The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP012584	Pseudomonas aeruginosa strain PA_D25, complete genome	6683204	633730	686395	6683204	tRNA,plate,tail,holin	uncultured_Caudovirales_phage(28.0%)	55	NA	NA
WP_003109020.1|633730_634756_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.1	3.7e-109
WP_003085061.1|634834_635404_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_003099587.1|635487_635841_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_023126993.1|635831_636374_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_003099584.1|636346_637579_-	multifunctional CCA addition/repair protein	NA	A0A076G5T8	Escherichia_phage	43.1	2.6e-77
WP_003085071.1|637622_638129_-	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_003085073.1|638223_639777_-	SpoVR family protein	NA	NA	NA	NA	NA
WP_003085075.1|639773_641045_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	37.2	4.2e-09
WP_003085078.1|641145_643068_-	PrkA family serine protein kinase	NA	NA	NA	NA	NA
WP_003099577.1|643346_643679_-	thiosulfate sulfurtransferase GlpE	NA	NA	NA	NA	NA
WP_003113213.1|643722_644574_-	symmetrical bis(5'-nucleosyl)-tetraphosphatase	NA	A0A2H4J0P0	uncultured_Caudovirales_phage	33.3	1.1e-08
WP_058165012.1|644573_644954_-	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_003085087.1|644990_645797_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_003123920.1|645912_646899_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_003109024.1|646895_648188_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_003085092.1|648168_650970_-	LPS-assembly protein LptD	NA	NA	NA	NA	NA
WP_003137370.1|651096_652113_+	phosphotransferase	NA	NA	NA	NA	NA
WP_003085095.1|652109_652784_+	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_003085097.1|652785_653544_+	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_034075333.1|653544_654606_-	DUF3530 family protein	NA	NA	NA	NA	NA
WP_003129201.1|654757_657151_+	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_003085103.1|657196_657829_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003085106.1|657957_658992_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_003085109.1|659225_660335_+	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.4	7.8e-28
WP_003109043.1|660390_661437_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014604087.1|661551_662799_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003085119.1|662904_663735_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003085122.1|663858_664533_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_003099532.1|664532_665351_+	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
WP_003085126.1|665423_666902_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_003085128.1|667087_667402_-	transcription regulatory protein PrtN	NA	NA	NA	NA	NA
WP_031686362.1|667501_668272_-	helix-turn-helix transcriptional regulator	NA	A0A1B0Z078	Pseudomonas_phage	58.6	1.0e-71
WP_003085132.1|668729_668930_+	repressor PtrB	NA	W6ATC1	Enterobacter_phage	58.3	3.7e-05
WP_003085135.1|668977_669337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077563386.1|669699_670149_+|holin	holin	holin	B5TK61	Pseudomonas_phage	53.3	5.0e-26
WP_015502278.1|670170_670686_+	hypothetical protein	NA	A0A2H4J881	uncultured_Caudovirales_phage	43.4	1.1e-32
WP_003085141.1|670682_671240_+|plate	phage baseplate assembly protein V	plate	A0A2H4JG06	uncultured_Caudovirales_phage	71.1	4.6e-45
WP_003113199.1|671392_671719_+	bacteriophage protein	NA	A0A2H4JA09	uncultured_Caudovirales_phage	60.2	2.4e-30
WP_031686363.1|671715_672603_+|plate	baseplate assembly protein	plate	S4TNY7	Salmonella_phage	59.8	4.1e-88
WP_003137385.1|672595_673129_+|tail	phage tail protein I	tail	Q9ZXK7	Pseudomonas_virus	64.6	5.2e-62
WP_015502281.1|673130_675239_+|tail	tail fiber	tail	Q9ZXK6	Pseudomonas_virus	52.3	6.5e-225
WP_003085172.1|675247_675688_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003109051.1|675730_676891_+|tail	phage tail sheath family protein	tail	Q38068	Phage_PS17	83.4	2.7e-188
WP_003129212.1|676903_677407_+|tail	phage major tail tube protein	tail	Q7M2A5	Pseudomonas_phage	73.5	6.1e-65
WP_003085178.1|677421_677766_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_031686365.1|677935_680173_+|tail	phage tail length tape measure protein	tail	NA	NA	NA	NA
WP_003085182.1|680182_681055_+|tail	phage tail protein	tail	A0A2H4J875	uncultured_Caudovirales_phage	51.7	3.9e-75
WP_003101635.1|681029_681236_+	hypothetical protein	NA	A0A2H4J9Z9	uncultured_Caudovirales_phage	64.2	2.3e-18
WP_031686366.1|681293_682283_+	phage late control D family protein	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	55.8	2.2e-106
WP_031686367.1|682315_682945_+	glycoside hydrolase family 19 protein	NA	A0A125RNP1	Pseudomonas_phage	78.0	2.1e-86
WP_003117967.1|682941_683304_+	hypothetical protein	NA	H2BDA0	Pseudomonas_phage	47.9	4.2e-15
WP_003118919.1|683300_683558_+	hypothetical protein	NA	A0A125RNP3	Pseudomonas_phage	64.6	8.3e-18
WP_023092374.1|683905_684511_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	65.8	4.6e-75
WP_003085203.1|684512_685562_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	57.8	1.8e-111
WP_003085205.1|685558_686395_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	56.9	2.1e-70
>prophage 2
NZ_CP012584	Pseudomonas aeruginosa strain PA_D25, complete genome	6683204	1196583	1234028	6683204	integrase,transposase,tRNA,terminase,portal,holin,protease	uncultured_Caudovirales_phage(38.1%)	42	1206647:1206664	1231190:1231207
WP_009313444.1|1196583_1199436_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	37.0	1.3e-148
WP_003112023.1|1199556_1199925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003100593.1|1199936_1200365_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_004351504.1|1200361_1201849_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	36.1	1.0e-51
WP_033994554.1|1202185_1202998_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003137845.1|1203081_1204005_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003092864.1|1204196_1205315_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_003092863.1|1205307_1206375_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_003092862.1|1206506_1207004_-	RDD family protein	NA	NA	NA	NA	NA
1206647:1206664	attL	AGCGCAGCAGCGCCTGGA	NA	NA	NA	NA
WP_003162594.1|1207133_1208714_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_079282768.1|1209210_1210212_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0A0YR56	Pseudomonas_phage	94.8	4.7e-149
WP_121379776.1|1210223_1210592_+	outer membrane protein assembly factor BamE	NA	J7HXI2	Pseudomonas_phage	88.2	1.4e-47
WP_025325127.1|1210780_1211494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033980357.1|1211496_1212018_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_025325125.1|1212065_1212365_-	hypothetical protein	NA	A0A0A0YRS6	Pseudomonas_phage	91.0	7.6e-47
WP_033980358.1|1212618_1214682_-	DNA methyltransferase	NA	Q5QF27	Pseudomonas_virus	98.0	0.0e+00
WP_058010781.1|1214678_1215224_-	hypothetical protein	NA	A0A2D1GNL9	Pseudomonas_phage	48.3	6.3e-31
WP_069376557.1|1215232_1215967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_028680747.1|1216033_1216843_-	YfdQ family protein	NA	A0A2R2Z323	Escherichia_phage	42.0	6.9e-50
WP_031632202.1|1216888_1217236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019726652.1|1217453_1217690_-	hypothetical protein	NA	A0A2H4J8B4	uncultured_Caudovirales_phage	40.3	6.1e-07
WP_069376558.1|1217686_1218055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_028680744.1|1218051_1218336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069376559.1|1218347_1218917_-	deoxynucleotide monophosphate kinase	NA	A0A2H4J8A1	uncultured_Caudovirales_phage	49.5	8.0e-45
WP_028680742.1|1218913_1219222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078451259.1|1219515_1220073_-	helix-turn-helix transcriptional regulator	NA	A0A1W6JNY2	Morganella_phage	44.0	2.9e-23
WP_028680740.1|1220304_1220535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154052173.1|1220561_1220711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154052175.1|1220760_1221922_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	52.9	1.0e-83
WP_019726644.1|1221964_1222168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033980361.1|1222374_1222875_+	hypothetical protein	NA	A0A2H4JFM0	uncultured_Caudovirales_phage	61.0	8.0e-33
WP_019726642.1|1222867_1223110_+	repressor, PtrB	NA	Q9ZXI6	Pseudomonas_virus	53.0	2.7e-10
WP_033980362.1|1223106_1225845_+	DNA primase	NA	A0A2H4JF22	uncultured_Caudovirales_phage	64.0	0.0e+00
WP_124182786.1|1226184_1226742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004353017.1|1226940_1227306_+	hypothetical protein	NA	E5E3W4	Burkholderia_phage	48.2	1.0e-13
WP_025325111.1|1227310_1227589_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_069376561.1|1227591_1228329_+	hypothetical protein	NA	A0A1B0Z000	Pseudomonas_phage	47.1	8.8e-44
WP_069376562.1|1228582_1229158_+|terminase	terminase small subunit	terminase	A0A2H4JG15	uncultured_Caudovirales_phage	55.2	8.1e-45
WP_034066184.1|1229160_1231170_+|terminase	phage terminase large subunit family protein	terminase	A0A2H4J898	uncultured_Caudovirales_phage	68.1	3.3e-271
WP_004353026.1|1231181_1231406_+	hypothetical protein	NA	NA	NA	NA	NA
1231190:1231207	attR	AGCGCAGCAGCGCCTGGA	NA	NA	NA	NA
WP_069376563.1|1231405_1232872_+|portal	phage portal protein	portal	A0A2H4JFL5	uncultured_Caudovirales_phage	65.8	6.6e-176
WP_069376564.1|1232855_1234028_+|protease	Clp protease ClpP	protease	A0A2H4JDI2	uncultured_Caudovirales_phage	49.9	1.6e-87
>prophage 3
NZ_CP012584	Pseudomonas aeruginosa strain PA_D25, complete genome	6683204	1242104	1258397	6683204	tRNA	Pseudomonas_phage(30.0%)	15	NA	NA
WP_069376568.1|1242104_1245656_+	hypothetical protein	NA	A0A0M4U447	Ralstonia_phage	35.2	1.8e-179
WP_023087707.1|1245655_1246663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069377023.1|1246650_1247520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069376569.1|1247516_1249277_+	hypothetical protein	NA	A0A2I7S8R8	Vibrio_phage	24.1	9.8e-25
WP_019682828.1|1249276_1249513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069376570.1|1249758_1250388_+	glycoside hydrolase family 19 protein	NA	J7I4M6	Pseudomonas_phage	83.7	6.4e-96
WP_069376571.1|1250384_1250753_+	hypothetical protein	NA	A0A0S2SY58	Pseudomonas_phage	62.3	8.0e-30
WP_034068839.1|1250749_1251010_+	hypothetical protein	NA	B5WZU5	Pseudomonas_phage	76.7	1.1e-28
WP_034065785.1|1251154_1251958_+	DNA adenine methylase	NA	C7BGE1	Burkholderia_phage	65.0	1.4e-100
WP_034068840.1|1252274_1252958_-	DUF159 family protein	NA	Q5QF62	Pseudomonas_virus	71.2	4.5e-95
WP_034065780.1|1253047_1253479_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A2H4J538	uncultured_Caudovirales_phage	43.9	1.8e-20
WP_034068843.1|1253471_1254740_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	51.9	6.6e-116
WP_044059572.1|1255286_1255844_+	DUF4760 domain-containing protein	NA	NA	NA	NA	NA
WP_003113798.1|1256222_1257266_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_003100607.1|1257278_1258397_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	49.9	6.7e-96
>prophage 4
NZ_CP012584	Pseudomonas aeruginosa strain PA_D25, complete genome	6683204	1448872	1522108	6683204	transposase,plate,capsid,tRNA,tail,terminase,portal,head,protease	uncultured_Caudovirales_phage(29.27%)	79	NA	NA
WP_003129940.1|1448872_1450225_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_003129941.1|1450295_1452662_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_003098586.1|1452712_1453219_+	OmpH family outer membrane protein	NA	NA	NA	NA	NA
WP_003092378.1|1453218_1454280_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_003092375.1|1454325_1454766_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_003092373.1|1454762_1455539_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_003109334.1|1455542_1456679_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_003092371.1|1456678_1457284_+	ribonuclease HII	NA	R4THQ2	Phaeocystis_globosa_virus	35.8	1.6e-19
WP_003092370.1|1457500_1458916_+	alanine:cation symporter family protein	NA	NA	NA	NA	NA
WP_003098578.1|1459045_1462567_+	DNA polymerase III subunit alpha	NA	A0A2L1IZ23	Streptomyces_phage	37.7	1.7e-198
WP_003109333.1|1462716_1463667_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_003098572.1|1463736_1465065_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	M1IB95	Acanthocystis_turfacea_Chlorella_virus	24.1	5.9e-06
WP_003092366.1|1465235_1466864_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	53.1	4.0e-158
WP_003092365.1|1466866_1467712_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	40.3	1.4e-48
WP_003092364.1|1467757_1469047_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	61.5	2.5e-139
WP_003098569.1|1469111_1469396_+	cell division protein FtsB	NA	NA	NA	NA	NA
WP_003092359.1|1469415_1470120_+	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_033938381.1|1470180_1470429_-	sulfurtransferase-like selenium metabolism protein YedF	NA	NA	NA	NA	NA
WP_069376587.1|1470394_1471621_-	selenium metabolism membrane protein YedE/FdhT	NA	NA	NA	NA	NA
WP_003092354.1|1471696_1472605_-	glutathione-dependent formaldehyde neutralization regulator	NA	NA	NA	NA	NA
WP_003092351.1|1472736_1473849_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.1	1.3e-35
WP_069376588.1|1473902_1474754_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_003092346.1|1474824_1475298_+	2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase	NA	NA	NA	NA	NA
WP_069376589.1|1475294_1476362_+|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
WP_003092341.1|1476349_1477099_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	53.0	6.8e-68
WP_003098558.1|1477131_1477767_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	52.3	1.0e-40
WP_069376590.1|1477812_1478706_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A0S2SXL7	Bacillus_phage	34.3	3.0e-06
WP_003113871.1|1478810_1479815_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.3	7.0e-36
WP_003092272.1|1480241_1480565_-	ferredoxin family protein	NA	NA	NA	NA	NA
WP_014603975.1|1480631_1483172_-	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	22.1	2.4e-24
WP_087920907.1|1483239_1484401_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	53.2	9.5e-85
WP_124074654.1|1484774_1485758_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_052150740.1|1485832_1486144_+	STAS-like domain-containing protein	NA	NA	NA	NA	NA
WP_015649074.1|1486187_1487447_-	DUF3596 domain-containing protein	NA	A0A1I9KF78	Aeromonas_phage	38.8	1.9e-67
WP_015649073.1|1487413_1487626_-	putative phage excisionase	NA	NA	NA	NA	NA
WP_034011743.1|1488180_1490016_-	DNA cytosine methyltransferase	NA	A0A1I9KFW0	Aeromonas_phage	38.0	1.4e-95
WP_034011745.1|1490012_1490492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015649068.1|1490501_1490741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034011746.1|1490737_1491364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031639816.1|1491414_1491732_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_031673600.1|1491728_1492037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014603908.1|1492190_1492484_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_023087724.1|1492493_1492805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034011748.1|1493087_1493801_-	helix-turn-helix domain-containing protein	NA	F1C599	Cronobacter_phage	35.8	2.4e-22
WP_019726484.1|1493907_1494162_+	hypothetical protein	NA	A0A2H4JA29	uncultured_Caudovirales_phage	45.6	1.5e-06
WP_023087721.1|1494478_1495033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003130865.1|1495025_1495235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019396873.1|1497442_1497814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014603903.1|1498385_1498748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023127296.1|1498862_1499387_+	hypothetical protein	NA	A0A2D1GMW4	Marinobacter_phage	37.2	1.5e-18
WP_052168560.1|1499430_1501317_+|terminase	phage terminase large subunit family protein	terminase	A0A2D1GMT1	Marinobacter_phage	50.0	4.5e-161
WP_014603900.1|1501329_1501545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031652606.1|1501547_1503161_+|portal	phage portal protein	portal	A0A067ZJA4	Vibrio_phage	39.6	5.5e-91
WP_033964211.1|1503163_1504384_+	S49 family peptidase	NA	A0A219YAK4	Aeromonas_phage	34.7	5.3e-46
WP_014603897.1|1504397_1504748_+|head	head decoration protein	head	A0A291AUM0	Sinorhizobium_phage	42.2	2.5e-12
WP_014603896.1|1504763_1505801_+|capsid	major capsid protein	capsid	A0A0C5ABI0	Bacteriophage	40.5	1.7e-69
WP_014603895.1|1505802_1505988_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015649052.1|1505990_1506305_+	hypothetical protein	NA	A0A2H4J879	uncultured_Caudovirales_phage	45.8	2.1e-18
WP_014603894.1|1506304_1506973_+	hypothetical protein	NA	A0A2H4JBV1	uncultured_Caudovirales_phage	59.3	3.7e-65
WP_033964215.1|1506965_1507502_+	hypothetical protein	NA	A0A2H4J881	uncultured_Caudovirales_phage	44.5	7.8e-34
WP_034011753.1|1507498_1508056_+|plate	phage baseplate assembly protein V	plate	A0A2H4JG06	uncultured_Caudovirales_phage	66.5	7.5e-48
WP_069376591.1|1508113_1508335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014603890.1|1508344_1508671_+	hypothetical protein	NA	A0A2H4JA09	uncultured_Caudovirales_phage	65.7	2.3e-33
WP_033964218.1|1508667_1509552_+|plate	baseplate assembly protein	plate	A0A2H4JFK9	uncultured_Caudovirales_phage	73.3	1.6e-113
WP_033964219.1|1509548_1510079_+|tail	phage tail protein I	tail	A0A2H4JDH5	uncultured_Caudovirales_phage	57.5	1.2e-50
WP_033964221.1|1510075_1512157_+|tail	tail fiber	tail	Q9ZXK6	Pseudomonas_virus	50.3	1.2e-111
WP_079384501.1|1512435_1512618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023107128.1|1512661_1513822_+|tail	phage tail sheath family protein	tail	Q38068	Phage_PS17	98.2	2.3e-216
WP_033964226.1|1513834_1514344_+|tail	phage major tail tube protein	tail	Q7M2A5	Pseudomonas_phage	98.2	3.4e-87
WP_014603883.1|1514353_1514650_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_034012938.1|1514788_1517479_+|tail	tail protein	tail	A0A2H4JG00	uncultured_Caudovirales_phage	28.7	1.3e-41
WP_014603880.1|1517487_1518327_+|tail	phage tail protein	tail	A0A2H4J875	uncultured_Caudovirales_phage	54.3	6.0e-81
WP_015649042.1|1518301_1518508_+|tail	tail protein X	tail	A0A2H4J9Z9	uncultured_Caudovirales_phage	62.7	9.6e-17
WP_034012936.1|1518521_1519574_+	phage late control protein	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	70.3	2.0e-134
WP_014603877.1|1519611_1519797_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034012935.1|1519908_1520538_+	glycoside hydrolase family 19 protein	NA	A0A125RNP1	Pseudomonas_phage	72.7	4.2e-79
WP_079392378.1|1520534_1520903_+	hypothetical protein	NA	H2BDD6	Pseudomonas_virus	80.3	4.1e-42
WP_060853382.1|1520899_1521160_+	hypothetical protein	NA	B5WZU5	Pseudomonas_phage	72.1	1.2e-27
WP_060853383.1|1521304_1522108_+	DNA adenine methylase	NA	C7BGE1	Burkholderia_phage	63.9	1.1e-100
>prophage 5
NZ_CP012584	Pseudomonas aeruginosa strain PA_D25, complete genome	6683204	2425941	2459004	6683204	integrase,transposase,tRNA,terminase,holin,tail	Pseudomonas_phage(64.52%)	45	2426259:2426274	2439079:2439094
WP_016562059.1|2425941_2426922_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
2426259:2426274	attL	GCAGATGCTCGCGGCA	NA	NA	NA	NA
WP_034008354.1|2427104_2428220_+|integrase	site-specific integrase	integrase	A0A2K8I325	Pseudomonas_phage	60.0	6.2e-118
WP_003130859.1|2428193_2428469_-	hypothetical protein	NA	A0A2K8HN48	Pseudomonas_phage	65.5	3.4e-25
WP_003130860.1|2428572_2428785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003130861.1|2428781_2430662_-	DNA cytosine methyltransferase	NA	Q5QF27	Pseudomonas_virus	43.2	1.2e-132
WP_023094641.1|2430658_2431138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003130862.1|2431147_2431387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003126620.1|2431383_2432010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019396880.1|2432059_2432377_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_003126630.1|2432373_2432604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003130863.1|2432754_2433048_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_087920907.1|2433308_2434471_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	53.2	9.5e-85
WP_003130870.1|2434796_2435156_-	DUF4440 domain-containing protein	NA	NA	NA	NA	NA
WP_031637682.1|2435873_2436524_-	hypothetical protein	NA	A0A0U4J8W4	Pseudomonas_phage	97.2	1.6e-121
WP_023088260.1|2436657_2437230_-	S24 family peptidase	NA	H2BD63	Pseudomonas_phage	91.7	1.9e-86
WP_003451709.1|2437606_2437825_+	helix-turn-helix domain-containing protein	NA	A0A2D1GND2	Pseudomonas_phage	64.7	2.9e-19
WP_033990714.1|2437856_2438429_+	hypothetical protein	NA	H2BD67	Pseudomonas_phage	98.4	1.3e-100
WP_034008244.1|2438431_2439316_+	hypothetical protein	NA	NA	NA	NA	NA
2439079:2439094	attR	GCAGATGCTCGCGGCA	NA	NA	NA	NA
WP_003103373.1|2439365_2439974_+	hypothetical protein	NA	A0A2H4J6S4	uncultured_Caudovirales_phage	43.9	3.4e-41
WP_023083722.1|2439966_2440410_+	RusA family crossover junction endodeoxyribonuclease	NA	H2BD71	Pseudomonas_phage	69.2	1.4e-52
WP_034008243.1|2440438_2441308_+	hypothetical protein	NA	J7HXH6	Pseudomonas_phage	84.4	4.1e-141
WP_069376653.1|2441367_2441676_-	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_023101093.1|2441650_2441926_-	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	A0A0A1IU40	Pseudomonas_phage	64.9	2.7e-06
WP_069376654.1|2442226_2442526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003103377.1|2442633_2443014_+	hypothetical protein	NA	H2BDJ3	Pseudomonas_virus	67.5	4.8e-38
WP_003103378.1|2442988_2443336_+|holin	phage holin family protein	holin	Q9MC42	Pseudomonas_phage	61.3	1.9e-25
WP_003103379.1|2443402_2443858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023101096.1|2443915_2444512_+|terminase	terminase small subunit	terminase	H2BD75	Pseudomonas_phage	61.9	3.3e-49
WP_023115880.1|2444498_2445794_+	hypothetical protein	NA	A0A1B1P9C9	Acinetobacter_phage	58.5	1.4e-145
WP_069376655.1|2445796_2447152_+	DUF4055 domain-containing protein	NA	A0A0H5AWC7	Pseudomonas_phage	45.4	5.3e-95
WP_046638885.1|2447148_2448228_+	hypothetical protein	NA	A0A0S2SY77	Pseudomonas_phage	97.8	4.4e-201
WP_034028840.1|2448351_2449095_+	hypothetical protein	NA	A0A0H5AWD1	Pseudomonas_phage	75.5	2.2e-87
WP_010793134.1|2449104_2450076_+	hypothetical protein	NA	A0A0M3LQL5	Mannheimia_phage	64.7	5.4e-110
WP_010793133.1|2450117_2450603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069376656.1|2450586_2451051_+	hypothetical protein	NA	H9EB35	Vibrio_phage	38.0	1.2e-09
WP_003103397.1|2451050_2451440_+	hypothetical protein	NA	A0A2H4JAS3	uncultured_Caudovirales_phage	55.0	2.8e-33
WP_061195337.1|2451443_2452118_+	hypothetical protein	NA	A0A0S2SY81	Pseudomonas_phage	96.4	6.0e-116
WP_012075336.1|2452114_2452525_+	hypothetical protein	NA	A0A1B0VMI0	Pseudomonas_phage	43.4	1.9e-24
WP_019396741.1|2452592_2453246_+|tail	phage tail protein	tail	A0A2H4IZV5	uncultured_Caudovirales_phage	52.8	1.0e-59
WP_023115887.1|2453255_2453636_+	hypothetical protein	NA	A0A1B0VMH4	Pseudomonas_phage	44.9	4.8e-22
WP_049246843.1|2453698_2453962_+	phage protein	NA	A0A2R3UAE2	Siphoviridae_environmental_samples	46.0	2.7e-16
WP_069376657.1|2453958_2457150_+|tail	phage tail tape measure protein	tail	A0A2H4J9A1	uncultured_Caudovirales_phage	40.8	5.1e-157
WP_024928576.1|2457155_2457494_+|tail	phage tail protein	tail	A0A0S2SYI2	Pseudomonas_phage	98.2	1.2e-59
WP_069376658.1|2457490_2458240_+|tail	phage minor tail protein L	tail	A0A0S2SY57	Pseudomonas_phage	98.4	1.6e-146
WP_003160548.1|2458242_2459004_+	C40 family peptidase	NA	A0A0S2SY75	Pseudomonas_phage	93.9	1.4e-140
>prophage 6
NZ_CP012584	Pseudomonas aeruginosa strain PA_D25, complete genome	6683204	2679231	2686125	6683204	tRNA	uncultured_Caudovirales_phage(83.33%)	9	NA	NA
WP_069376677.1|2679231_2680512_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	45.4	6.3e-98
WP_003131135.1|2680513_2681911_+	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_003097628.1|2681915_2682890_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_009314043.1|2682977_2683961_-	glycosyl transferase family protein	NA	A0A2H4JBY5	uncultured_Caudovirales_phage	74.0	1.2e-141
WP_003090393.1|2683957_2684293_-	TusE/DsrC/DsvC family sulfur relay protein	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	69.4	3.3e-38
WP_003090391.1|2684289_2684595_-	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_003090389.1|2684594_2684954_-	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	61.7	1.4e-34
WP_003090387.1|2684950_2685346_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	72.1	2.7e-47
WP_003090386.1|2685456_2686125_-	Bax inhibitor-1/YccA family protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	82.1	1.5e-90
>prophage 7
NZ_CP012584	Pseudomonas aeruginosa strain PA_D25, complete genome	6683204	4378549	4450400	6683204	tRNA,integrase,transposase,protease	Escherichia_phage(25.0%)	53	4414231:4414247	4432082:4432098
WP_003082462.1|4378549_4379374_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	73.7	1.4e-106
WP_003082458.1|4379476_4380070_+	molecular chaperone DnaJ	NA	NA	NA	NA	NA
WP_003082455.1|4380228_4380828_+	YIP1 family protein	NA	NA	NA	NA	NA
WP_003082453.1|4380995_4381493_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_069382930.1|4381494_4382676_-	CoA transferase	NA	NA	NA	NA	NA
WP_003082447.1|4382764_4383904_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_031636425.1|4384005_4385025_-	LLM class oxidoreductase	NA	NA	NA	NA	NA
WP_003140525.1|4385021_4385651_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_003140526.1|4385852_4386743_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003133810.1|4386817_4388128_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_003133812.1|4388463_4389465_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_003086577.1|4389468_4392831_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	33.1	7.9e-15
WP_003082438.1|4392932_4394279_-	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_003082436.1|4394275_4394953_-	response regulator	NA	NA	NA	NA	NA
WP_003082431.1|4395032_4395635_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_003082429.1|4395856_4396024_+	periplasmic nitrate reductase, NapE protein	NA	NA	NA	NA	NA
WP_009315481.1|4396032_4396524_+	ferredoxin-type protein NapF	NA	NA	NA	NA	NA
WP_009315480.1|4396516_4396846_+	chaperone NapD	NA	NA	NA	NA	NA
WP_003107632.1|4396826_4399331_+	nitrate reductase catalytic subunit NapA	NA	NA	NA	NA	NA
WP_003082414.1|4399341_4399833_+	cytochrome C protein NapB	NA	NA	NA	NA	NA
WP_003082412.1|4399843_4400440_+	cytochrome c3 family protein	NA	NA	NA	NA	NA
WP_069376804.1|4400471_4401668_-	lytic murein transglycosylase	NA	NA	NA	NA	NA
WP_009315477.1|4402124_4402859_+	TerC family protein	NA	A0A0S4KZH7	Pseudomonas_phage	41.2	1.7e-31
WP_023099838.1|4402902_4404960_-	oleic acid lipoxygenase	NA	NA	NA	NA	NA
WP_003082401.1|4405037_4405358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019486594.1|4405857_4406529_-	polysaccharide lyase family 7 protein	NA	NA	NA	NA	NA
WP_019486595.1|4406704_4407493_+	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_003449100.1|4407720_4408449_+	4'-phosphopantetheinyl transferase superfamily protein	NA	NA	NA	NA	NA
WP_003086553.1|4408449_4409262_-|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	29.3	1.4e-13
WP_003140539.1|4409473_4412083_+	glycosyltransferase	NA	M1I277	Paramecium_bursaria_Chlorella_virus	26.8	1.1e-16
WP_069376805.1|4412197_4413349_+	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_003140543.1|4413348_4414152_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_003082373.1|4414169_4414553_+	hypothetical protein	NA	NA	NA	NA	NA
4414231:4414247	attL	GGCTGGAACAGGCGCTG	NA	NA	NA	NA
WP_003082372.1|4414657_4414867_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	58.1	2.0e-14
WP_003140545.1|4415186_4416545_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	26.0	2.3e-13
WP_003082360.1|4416886_4417597_-	response regulator	NA	W8CYM9	Bacillus_phage	33.5	3.3e-32
WP_003082358.1|4418329_4421221_+	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2H4P767	Pseudomonas_phage	46.3	9.9e-184
WP_015648380.1|4421413_4422619_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_069376806.1|4422611_4424069_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_015648377.1|4426172_4426583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154052184.1|4427220_4427601_-	mCpol domain-containing protein	NA	NA	NA	NA	NA
WP_154066777.1|4429948_4430917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069382932.1|4431069_4431321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003105872.1|4434550_4434772_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
4432082:4432098	attR	CAGCGCCTGTTCCAGCC	NA	NA	NA	NA
WP_015648372.1|4434874_4435465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075116582.1|4437648_4438251_+	type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein	NA	NA	NA	NA	NA
WP_049339758.1|4438445_4441364_-|transposase	Tn3-like element ISPa38 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.4	0.0e+00
WP_001389365.1|4441388_4442153_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_000376623.1|4442659_4443160_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000259031.1|4443287_4444127_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000679427.1|4444120_4444468_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001261740.1|4445719_4446511_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_001067855.1|4449695_4450400_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 8
NZ_CP012584	Pseudomonas aeruginosa strain PA_D25, complete genome	6683204	4657450	4737465	6683204	transposase,integrase,tRNA	Escherichia_phage(22.73%)	72	4697185:4697244	4733282:4734104
WP_087920907.1|4657450_4658613_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	53.2	9.5e-85
WP_031686419.1|4658899_4660426_+	conjugal transfer protein TraG	NA	NA	NA	NA	NA
WP_071534421.1|4660474_4660822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003123374.1|4660940_4661213_+	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_031686420.1|4661216_4661567_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_031636509.1|4661863_4662406_-	DUF924 family protein	NA	E3T4R4	Cafeteria_roenbergensis_virus	31.7	4.8e-15
WP_023124010.1|4662402_4664178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031636511.1|4664270_4665044_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_023124012.1|4665097_4665997_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_023124013.1|4666027_4666765_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_023124014.1|4666914_4668366_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_031636513.1|4668387_4669191_-	class II aldolase/adducin family protein	NA	NA	NA	NA	NA
WP_023124016.1|4669328_4670255_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023124017.1|4670443_4672138_+	hypothetical protein	NA	A0A1V0SI18	Klosneuvirus	31.4	1.5e-54
WP_023124018.1|4672134_4673079_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_023124019.1|4673119_4674163_+	gentisate 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_023124020.1|4674478_4675708_+	3-hydroxybenzoate 6-monooxygenase	NA	NA	NA	NA	NA
WP_077563447.1|4676143_4678075_+	DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_034005563.1|4678071_4679355_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_003086132.1|4679858_4680533_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	39.3	2.3e-30
WP_023657672.1|4680548_4681343_-	7-carboxy-7-deazaguanine synthase QueE	NA	NA	NA	NA	NA
WP_003120698.1|4681415_4682240_-	tol-pal system protein YbgF	NA	NA	NA	NA	NA
WP_003111417.1|4682249_4682756_-	peptidoglycan-associated lipoprotein Pal	NA	NA	NA	NA	NA
WP_003086128.1|4682808_4684107_-	Tol-Pal system protein TolB	NA	NA	NA	NA	NA
WP_003086127.1|4684103_4685147_-	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_003086126.1|4685149_4685590_-	protein TolR	NA	NA	NA	NA	NA
WP_003086125.1|4685612_4686308_-	protein TolQ	NA	NA	NA	NA	NA
WP_003086124.1|4686309_4686756_-	tol-pal system-associated acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_003086123.1|4686808_4687867_-	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	26.8	4.0e-05
WP_003086122.1|4687877_4688483_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_003112575.1|4688499_4689024_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	24.4	2.6e-05
WP_003086107.1|4689108_4689855_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_069376817.1|4689921_4691697_-|tRNA	aspartate--tRNA ligase	tRNA	A0A1V0SIS0	Klosneuvirus	27.8	1.5e-12
WP_003086103.1|4692136_4692607_+	DNA starvation/stationary phase protection protein	NA	A0A2H4N7L5	Lake_Baikal_phage	36.4	6.6e-21
WP_003106665.1|4692820_4693435_+	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	46.8	1.4e-10
WP_003086099.1|4693483_4693693_-	protein SlyX	NA	NA	NA	NA	NA
WP_023910379.1|4693693_4694323_-	HIT domain-containing protein	NA	NA	NA	NA	NA
WP_001067855.1|4695173_4695878_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000902128.1|4695969_4696149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000018326.1|4696302_4697118_-	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	98.5	4.3e-161
4697185:4697244	attL	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTG	NA	NA	NA	NA
WP_001067855.1|4697247_4697952_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000015696.1|4698309_4698588_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_079858798.1|4698613_4698799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002310911.1|4698795_4699134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001297013.1|4699037_4700228_-	tetracycline efflux MFS transporter Tet(C)	NA	A0A2H4UVM2	Bodo_saltans_virus	24.0	8.1e-07
WP_001038045.1|4700320_4700980_+	tetracycline resistance transcriptional repressor TetR(C)	NA	NA	NA	NA	NA
WP_001067855.1|4701812_4702517_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_015057121.1|4702407_4703367_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	40.5	1.7e-47
WP_003159191.1|4703527_4704082_+	aminoglycoside N-acetyltransferase AAC(6')-Ib4	NA	NA	NA	NA	NA
WP_001256776.1|4704348_4705608_+	chloramphenicol efflux MFS transporter CmlA1	NA	S4TR35	Salmonella_phage	31.7	1.7e-26
WP_001261740.1|4705700_4706492_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_000777554.1|4706567_4707041_+	trimethoprim-resistant dihydrofolate reductase DfrA1	NA	A0A140HLG8	Bacillus_phage	34.4	1.6e-19
WP_000679427.1|4707744_4708092_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|4708085_4708925_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000376623.1|4709052_4709553_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001389365.1|4710059_4710824_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_049339758.1|4710848_4713767_+|transposase	Tn3-like element ISPa38 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.4	0.0e+00
WP_075116582.1|4713961_4714564_-	type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein	NA	NA	NA	NA	NA
WP_015648370.1|4714962_4715265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031757590.1|4715355_4716756_-	AAA family ATPase	NA	I4AZM6	Saccharomonospora_phage	32.5	5.0e-40
WP_015648372.1|4716752_4717343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003105872.1|4717445_4717667_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_069376833.1|4717685_4720889_-	type I restriction endonuclease subunit R	NA	NA	NA	NA	NA
WP_015648374.1|4720889_4722263_-	type I restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_069376834.1|4722259_4724242_-	SAM-dependent DNA methyltransferase	NA	A0A220A2U5	Liberibacter_phage	24.9	1.6e-31
WP_154052184.1|4724628_4725009_+	mCpol domain-containing protein	NA	NA	NA	NA	NA
WP_015648377.1|4725646_4726057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069376806.1|4728161_4729619_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_015648380.1|4729611_4730817_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_001067855.1|4733344_4734049_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_003086091.1|4735234_4735642_-	PaaI family thioesterase	NA	NA	NA	NA	NA
4733282:4734104	attR	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTGCACATGAACCCATTCAAAGGCCGGCATTTTCAGCGTGACATCATTCTGTGGGCCGTACGCTGGTACTGCAAATACGGCATCAGTTACCGTGAGCTGCAGGAGATGCTGGCTGAACGCGGAGTGAATGTCGATCACTCCACGATTTACCGCTGGGTTCAGCGTTATGCGCCTGAAATGGAAAAACGGCTGCGCTGGTACTGGCGTAACCCTTCCGATCTTTGCCCGTGGCACATGGATGAAACCTACGTGAAGGTCAATGGCCGCTGGGCGTATCTGTACCGGGCCGTCGACAGCCGGGGCCGCACTGTCGATTTTTATCTCTCCTCCCGTCGTAACAGCAAAGCTGCATACCGGTTTCTGGGTAAAATCCTCAACAACGTGAAGAAGTGGCAGATCCCGCGATTCATCAACACGGATAAAGCGCCCGCCTATGGTCGCGCGCTTGCTCTGCTCAAACGCGAAGGCCGGTGCCCGTCTGACGTTGAACACCGACAGATTAAGTACCGGAACAACGTGATTGAATGCGATCATGGCAAACTGAAACGGATAATCGGCGCCACGCTGGGATTTAAATCCATGAAGACGGCTTACGCCACCATCAAAGGTATTGAGGTGATGCGTGCACTACGCAAAGGCCAGGCCTCAGCATTTTATTATGGTGATCCCCTGGGCGAAATGCGCCTGGTAAGCAGAGTTTTTGAAATGTAAGGCCTTTGAATAAGACAAAAGGCTGCCTCATCGCTAACTTTGCAACAGTGCCCCT	NA	NA	NA	NA
WP_003086089.1|4735749_4737465_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
>prophage 9
NZ_CP012584	Pseudomonas aeruginosa strain PA_D25, complete genome	6683204	6122747	6187584	6683204	capsid,tail,terminase,portal,head,protease	Acidithiobacillus_phage(37.84%)	75	NA	NA
WP_023098208.1|6122747_6123566_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_023876105.1|6123715_6125002_+	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	39.8	2.9e-10
WP_003096067.1|6125030_6126341_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	29.0	3.9e-26
WP_003096069.1|6126340_6127114_+	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_033876922.1|6127182_6128664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003096075.1|6128701_6129457_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003106330.1|6129606_6130359_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003111636.1|6130449_6131196_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003106334.1|6131367_6132138_-	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
WP_003106336.1|6132148_6132886_-	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
WP_034075387.1|6132934_6133195_-	DUF2164 domain-containing protein	NA	NA	NA	NA	NA
WP_003096087.1|6133198_6133837_-	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
WP_003096088.1|6133836_6134430_-	imidazoleglycerol-phosphate dehydratase HisB	NA	NA	NA	NA	NA
WP_003118016.1|6134590_6134989_+	acetyl-CoA sensor PanZ family protein	NA	NA	NA	NA	NA
WP_009314450.1|6135025_6135262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069376948.1|6135258_6136365_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_034019954.1|6136458_6138711_+	AsmA family protein	NA	NA	NA	NA	NA
WP_069376949.1|6138707_6139775_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_003096100.1|6139818_6140091_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_034019955.1|6140118_6141201_+	oxidoreductase	NA	NA	NA	NA	NA
WP_069376950.1|6141684_6141915_-	DUF2188 domain-containing protein	NA	A0A142KA22	Gordonia_phage	37.1	9.4e-05
WP_069376951.1|6141986_6142952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069376952.1|6142955_6144191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069376953.1|6144435_6144765_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_069377030.1|6144859_6145708_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0A7RTT7	Clostridium_phage	33.3	4.1e-05
WP_154052191.1|6145733_6146555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_055451266.1|6146877_6147351_+	DUF2924 domain-containing protein	NA	K4I3X1	Acidithiobacillus_phage	51.4	1.4e-34
WP_069376955.1|6147347_6148760_+	recombinase family protein	NA	K4ICM1	Acidithiobacillus_phage	58.4	2.0e-137
WP_069376956.1|6148756_6149221_+	hypothetical protein	NA	K4HZX2	Acidithiobacillus_phage	37.3	1.4e-15
WP_020200569.1|6149395_6149659_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_069376957.1|6149670_6150147_+	hypothetical protein	NA	K4HZ96	Acidithiobacillus_phage	65.2	4.6e-54
WP_069377031.1|6150152_6150434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069376958.1|6150436_6151195_+	antirepressor	NA	K4I1D2	Acidithiobacillus_phage	68.5	1.7e-87
WP_069376959.1|6151194_6152055_+	ATP-binding protein	NA	K4HZX9	Acidithiobacillus_phage	70.9	2.4e-109
WP_069376960.1|6152060_6152690_+	hypothetical protein	NA	K4ICM8	Acidithiobacillus_phage	68.8	5.1e-77
WP_055451273.1|6152699_6153188_+	hypothetical protein	NA	K4I3X7	Acidithiobacillus_phage	80.5	2.0e-73
WP_069376961.1|6153184_6153922_+	hypothetical protein	NA	K4HZA0	Acidithiobacillus_phage	75.4	2.7e-109
WP_024541980.1|6153918_6154146_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_069376962.1|6154138_6156430_+	hypothetical protein	NA	K4HZY1	Acidithiobacillus_phage	64.6	7.9e-293
WP_024541982.1|6156555_6157032_+	hypothetical protein	NA	K4ICN3	Acidithiobacillus_phage	73.5	1.3e-59
WP_024541983.1|6157033_6157243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069376963.1|6157235_6157634_+	RNA polymerase subunit sigma	NA	NA	NA	NA	NA
WP_069376964.1|6157992_6159408_+	site-specific DNA-methyltransferase	NA	K4I3Y2	Acidithiobacillus_phage	61.1	3.9e-165
WP_069376965.1|6159404_6160667_+	site-specific DNA-methyltransferase	NA	A0A2H4JGF1	uncultured_Caudovirales_phage	89.7	1.2e-223
WP_069376966.1|6160630_6160999_-	hypothetical protein	NA	A0A2H4JI44	uncultured_Caudovirales_phage	85.8	1.5e-57
WP_069376967.1|6161096_6161660_-	DUF3489 domain-containing protein	NA	A0A2H4JE21	uncultured_Caudovirales_phage	80.9	1.1e-33
WP_069376968.1|6161755_6161962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069376969.1|6162068_6162614_+	elements of external origin	NA	A0A2H4JCL4	uncultured_Caudovirales_phage	65.7	2.6e-53
WP_069376970.1|6162613_6164572_+|terminase	phage terminase large subunit family protein	terminase	A0A2H4JIC6	uncultured_Caudovirales_phage	88.4	0.0e+00
WP_069376971.1|6164602_6165094_+	hypothetical protein	NA	A0A0F6WCR7	Sinorhizobium_phage	49.1	9.3e-26
WP_069376972.1|6165093_6165486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069376973.1|6165485_6165707_+	hypothetical protein	NA	A0A2H4JCJ9	uncultured_Caudovirales_phage	58.9	1.7e-11
WP_069376974.1|6165708_6167223_+|portal	phage portal protein	portal	A0A1B2LRR5	Wolbachia_phage	56.0	5.8e-151
WP_069376975.1|6167256_6168498_+|protease	Clp protease ClpP	protease	K4HZZ6	Acidithiobacillus_phage	41.7	3.7e-63
WP_004629291.1|6168499_6168877_+|head	head decoration protein	head	A0A1B2LRT0	Wolbachia_phage	53.9	1.8e-16
WP_024541998.1|6168879_6169884_+|capsid	major capsid protein	capsid	Q9JMM2	Wolbachia_phage	67.1	2.4e-124
WP_069376976.1|6169883_6170186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069376977.1|6170190_6170637_+	hypothetical protein	NA	A0A2I5ARB4	Synechococcus_phage	29.8	2.1e-08
WP_069376978.1|6170642_6170864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054286366.1|6170860_6171613_+	hypothetical protein	NA	A0A2D2W2E0	Stenotrophomonas_phage	44.6	3.3e-46
WP_054286367.1|6171624_6172023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054286368.1|6172019_6172229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069376979.1|6172203_6172848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069376980.1|6172849_6176887_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	29.2	4.7e-30
WP_069376981.1|6176923_6177334_+	hypothetical protein	NA	A0A0M4UTA7	Ralstonia_phage	48.5	3.1e-30
WP_069376982.1|6177333_6180942_+	hypothetical protein	NA	A0A0M4U447	Ralstonia_phage	41.1	3.2e-240
WP_069376983.1|6180989_6182255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069376984.1|6182258_6183344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069376985.1|6183340_6183736_+	hypothetical protein	NA	Q6VSZ7	Vibrio_phage	34.1	1.5e-05
WP_069376986.1|6183739_6185767_+	hypothetical protein	NA	A0A0M4UKC5	Ralstonia_phage	36.1	7.2e-56
WP_069376987.1|6185759_6185981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069376988.1|6186060_6186366_+	hypothetical protein	NA	K4I011	Acidithiobacillus_phage	62.6	1.6e-23
WP_045667467.1|6186362_6186590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069376989.1|6186586_6187087_+	lysozyme	NA	A0A1S6L191	Ralstonia_phage	39.8	1.9e-18
WP_069376990.1|6187083_6187584_+	hypothetical protein	NA	A0A077K9R7	Ralstonia_phage	50.0	8.6e-27
