucitol/sorbitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_002287107.1|1653212_1654463_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
1661969:1661986	attR	AAAATAAGAAAATGTTGT	NA	NA	NA	NA
>prophage 12
NZ_CP016163	Enterococcus faecium strain ISMMS_VRE_11 chromosome, complete genome	2823158	2219971	2336307	2823158	integrase,protease,tail,head,plate,holin,portal,transposase,capsid,terminase	Streptococcus_phage(12.77%)	119	2270448:2270466	2308194:2308212
WP_002287598.1|2219971_2222206_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	39.1	5.1e-127
WP_002290825.1|2222353_2222674_+	DUF1827 family protein	NA	NA	NA	NA	NA
WP_002302440.1|2222787_2224089_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	33.6	1.6e-48
WP_002287661.1|2224379_2224604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002295394.1|2224801_2226382_-	peptide chain release factor 3	NA	A0A1B0RXH7	Streptococcus_phage	28.4	5.1e-33
WP_002295395.1|2226782_2228159_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_002290821.1|2228286_2229405_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_002290819.1|2229546_2229981_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002290817.1|2230058_2230592_-	DUF402 domain-containing protein	NA	NA	NA	NA	NA
WP_002296955.1|2230685_2231864_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_002295398.1|2231856_2232654_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_002295399.1|2232760_2234143_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	37.4	3.5e-86
WP_002292856.1|2234316_2234895_-	chitin-binding protein	NA	A0A0K1Y848	Apis_mellifera_filamentous_virus	34.4	9.7e-14
WP_002296956.1|2235216_2235687_+	tryptophan-rich sensory protein	NA	NA	NA	NA	NA
WP_002295400.1|2235794_2237021_-	LytR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002297218.1|2237843_2239139_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002292860.1|2239296_2239497_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	67.7	7.6e-19
WP_002295401.1|2239630_2240239_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	60.1	7.7e-70
WP_002292862.1|2240323_2240794_-	GtrA family protein	NA	NA	NA	NA	NA
WP_002317368.1|2240841_2241756_-	cation transporter	NA	A0A1V0SED0	Indivirus	31.5	2.1e-10
WP_002289147.1|2241901_2242705_+	DUF1189 domain-containing protein	NA	NA	NA	NA	NA
WP_002289148.1|2242882_2243830_+	2-hydroxyacid dehydrogenase	NA	NA	NA	NA	NA
WP_002302440.1|2243913_2245215_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	33.6	1.6e-48
WP_002303172.1|2245398_2245692_-	iron-sulfur cluster biosynthesis protein	NA	NA	NA	NA	NA
WP_002289151.1|2245719_2246385_-	TrkA family potassium uptake protein	NA	NA	NA	NA	NA
WP_002289153.1|2246524_2247157_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_002289154.1|2247163_2248231_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_002292871.1|2248227_2248959_-	cell wall-active antibiotics response protein	NA	NA	NA	NA	NA
WP_002289156.1|2249127_2249607_-	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_002289159.1|2249742_2250918_-	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_002289161.1|2251121_2252291_+	serine hydrolase	NA	A0A2R4AS58	Mycobacterium_phage	26.3	1.6e-10
WP_002303174.1|2252557_2254180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000997695.1|2254421_2255600_+|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_002286097.1|2256672_2257626_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002296623.1|2259635_2260931_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	37.5	3.9e-55
WP_084812606.1|2261104_2262052_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A1V0SKV4	Klosneuvirus	37.7	3.6e-50
WP_002289370.1|2262056_2262809_-	acylneuraminate cytidylyltransferase family protein	NA	NA	NA	NA	NA
WP_002289368.1|2262809_2263718_-	dehydrogenase	NA	NA	NA	NA	NA
WP_002289366.1|2263717_2264695_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_002289362.1|2266486_2267635_-	UDP-N-acetylglucosamine 2-epimerase (hydrolyzing)	NA	NA	NA	NA	NA
WP_002292874.1|2267631_2268636_-	N-acetylneuraminate synthase	NA	NA	NA	NA	NA
WP_002289359.1|2268647_2269655_-	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	35.9	1.2e-40
WP_002292875.1|2269667_2271089_-	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
2270448:2270466	attL	CCACTGTTTTTTATCAAAA	NA	NA	NA	NA
WP_002347167.1|2272139_2273573_-	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_002289068.1|2273565_2274528_-	glycosyl transferase	NA	NA	NA	NA	NA
WP_002289069.1|2274560_2275646_-	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
WP_002289071.1|2275664_2276705_-	glycosyltransferase family 2 protein	NA	I1TED8	Salmonella_phage	35.3	2.4e-07
WP_002302725.1|2276720_2278112_-	sugar transferase	NA	NA	NA	NA	NA
WP_002297404.1|2278519_2279770_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002289074.1|2280272_2281256_+	serine hydrolase	NA	NA	NA	NA	NA
WP_002289076.1|2281623_2283762_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_002289078.1|2283800_2285387_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_002289079.1|2285376_2286597_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.9	1.1e-11
WP_002289081.1|2286608_2287415_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_084812607.1|2288947_2290981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286428.1|2291014_2291866_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	39.0	1.7e-38
WP_002294532.1|2291963_2292992_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	42.9	6.4e-69
WP_002286449.1|2293598_2294465_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	62.5	3.7e-102
WP_002321540.1|2294564_2295299_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_002286453.1|2295276_2296104_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_002286455.1|2296103_2296904_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_002286457.1|2296896_2298036_-	undecaprenyl/decaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase	NA	NA	NA	NA	NA
WP_002286461.1|2298111_2299035_-	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_002294533.1|2299066_2299831_-	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_002286465.1|2299988_2300429_+	flavodoxin	NA	NA	NA	NA	NA
WP_002286467.1|2300606_2301176_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002286469.1|2301430_2302663_+	aminopeptidase	NA	NA	NA	NA	NA
WP_002296840.1|2302937_2304125_-|transposase	IS256-like element IS16 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.3	8.2e-92
WP_002286470.1|2304441_2304642_+|integrase	tyrosine-type recombinase/integrase	integrase	Q9AZR0	Lactococcus_phage	75.7	4.6e-08
WP_002302745.1|2304890_2305121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002302747.1|2305126_2305426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002303477.1|2306202_2307222_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1G5SA77	Enterococcus_phage	66.1	2.4e-60
WP_002286683.1|2307218_2307443_-|holin	holin	holin	NA	NA	NA	NA
WP_002303476.1|2307439_2307733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002303475.1|2307769_2307907_-	XkdX family protein	NA	NA	NA	NA	NA
WP_002347165.1|2307908_2308340_-	hypothetical protein	NA	NA	NA	NA	NA
2308194:2308212	attR	CCACTGTTTTTTATCAAAA	NA	NA	NA	NA
WP_002305897.1|2308353_2308848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002301867.1|2308847_2309297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002303523.1|2309300_2309918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002332773.1|2309917_2310826_-|plate	phage baseplate upper protein	plate	A0A1P8BLW0	Lactococcus_phage	25.2	7.8e-10
WP_002347164.1|2310838_2313598_-	CHAP domain-containing protein	NA	D7RWE0	Brochothrix_phage	55.7	1.6e-50
WP_002349218.1|2313594_2314299_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_002303051.1|2314310_2316620_-|tail	phage tail tape measure protein	tail	Q8W5Z7	Listeria_phage	50.1	5.5e-84
WP_002303049.1|2316814_2317279_-	hypothetical protein	NA	A0A2H4J956	uncultured_Caudovirales_phage	38.9	1.4e-15
WP_002303047.1|2317278_2317905_-|tail	tail protein	tail	A0A2H4JGN2	uncultured_Caudovirales_phage	34.5	5.7e-28
WP_002303045.1|2317911_2318277_-	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_002303043.1|2318266_2318605_-	hypothetical protein	NA	A0A1B1P7P2	Bacillus_phage	45.9	9.6e-22
WP_002303041.1|2318594_2318921_-|head	phage head closure protein	head	A0A0N7IRA3	Lactobacillus_phage	53.4	2.9e-23
WP_002303039.1|2318898_2319180_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1C8E967	Bacillus_phage	62.7	4.7e-22
WP_002303037.1|2319181_2320546_-|capsid	phage major capsid protein	capsid	A0A1B2APY9	Phage_Wrath	69.1	2.2e-125
WP_002349220.1|2320558_2321134_-|head,protease	HK97 family phage prohead protease	head,protease	A0A1B2APW1	Phage_Wrath	71.7	3.6e-69
WP_002304437.1|2321099_2322287_-|portal	phage portal protein	portal	A0A1B2APW5	Phage_Wrath	65.5	1.3e-142
WP_002303033.1|2322350_2324078_-|terminase	terminase large subunit	terminase	A0A2H4JDG5	uncultured_Caudovirales_phage	73.3	6.9e-265
WP_002303032.1|2324074_2324527_-	hypothetical protein	NA	A0A2H4JFK0	uncultured_Caudovirales_phage	66.2	6.8e-47
WP_002304435.1|2324638_2325019_-	HNH endonuclease	NA	A0A1B1P7N1	Bacillus_phage	64.0	4.7e-41
WP_002303030.1|2325015_2325402_-	hypothetical protein	NA	A0A1B1P7N8	Bacillus_phage	36.7	1.9e-10
WP_002303029.1|2325403_2325682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002349221.1|2325729_2326458_+	DUF4145 domain-containing protein	NA	A0A1X9I5M7	Streptococcus_phage	52.4	1.2e-58
WP_002303026.1|2326603_2327080_-	DUF1492 domain-containing protein	NA	A0A2H4JFW6	uncultured_Caudovirales_phage	50.8	2.2e-27
WP_002303025.1|2327373_2327559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002303024.1|2327559_2327832_-	DUF3850 domain-containing protein	NA	C9E2N9	Enterococcus_phage	61.6	5.5e-20
WP_002303023.1|2327828_2328032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002303022.1|2328156_2328369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002347162.1|2328401_2328596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002303020.1|2328603_2328792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002303018.1|2329418_2329784_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002303017.1|2329823_2330126_-	hypothetical protein	NA	D2IZY1	Enterococcus_phage	70.7	2.8e-33
WP_002303016.1|2330125_2330425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002304429.1|2330587_2330857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286552.1|2330868_2331618_-	helix-turn-helix domain-containing protein	NA	A0A1L2BY83	Clostridium_phage	54.0	1.7e-31
WP_002286553.1|2331620_2332307_-	hypothetical protein	NA	C9E2N1	Enterococcus_phage	69.1	3.2e-88
WP_002286557.1|2332312_2332984_-	DUF1071 domain-containing protein	NA	A0A1B1P7F0	Bacillus_phage	47.4	4.2e-29
WP_002286559.1|2332976_2333318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286562.1|2333495_2334194_-	phage regulatory protein	NA	D2IYT0	Enterococcus_phage	34.6	1.7e-25
WP_002286568.1|2334279_2334750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296610.1|2334792_2334972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286573.1|2334958_2335297_-	DUF771 domain-containing protein	NA	NA	NA	NA	NA
WP_002296611.1|2335312_2335516_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002290310.1|2335530_2336307_-	phage antirepressor protein	NA	A0A1Q1PVU2	Staphylococcus_phage	53.8	1.1e-73
>prophage 13
NZ_CP016163	Enterococcus faecium strain ISMMS_VRE_11 chromosome, complete genome	2823158	2390820	2448302	2823158	transposase,protease	Streptococcus_phage(40.0%)	54	NA	NA
WP_000122610.1|2390820_2392113_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	38.9	3.2e-57
WP_002289452.1|2392259_2392553_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_002289451.1|2392565_2392910_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_002289450.1|2392936_2393245_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_002289449.1|2393526_2394168_+	uracil-DNA glycosylase	NA	NA	NA	NA	NA
WP_002294025.1|2394229_2395861_-	SulP family inorganic anion transporter	NA	NA	NA	NA	NA
WP_002295743.1|2395997_2396906_-|transposase	IS982-like element ISEfm1 family transposase	transposase	NA	NA	NA	NA
WP_002288109.1|2397032_2397392_-	DUF1304 family protein	NA	NA	NA	NA	NA
WP_002288107.1|2397931_2398615_-	O-methyltransferase	NA	NA	NA	NA	NA
WP_002299609.1|2398742_2399261_-	signal peptidase I	NA	NA	NA	NA	NA
WP_010729540.1|2399507_2400686_-|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_002288103.1|2400818_2402663_+	membrane protein	NA	NA	NA	NA	NA
WP_002288102.1|2402707_2403712_-	lipoate--protein ligase	NA	NA	NA	NA	NA
WP_002288100.1|2403722_2404463_-	MBL fold metallo-hydrolase	NA	S4VYV9	Pandoravirus	26.3	3.9e-07
WP_002288098.1|2404532_2405336_-	DUF975 family protein	NA	NA	NA	NA	NA
WP_002288096.1|2405335_2406418_-	M42 family metallopeptidase	NA	NA	NA	NA	NA
WP_002288094.1|2406558_2407827_-	D-alanyl-lipoteichoic acid biosynthesis protein DltD	NA	NA	NA	NA	NA
WP_002288090.1|2408106_2409312_-	D-alanyl-lipoteichoic acid biosynthesis protein DltB	NA	A0A125RNP0	Pseudomonas_phage	30.7	1.4e-19
WP_002288089.1|2409308_2410823_-	D-alanine--poly(phosphoribitol) ligase subunit DltA	NA	A0A2K9KZV5	Tupanvirus	28.5	3.4e-42
WP_002288113.1|2410833_2410983_-	teichoic acid D-Ala incorporation-associated protein DltX	NA	NA	NA	NA	NA
WP_002288087.1|2411263_2413306_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002304285.1|2413295_2414063_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.2	8.0e-32
WP_002288083.1|2414388_2416578_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0C5KKX3	Enterococcus_phage	66.6	1.8e-286
WP_002288081.1|2416892_2417495_+	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A288TZV3	Enterococcus_phage	58.6	1.7e-53
WP_002294035.1|2417548_2418670_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_002288078.1|2418778_2419651_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	60.4	3.1e-88
WP_002288076.1|2419719_2420067_-	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	41.1	5.1e-18
WP_002288073.1|2420059_2420884_-	stage 0 sporulation family protein	NA	NA	NA	NA	NA
WP_002288071.1|2420919_2421858_-	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	34.4	3.3e-35
WP_002292340.1|2421871_2422201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002294039.1|2422215_2422860_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	52.6	4.2e-58
WP_002296223.1|2422923_2423520_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_002292337.1|2423544_2423859_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_002294042.1|2423878_2425624_-	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	36.3	1.9e-49
WP_002289234.1|2425838_2427086_+	virion core protein	NA	NA	NA	NA	NA
WP_002289233.1|2427110_2428295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002289232.1|2428291_2429089_+	TPM domain-containing protein	NA	NA	NA	NA	NA
WP_000122610.1|2429197_2430490_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	38.9	3.2e-57
WP_002289231.1|2431037_2431694_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_002289230.1|2431886_2432165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002294047.1|2432183_2433392_+	MFS transporter	NA	NA	NA	NA	NA
WP_002289228.1|2433539_2433905_-	DUF2512 family protein	NA	NA	NA	NA	NA
WP_002289227.1|2434051_2434825_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_002289226.1|2434998_2435859_-	ketose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_002289225.1|2435858_2437277_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_002296225.1|2437333_2437783_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_002290330.1|2438227_2438491_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_002290332.1|2438589_2439885_-	transcription termination factor Rho	NA	NA	NA	NA	NA
WP_002294056.1|2439881_2441153_-	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_002294057.1|2441317_2442187_-	fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_002286999.1|2442476_2444087_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	48.4	2.3e-145
WP_002287001.1|2445279_2446620_-	type I glutamate--ammonia ligase	NA	A0A1V0SJ53	Klosneuvirus	25.6	9.1e-07
WP_002287002.1|2446647_2447040_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000222572.1|2447348_2448302_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP016164	Enterococcus faecium strain ISMMS_VRE_11 plasmid ISMMS_VRE11_p1, complete sequence	202822	9968	59072	202822	holin,bacteriocin,integrase,transposase	Streptococcus_phage(20.0%)	47	9291:9307	60900:60916
9291:9307	attL	ATCCAAATCAATTTTTA	NA	NA	NA	NA
WP_002287107.1|9968_11219_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_049142609.1|11627_14000_+	hypothetical protein	NA	B5SP25	Lactococcus_phage	30.6	2.3e-13
WP_002313123.1|14060_15530_+	DUF3991 domain-containing protein	NA	NA	NA	NA	NA
WP_002303486.1|15540_17550_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	52.6	1.6e-111
WP_002299811.1|17895_18492_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_002352365.1|18504_19404_+	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_002301801.1|19406_19538_+	single-stranded DNA-binding protein	NA	A8ATZ7	Listeria_phage	83.3	1.3e-11
WP_002305808.1|19559_19892_+	single-stranded DNA-binding protein	NA	W6LM61	Streptococcus_phage	53.2	6.1e-21
WP_002303482.1|19936_20170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002295624.1|20328_20451_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_002305809.1|20640_20865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305810.1|21307_21514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002300797.1|21513_21765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002300801.1|21945_22218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002300804.1|22662_22842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002311569.1|22900_23257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000222572.1|24225_25179_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.8	3.7e-34
WP_002300807.1|25299_25563_+|bacteriocin	circular bacteriocin, circularin A/uberolysin family	bacteriocin	NA	NA	NA	NA
WP_000997695.1|25934_27113_+|transposase	IS256-like element ISEf1 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	25.6	3.0e-30
WP_002300833.1|27500_29447_+	PTS transporter subunit EIIA	NA	NA	NA	NA	NA
WP_002300835.1|29449_29905_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_002300836.1|29918_31247_+	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_002300838.1|31280_31565_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002300840.1|31566_32082_+	YjbQ family protein	NA	NA	NA	NA	NA
WP_002300841.1|32097_32760_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_002300842.1|32766_33339_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_002300843.1|33525_35046_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	31.6	1.1e-48
WP_002300845.1|35288_35468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002300846.1|35457_35640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002301839.1|36593_37193_+|integrase	tyrosine-type recombinase/integrase	integrase	D2XR58	Bacillus_phage	36.1	1.3e-29
WP_002322465.1|37256_37856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305879.1|38871_39744_-	ROK family protein	NA	NA	NA	NA	NA
WP_002352509.1|40007_41954_-	PTS beta-glucoside transporter subunit IIBCA	NA	NA	NA	NA	NA
WP_002302078.1|42138_43578_+	sucrose-6-phosphate hydrolase	NA	S6ATV4	Bacillus_phage	25.1	1.4e-16
WP_002302077.1|43579_44542_+	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	25.8	2.3e-20
WP_086953894.1|44711_46138_-|transposase	IS3-like element ISEfa10 family transposase	transposase	A0A1B1P773	Bacillus_phage	40.2	2.3e-48
WP_002301718.1|46380_46836_+|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.6	1.3e-13
WP_002289255.1|47421_47652_-	resolvase	NA	NA	NA	NA	NA
WP_002289254.1|47881_48700_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002289253.1|48860_49550_+	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_002289252.1|49563_51066_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_002300328.1|51078_51555_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_158514107.1|51651_51762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086956687.1|52052_53215_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	51.3	1.6e-79
WP_002287870.1|54332_54851_+	ClbS/DfsB family four-helix bundle protein	NA	NA	NA	NA	NA
WP_002301591.1|56925_58011_+	tyrosine recombinase XerS	NA	NA	NA	NA	NA
WP_000222572.1|58118_59072_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.8	3.7e-34
60900:60916	attR	TAAAAATTGATTTGGAT	NA	NA	NA	NA
>prophage 2
NZ_CP016164	Enterococcus faecium strain ISMMS_VRE_11 plasmid ISMMS_VRE11_p1, complete sequence	202822	65177	124981	202822	integrase,transposase	Streptococcus_phage(25.0%)	55	83207:83232	129447:129472
WP_086956687.1|65177_66340_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	51.3	1.6e-79
WP_086953915.1|66600_67939_+|transposase	IS3-like element ISEnfa3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.7	2.6e-78
WP_002301811.1|68330_69623_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	41.0	6.1e-32
WP_000122610.1|69772_71065_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	38.9	3.2e-57
WP_002313174.1|71403_71664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002346943.1|71914_73093_+|transposase	IS256-like element ISEf1 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	25.3	4.0e-30
WP_073120200.1|73444_73741_+|transposase	IS3 family transposase	transposase	A0A0C5AEB1	Paenibacillus_phage	59.2	6.7e-19
WP_002287876.1|74689_75085_-	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_002287875.1|75094_75943_-	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_002287874.1|75957_76785_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	NA	NA	NA	NA
WP_002349114.1|76796_77657_-	Rossmann-like and DUF2520 domain-containing protein	NA	NA	NA	NA	NA
WP_002285758.1|77855_78050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002287659.1|78039_78393_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	38.7	5.7e-17
WP_002296127.1|78494_80042_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	28.9	1.7e-44
WP_000122610.1|81250_82543_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	38.9	3.2e-57
83207:83232	attL	AAGGGTTCTGTTGCAAAGTTTTAAAT	NA	NA	NA	NA
WP_001015311.1|83263_83944_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	1.5e-127
WP_000195429.1|84573_85746_+|transposase	IS256-like element IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	100.0	3.5e-135
WP_002303110.1|87576_88614_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	28.5	7.1e-07
WP_002303111.1|88610_89123_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_002304894.1|89180_89447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002303113.1|90122_90674_-	DUF334 domain-containing protein	NA	NA	NA	NA	NA
WP_002319817.1|91218_91899_+|transposase	IS6-like element ISS1N family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	84.1	2.5e-109
WP_002304893.1|91926_92490_+	recombinase family protein	NA	A0A1V0E035	Clostridioides_phage	34.9	2.2e-18
WP_000824191.1|92534_92702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000366408.1|92735_93035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001224538.1|93075_93693_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	33.1	5.1e-13
WP_002304891.1|94017_94413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000344083.1|94492_96844_-	DUF1906 domain-containing protein	NA	NA	NA	NA	NA
WP_000718009.1|96968_97658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000751236.1|97671_98124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002325565.1|98254_98935_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.1	1.3e-126
WP_002300494.1|99036_100356_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_002285815.1|100352_101006_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.2	4.0e-24
WP_002348630.1|101714_102431_-	aminotransferase class V-fold PLP-dependent enzyme	NA	Q2XUY6	environmental_halophage	50.0	4.5e-45
WP_016922460.1|102554_102740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002302261.1|104346_105378_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.6	1.8e-26
WP_002313180.1|105384_106215_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002302265.1|106211_107018_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_002302267.1|107023_107848_-	type I phosphodiesterase/nucleotide pyrophosphatase	NA	NA	NA	NA	NA
WP_002302270.1|109114_109900_+	histidinol phosphate phosphatase	NA	NA	NA	NA	NA
WP_002330694.1|109932_110316_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077828694.1|110391_110523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002322470.1|110491_110728_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_002302275.1|110805_111777_-	radical SAM protein	NA	NA	NA	NA	NA
WP_002340465.1|112428_114051_+|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	47.5	2.7e-122
WP_002301195.1|114336_115713_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002298083.1|115712_116369_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.1	1.3e-22
WP_002301194.1|116378_117656_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_087121905.1|117905_119067_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	54.2	4.1e-80
WP_002330699.1|119097_119547_-	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_002298088.1|119702_120245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_102829664.1|120519_121681_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	54.2	9.2e-80
WP_002349250.1|122293_122818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002295743.1|122842_123751_-|transposase	IS982-like element ISEfm1 family transposase	transposase	NA	NA	NA	NA
WP_002301108.1|124426_124981_-|integrase	tyrosine-type recombinase/integrase	integrase	W8CYP1	Bacillus_phage	46.1	8.6e-36
129447:129472	attR	ATTTAAAACTTTGCAACAGAACCCTT	NA	NA	NA	NA
>prophage 1
NZ_CP016166	Enterococcus faecium strain ISMMS_VRE_11 plasmid ISMMS_VRE11_p3, complete sequence	48256	42	19885	48256	transposase	Streptococcus_phage(75.0%)	21	NA	NA
WP_084812618.1|42_720_+	23S ribosomal RNA methyltransferase Erm	NA	E4ZFQ0	Streptococcus_phage	98.7	1.1e-122
WP_084812616.1|724_916_+	hypothetical protein	NA	E4ZFP9	Streptococcus_phage	100.0	2.9e-15
WP_002297218.1|983_2279_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	29.1	1.0e-42
WP_002297218.1|2937_4233_-|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	29.1	1.0e-42
WP_000567888.1|5187_5433_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000228166.1|5535_6405_+	hypothetical protein	NA	A0A1X9I6C9	Streptococcus_phage	95.8	4.3e-159
WP_000662263.1|6385_7120_+	class I SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	100.0	1.5e-141
WP_001255866.1|7152_8061_+	aminoglycoside nucleotidyltransferase ANT(6)-Ia	NA	E4ZFP8	Streptococcus_phage	100.0	2.8e-177
WP_000627290.1|8057_8600_+	streptothricin N-acetyltransferase Sat4	NA	A0A1B0RXL7	Streptococcus_phage	100.0	8.9e-94
WP_001096887.1|8692_9487_+	aminoglycoside O-phosphotransferase APH(3')-IIIa	NA	E4ZFP6	Streptococcus_phage	100.0	2.3e-154
WP_002321977.1|9762_10305_+	HTH domain-containing protein	NA	A0A1B0RXM1	Streptococcus_phage	98.3	2.4e-91
WP_001015311.1|10334_11015_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	1.5e-127
WP_002305129.1|11673_12051_-	antitoxin HicB	NA	A0A1X9I5X0	Streptococcus_phage	52.1	6.9e-29
WP_002305130.1|12096_12285_-	type II toxin-antitoxin system HicA family toxin	NA	A0A1X9I5T5	Streptococcus_phage	66.1	1.7e-15
WP_002305131.1|12455_12998_+	helix-turn-helix transcriptional regulator	NA	Q9AZH9	Lactococcus_phage	45.0	3.8e-12
WP_002305840.1|13192_14089_+	helix-turn-helix transcriptional regulator	NA	Q9AZH9	Lactococcus_phage	40.7	9.1e-11
WP_002305133.1|14137_15520_+	helix-turn-helix domain-containing protein	NA	I3VYY8	Thermoanaerobacterium_phage	32.2	5.9e-09
WP_002305134.1|15533_16316_+	helix-turn-helix domain-containing protein	NA	A0A1X9I5A1	Streptococcus_phage	35.2	5.0e-05
WP_002305817.1|16355_16967_+	recombinase family protein	NA	A0A1V0E035	Clostridioides_phage	39.2	3.4e-17
WP_084812617.1|17996_19151_+|transposase	IS256-like element IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	100.0	3.4e-135
WP_002325565.1|19204_19885_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.1	1.3e-126
