The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP012560	Klebsiella pneumoniae strain UCLAOXA232KP_Pt0 chromosome, complete genome	5312744	4500	15195	5312744	integrase	Klebsiella_phage(46.67%)	18	7161:7175	12317:12331
WP_071854265.1|4500_4734_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPK9	Escherichia_phage	63.9	4.9e-17
WP_029602970.1|4889_5549_+	LexA family transcriptional regulator	NA	A0A1B5FPF4	Escherichia_phage	79.5	9.4e-98
WP_040182568.1|5712_6126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004177202.1|6308_6533_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023304721.1|6533_6899_+	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	97.5	5.8e-57
WP_040186816.1|6891_7146_+	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	89.3	1.4e-36
WP_004177208.1|7117_7336_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	98.6	6.6e-32
7161:7175	attL	AGGCGCTGCAGGTCC	NA	NA	NA	NA
WP_040186814.1|7332_7773_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	80.8	7.5e-59
WP_040186812.1|7813_8332_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	97.7	9.4e-93
WP_032415174.1|8337_9063_+	Rha family transcriptional regulator	NA	A0A286S260	Klebsiella_phage	99.6	1.4e-131
WP_040186810.1|9052_9277_+	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	94.6	1.7e-30
WP_103219593.1|9273_10158_+	hypothetical protein	NA	A0A2H4FNA9	Salmonella_phage	70.6	5.1e-06
WP_004198245.1|10230_10377_+	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	70.8	2.9e-15
WP_077255525.1|10336_10579_+	AlpA family transcriptional regulator	NA	A0A0M4RTZ2	Salmonella_phage	73.8	2.2e-20
WP_040186739.1|10559_11741_-|integrase	site-specific integrase	integrase	A0A0M4QX09	Salmonella_phage	84.2	1.3e-201
WP_016197745.1|11937_12486_+	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
12317:12331	attR	GGACCTGCAGCGCCT	NA	NA	NA	NA
WP_004224331.1|12684_14217_-	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	30.0	1.5e-21
WP_023285032.1|14433_15195_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.1	3.1e-20
>prophage 2
NZ_CP012560	Klebsiella pneumoniae strain UCLAOXA232KP_Pt0 chromosome, complete genome	5312744	169744	215882	5312744	terminase,tRNA,head,integrase,portal,tail,plate,capsid	Enterobacteria_phage(52.94%)	55	174972:174989	212148:212165
WP_004892876.1|169744_170245_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_002901080.1|170361_170808_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_004140469.1|170791_171586_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_020324105.1|171693_172869_+	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_004140471.1|172900_173593_-	CTP synthase	NA	NA	NA	NA	NA
WP_020802835.1|173738_174248_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_014343000.1|174252_174591_+	DUF488 family protein	NA	NA	NA	NA	NA
WP_004176548.1|174580_174820_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
174972:174989	attL	CCCGACGGGGCTTTTTTT	NA	NA	NA	NA
WP_004213128.1|175084_175336_-	ogr/Delta-like zinc finger family protein	NA	A0A2I8TV89	Erwinia_phage	49.2	3.4e-08
WP_040181406.1|175379_176519_-	phage late control D family protein	NA	B9A7A9	Serratia_phage	72.3	9.4e-146
WP_040181409.1|176673_177846_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	70.7	5.0e-158
WP_004216461.1|177845_178361_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	61.2	2.2e-57
WP_004131585.1|178406_178724_+	hypothetical protein	NA	B9A7B2	Serratia_phage	54.8	1.0e-17
WP_071591910.1|178744_178882_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	65.9	4.4e-10
WP_040181412.1|178868_181844_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	46.4	2.0e-219
WP_040181415.1|181859_182333_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	66.9	6.6e-53
WP_040181417.1|182796_183459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052450975.1|183476_184700_-	DUF262 domain-containing protein	NA	A0A1V0S9I8	Catovirus	27.5	7.8e-05
WP_040181419.1|185299_186397_-|tail	phage tail protein	tail	G4KKN6	Yersinia_phage	47.8	5.2e-08
WP_023339950.1|186396_186609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040181424.1|186605_189632_-|tail	phage tail protein I	tail	D5LGZ2	Escherichia_phage	40.7	6.4e-24
WP_023300878.1|189621_190545_-|plate	baseplate J/gp47 family protein	plate	A0A0A7NPY5	Enterobacteria_phage	43.6	7.6e-53
WP_040181426.1|190546_190897_-	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	58.2	1.8e-23
WP_009486481.1|190893_191481_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	60.5	6.9e-60
WP_020316957.1|191477_192113_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	51.9	4.6e-57
WP_040181428.1|192109_192577_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	58.8	4.5e-46
WP_158246032.1|192577_192913_-	peptidase	NA	B6SD31	Bacteriophage	33.3	2.1e-05
WP_023339943.1|193099_193645_-	lysozyme	NA	Q1I0Z1	Pasteurella_virus	43.0	6.3e-31
WP_004213110.1|193641_193926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004131559.1|193916_194117_-|tail	tail protein X	tail	A0A0A7NV57	Enterobacteria_phage	63.1	1.6e-16
WP_040181431.1|194116_194632_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	48.8	2.7e-39
WP_040181433.1|194744_195602_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	61.3	9.8e-71
WP_023328071.1|195651_196686_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	50.0	3.6e-96
WP_040181436.1|196695_197535_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	66.3	4.3e-95
WP_040181438.1|197691_199419_+	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	67.1	1.0e-228
WP_048289843.1|199412_200474_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	68.1	9.1e-143
WP_040181440.1|201318_202110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040181442.1|202109_204380_+	UvrD-helicase domain-containing protein	NA	NA	NA	NA	NA
WP_162899463.1|205200_207252_-	replication endonuclease	NA	A0A0M4RTM8	Salmonella_phage	52.3	6.2e-188
WP_040181444.1|207269_208226_-	DNA adenine methylase	NA	A0A0M4QWR0	Salmonella_phage	54.4	1.5e-83
WP_023329528.1|208458_209025_-	3'-5' exoribonuclease	NA	D4HTX2	Vibrio_phage	33.2	2.8e-13
WP_004213098.1|209021_209246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023329526.1|209314_209587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040181449.1|209602_209980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004216643.1|209995_210214_-	hypothetical protein	NA	A0A0M5M1I3	Salmonella_phage	49.1	3.6e-06
WP_020806130.1|210234_210513_-	regulatory phage cox family protein	NA	Q1JS60	Enterobacteria_phage	88.9	6.2e-43
WP_004213095.1|210633_210933_+	helix-turn-helix transcriptional regulator	NA	Q1JS61	Enterobacteria_phage	77.8	6.5e-38
WP_040181453.1|211048_212032_+|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	79.8	1.4e-150
WP_004176549.1|212296_213310_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	29.0	1.9e-12
212148:212165	attR	CCCGACGGGGCTTTTTTT	NA	NA	NA	NA
WP_004150782.1|213367_213469_+	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_004892898.1|213468_213543_+	protein YoaJ	NA	NA	NA	NA	NA
WP_004140488.1|213660_213786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004140489.1|213845_214109_-	DUF2534 family protein	NA	NA	NA	NA	NA
WP_004150783.1|214239_214878_-	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_023302064.1|214967_215882_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	50.4	1.1e-72
>prophage 3
NZ_CP012560	Klebsiella pneumoniae strain UCLAOXA232KP_Pt0 chromosome, complete genome	5312744	478371	487845	5312744	protease,tRNA	Brazilian_cedratvirus(16.67%)	8	NA	NA
WP_023302125.1|478371_480093_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
WP_023302126.1|480137_480839_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|481192_481411_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002896522.1|481541_483821_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_002896520.1|483851_484169_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|484494_484716_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_004150848.1|484792_486733_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896440.1|486729_487845_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
>prophage 4
NZ_CP012560	Klebsiella pneumoniae strain UCLAOXA232KP_Pt0 chromosome, complete genome	5312744	969436	1014383	5312744	terminase,lysis,tRNA,head,tail,coat	Cronobacter_phage(27.08%)	65	NA	NA
WP_040181289.1|969436_969676_-	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	51.9	4.2e-16
WP_071854268.1|969781_970582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040186451.1|972667_975145_-	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	45.3	1.4e-197
WP_040181295.1|975131_975527_-	C40 family peptidase	NA	F1C5F2	Cronobacter_phage	54.8	4.7e-36
WP_004196571.1|975523_975994_-	hypothetical protein	NA	R9TPR6	Aeromonas_phage	40.4	1.2e-27
WP_023283377.1|975993_976470_-	hypothetical protein	NA	A0A2P1MXB5	Escherichia_phage	49.0	3.0e-37
WP_071854269.1|976583_976997_+	hypothetical protein	NA	G0ZNE8	Cronobacter_phage	89.8	5.0e-65
WP_040181302.1|977016_977196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040181305.1|977236_979807_-|tail	tail protein (tape measure)	tail	F1C5E9	Cronobacter_phage	40.3	8.5e-94
WP_071854270.1|979898_980369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040181307.1|980424_980763_-	hypothetical protein	NA	H6WRV3	Salmonella_phage	57.3	1.0e-31
WP_052450973.1|980858_981332_-	DUF2335 domain-containing protein	NA	NA	NA	NA	NA
WP_023339090.1|981300_981498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040181310.1|981644_982202_-	Rha family transcriptional regulator	NA	A0A088CBJ5	Shigella_phage	88.2	6.7e-89
WP_040181312.1|982419_983133_-	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	54.6	2.1e-63
WP_023283367.1|983201_983966_-	immunoglobulin domain-containing protein	NA	G0ZNE6	Cronobacter_phage	43.8	2.7e-40
WP_023339086.1|984024_984408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040181318.1|984404_984773_-	hypothetical protein	NA	F1C5E3	Cronobacter_phage	82.0	1.9e-47
WP_040181321.1|984775_985138_-	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	50.8	1.6e-27
WP_038434988.1|985137_985311_-	hypothetical protein	NA	Q5G8X7	Enterobacteria_phage	51.8	1.2e-12
WP_032439723.1|985310_985691_-	hypothetical protein	NA	F1C5E2	Cronobacter_phage	54.5	4.1e-29
WP_029884066.1|985693_985933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040027496.1|985965_987021_-|coat	phage coat protein	coat	A0A291AXD4	Shigella_phage	53.2	2.2e-101
WP_016529582.1|987017_987479_-	hypothetical protein	NA	B1GS72	Salmonella_phage	50.3	5.0e-29
WP_040181327.1|987478_988834_-	hypothetical protein	NA	F1C5D9	Cronobacter_phage	53.1	5.1e-130
WP_020804668.1|988884_989088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087749279.1|989084_990098_-|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	69.7	1.8e-116
WP_040181330.1|990015_991464_-	hypothetical protein	NA	F1C5D7	Cronobacter_phage	51.0	2.1e-118
WP_040181332.1|991475_993044_-|terminase	terminase	terminase	G8C7P3	Escherichia_phage	91.2	2.4e-301
WP_069377345.1|993040_993691_-	hypothetical protein	NA	G8C7P2	Escherichia_phage	89.4	6.2e-102
WP_087749278.1|993759_993897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040181192.1|993899_994367_-|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	73.5	7.5e-57
WP_040181191.1|994363_994867_-	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	78.4	5.0e-75
WP_012967717.1|994869_995184_-	hypothetical protein	NA	H6WRZ3	Salmonella_phage	86.1	8.3e-44
WP_065807620.1|995958_996648_-	antiterminator	NA	I6PDF8	Cronobacter_phage	54.9	1.1e-56
WP_004136182.1|996644_996785_-	YlcG family protein	NA	NA	NA	NA	NA
WP_065807619.1|996781_997012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065807618.1|997008_997617_-	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	65.7	2.3e-50
WP_065807617.1|997609_998278_-	metallophosphoesterase	NA	K7P6H8	Enterobacteria_phage	76.0	4.1e-101
WP_071854273.1|998274_998442_-	NinE family protein	NA	NA	NA	NA	NA
WP_004191566.1|998447_999044_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	54.3	1.2e-56
WP_077269010.1|999450_999927_-	DUF551 domain-containing protein	NA	A0A077SK54	Escherichia_phage	35.4	3.0e-13
WP_009308003.1|1000427_1000604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065807615.1|1000603_1001143_-	hypothetical protein	NA	A0A1V0E5L5	Salmonella_phage	37.6	9.3e-19
WP_065807614.1|1001135_1001372_-	hypothetical protein	NA	S4TVX5	Salmonella_phage	50.0	1.5e-13
WP_162899465.1|1001368_1001818_-	hypothetical protein	NA	R9TME7	Aeromonas_phage	31.7	7.5e-06
WP_012542626.1|1001820_1002114_-	protein ren	NA	O48423	Enterobacteria_phage	65.6	2.5e-26
WP_065807612.1|1002110_1002983_-	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	69.4	3.8e-94
WP_065807611.1|1002967_1003822_-	replication protein	NA	K7PGT1	Enterobacteria_phage	54.8	2.8e-62
WP_001548453.1|1003907_1004129_-	hypothetical protein	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
WP_004194000.1|1004168_1004396_-	Cro/Cl family transcriptional regulator	NA	A0A2I6PIE5	Escherichia_phage	61.2	1.9e-18
WP_032429930.1|1004464_1005187_+	helix-turn-helix transcriptional regulator	NA	E7C9R0	Salmonella_phage	63.2	9.4e-75
WP_004178798.1|1005436_1005910_+	hypothetical protein	NA	K7PLT9	Enterobacteria_phage	58.5	1.1e-52
WP_004178796.1|1005906_1006839_+	hypothetical protein	NA	K7PGT0	Enterobacteria_phage	55.5	1.9e-91
WP_074183191.1|1007222_1007348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019704100.1|1007340_1007535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040182107.1|1007624_1007909_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	81.9	1.7e-40
WP_040182110.1|1007925_1008672_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	67.7	7.0e-65
WP_040182112.1|1008668_1009292_+	YqaJ viral recombinase family protein	NA	A0A0S2SY31	Pseudomonas_phage	59.2	5.8e-57
WP_040182113.1|1009320_1009848_+	phage N-6-adenine-methyltransferase	NA	Q9ZWX6	Enterobacteria_phage	61.0	1.1e-56
WP_040182114.1|1009844_1010063_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	52.2	4.4e-12
WP_071531921.1|1010064_1010400_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004143017.1|1011871_1012738_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
WP_004143016.1|1012739_1012952_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_004143010.1|1012997_1014383_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
>prophage 5
NZ_CP012560	Klebsiella pneumoniae strain UCLAOXA232KP_Pt0 chromosome, complete genome	5312744	3677901	3734049	5312744	protease,holin,terminase,integrase,tRNA,head,portal,tail,capsid	Klebsiella_phage(54.35%)	72	3700901:3700924	3740355:3740378
WP_004145598.1|3677901_3679320_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_002913435.1|3679371_3679764_-	putative DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_002913434.1|3679767_3680121_-	putative DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_023301631.1|3680742_3682914_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_002913423.1|3682962_3684165_-	nucleoside permease NupC	NA	NA	NA	NA	NA
WP_002913421.1|3684511_3685753_+	Nramp family divalent metal transporter	NA	NA	NA	NA	NA
WP_004899719.1|3685810_3686164_-	DUF2502 domain-containing protein	NA	NA	NA	NA	NA
WP_023301632.1|3686294_3687287_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_023301633.1|3687467_3689129_+	indolepyruvate decarboxylase	NA	NA	NA	NA	NA
WP_004180794.1|3689125_3690361_-	ion channel protein	NA	NA	NA	NA	NA
WP_002913377.1|3690624_3691590_+	glucokinase	NA	NA	NA	NA	NA
WP_002913374.1|3691643_3692381_-	response regulator transcription factor	NA	A0A2R2ZGH8	Clostridioides_phage	26.3	1.5e-14
WP_004149230.1|3692392_3694090_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	28.5	6.7e-47
WP_004153200.1|3694088_3694202_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032409803.1|3694198_3694384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002913372.1|3694472_3695687_+	alanine transaminase	NA	NA	NA	NA	NA
WP_099119320.1|3695757_3695829_-	membrane protein YpdK	NA	NA	NA	NA	NA
WP_004185022.1|3696167_3697364_-	cyanate transporter	NA	NA	NA	NA	NA
WP_023301635.1|3697360_3697819_-	nucleoside deaminase	NA	A0A0B5J096	Pandoravirus	33.1	7.2e-12
WP_004149227.1|3697951_3698860_+	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	24.2	4.6e-10
WP_023301636.1|3698869_3699751_-	hypothetical protein	NA	A0A2H4JEC4	uncultured_Caudovirales_phage	56.8	1.5e-05
WP_004174945.1|3700117_3700600_-	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
3700901:3700924	attL	TATATCCATTTAACTAAGGGGACA	NA	NA	NA	NA
WP_064184927.1|3701118_3702288_+|integrase	site-specific integrase	integrase	A0A2R2Z2Y0	Escherichia_phage	85.5	1.1e-200
WP_064184926.1|3702320_3703259_+	DUF2971 domain-containing protein	NA	J9Q7Y9	Salmonella_phage	31.7	5.8e-08
WP_077255880.1|3703274_3703460_-	hypothetical protein	NA	G3CFG7	Escherichia_phage	61.4	2.4e-14
WP_064184925.1|3703467_3704076_-	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	82.4	4.8e-48
WP_004141386.1|3704072_3704285_-	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	45.5	8.1e-11
WP_064184924.1|3704284_3705025_-	hypothetical protein	NA	R9TPK2	Aeromonas_phage	97.3	2.5e-30
WP_048270910.1|3705302_3705713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064184923.1|3705840_3706626_-	hypothetical protein	NA	C7BGF1	Burkholderia_phage	53.3	8.1e-64
WP_040149782.1|3706625_3706925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019705289.1|3707313_3707958_-	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	40.7	8.2e-38
WP_024176406.1|3708052_3708262_+	cell division protein	NA	NA	NA	NA	NA
WP_004213338.1|3708287_3708749_+	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	88.2	1.7e-69
WP_001208720.1|3708986_3709166_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	73.1	4.6e-15
WP_069377391.1|3709155_3710124_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	66.0	1.6e-85
WP_049006283.1|3710120_3710930_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	69.3	3.5e-110
WP_000779146.1|3710939_3711317_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	73.6	2.3e-48
WP_071854253.1|3711329_3712310_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	66.9	1.1e-134
WP_064184919.1|3712323_3712902_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	55.6	1.9e-49
WP_064184918.1|3713053_3713293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024176410.1|3713462_3713762_+|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	83.8	4.5e-39
WP_064184917.1|3713758_3714298_+	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	96.6	3.1e-99
WP_064184916.1|3714294_3714642_+	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	78.3	5.7e-38
WP_064184915.1|3714638_3714914_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	65.2	2.1e-22
WP_052454910.1|3714864_3715062_+	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	84.5	7.3e-22
WP_106493672.1|3715217_3715640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064184914.1|3715636_3716929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004216876.1|3717005_3717251_+	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	96.3	3.0e-33
WP_042950192.1|3717317_3717539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042950190.1|3717595_3717886_+	HNH endonuclease	NA	A0A286N2R3	Klebsiella_phage	94.8	1.7e-51
WP_004216880.1|3717898_3718108_+	hypothetical protein	NA	A0A286N2R4	Klebsiella_phage	87.0	2.6e-25
WP_064184913.1|3718229_3718664_+	hypothetical protein	NA	A0A286S1P9	Klebsiella_phage	99.3	2.4e-73
WP_004143904.1|3718673_3720206_+|terminase	terminase	terminase	A0A286S1M9	Klebsiella_phage	100.0	3.9e-296
WP_017880221.1|3720208_3721486_+|portal	phage portal protein	portal	A0A286S1N5	Klebsiella_phage	100.0	6.2e-247
WP_077269009.1|3721491_3722172_+|head,protease	HK97 family phage prohead protease	head,protease	A0A286S1N1	Klebsiella_phage	99.6	6.0e-124
WP_064184946.1|3722183_3723347_+|capsid	phage major capsid protein	capsid	A0A286S1R4	Klebsiella_phage	99.7	7.7e-212
WP_133060710.1|3723383_3723626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017880223.1|3723573_3723900_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A286S294	Klebsiella_phage	100.0	7.5e-56
WP_004143899.1|3723960_3724158_+	hypothetical protein	NA	A0A286S2A5	Klebsiella_phage	100.0	1.7e-26
WP_064184945.1|3724159_3724492_+|head	phage head closure protein	head	A0A286S2A2	Klebsiella_phage	99.1	1.5e-56
WP_064184944.1|3724484_3725024_+	HK97 gp10 family phage protein	NA	A0A286S249	Klebsiella_phage	99.4	2.3e-94
WP_000561415.1|3725020_3725386_+	DUF3168 domain-containing protein	NA	A0A286S1R1	Klebsiella_phage	92.6	3.9e-61
WP_000115125.1|3725442_3725934_+	hypothetical protein	NA	A0A286S1Q8	Klebsiella_phage	100.0	2.3e-88
WP_004899623.1|3725977_3726361_+|tail	phage tail assembly chaperone family protein, TAC	tail	A0A286S1N4	Klebsiella_phage	86.3	1.4e-53
WP_004104224.1|3726363_3726627_+	hypothetical protein	NA	A0A286S1P2	Klebsiella_phage	91.9	3.0e-39
WP_133060711.1|3726685_3727063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064184943.1|3727111_3729646_+|tail	phage tail tape measure protein	tail	A0A286S1S3	Klebsiella_phage	74.4	0.0e+00
WP_004899614.1|3729645_3730125_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	98.7	1.7e-93
WP_064184942.1|3730111_3730594_+	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	98.8	3.9e-85
WP_064184941.1|3730603_3730984_+	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	96.0	1.8e-69
WP_065802474.1|3730980_3734049_+	kinase	NA	A0A286S259	Klebsiella_phage	97.7	0.0e+00
3740355:3740378	attR	TATATCCATTTAACTAAGGGGACA	NA	NA	NA	NA
>prophage 6
NZ_CP012560	Klebsiella pneumoniae strain UCLAOXA232KP_Pt0 chromosome, complete genome	5312744	3962006	3968911	5312744	tRNA	Planktothrix_phage(33.33%)	6	NA	NA
WP_004175147.1|3962006_3962870_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
WP_004180550.1|3962880_3963654_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
WP_004151134.1|3963894_3964791_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_004144192.1|3965033_3966395_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.8	1.8e-207
WP_004175198.1|3966713_3967436_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_004149058.1|3967432_3968911_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
>prophage 7
NZ_CP012560	Klebsiella pneumoniae strain UCLAOXA232KP_Pt0 chromosome, complete genome	5312744	4303400	4360234	5312744	terminase,integrase,head,tail,lysis,plate	Salmonella_phage(32.2%)	83	4301571:4301588	4350878:4350895
4301571:4301588	attL	GGCGCCGACCTGCTGGCG	NA	NA	NA	NA
WP_004175494.1|4303400_4304696_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	36.8	9.6e-62
WP_074183181.1|4304707_4305517_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_021312745.1|4305757_4307020_-	DUF3596 domain-containing protein	NA	A0A286S1S8	Klebsiella_phage	95.0	1.7e-233
WP_040181674.1|4307062_4307308_-	excisionase family protein	NA	A0A286S2A4	Klebsiella_phage	92.1	1.9e-35
WP_009483816.1|4307311_4307530_-	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	52.2	2.6e-12
WP_032431536.1|4307526_4307736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040218332.1|4307732_4307924_-	DUF1382 family protein	NA	G9L698	Escherichia_phage	64.4	1.3e-12
WP_065802489.1|4307920_4308685_-	hypothetical protein	NA	Q71T76	Escherichia_phage	58.3	3.0e-71
WP_040181679.1|4308901_4309672_-	hypothetical protein	NA	D5LH17	Escherichia_phage	51.0	3.2e-65
WP_024264482.1|4309668_4310196_-	phage N-6-adenine-methyltransferase	NA	Q9ZWX6	Enterobacteria_phage	62.2	1.3e-57
WP_016529279.1|4310192_4310351_-	DUF1317 family protein	NA	A0A0N7CHV0	Escherichia_phage	58.8	6.7e-10
WP_040181683.1|4310347_4311034_-	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	90.6	4.8e-113
WP_129693859.1|4311026_4311647_-	hypothetical protein	NA	A0A076GAP8	Staphylococcus_phage	43.8	5.5e-23
WP_040181685.1|4311643_4312489_-	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	58.8	2.6e-68
WP_040181687.1|4312504_4312789_-	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	78.7	4.3e-39
WP_008807814.1|4312869_4313076_-	phage encoded cell division inhibitor protein	NA	A0A0M4S6W3	Salmonella_phage	94.1	1.4e-31
WP_004219883.1|4313068_4313194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021312733.1|4313572_4314232_-	helix-turn-helix domain-containing protein	NA	K7P7K3	Enterobacteria_phage	61.5	1.9e-69
WP_004191589.1|4314340_4314559_+	helix-turn-helix transcriptional regulator	NA	A0A1P8DTF8	Proteus_phage	50.7	1.4e-13
WP_001548453.1|4314599_4314821_+	hypothetical protein	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
WP_065807611.1|4314906_4315761_+	replication protein	NA	K7PGT1	Enterobacteria_phage	54.8	2.8e-62
WP_065807612.1|4315745_4316618_+	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	69.4	3.8e-94
WP_012542626.1|4316614_4316908_+	protein ren	NA	O48423	Enterobacteria_phage	65.6	2.5e-26
WP_162899465.1|4316910_4317360_+	hypothetical protein	NA	R9TME7	Aeromonas_phage	31.7	7.5e-06
WP_065807614.1|4317356_4317593_+	hypothetical protein	NA	S4TVX5	Salmonella_phage	50.0	1.5e-13
WP_065807615.1|4317585_4318125_+	hypothetical protein	NA	A0A1V0E5L5	Salmonella_phage	37.6	9.3e-19
WP_009308003.1|4318124_4318301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077269010.1|4318801_4319278_+	DUF551 domain-containing protein	NA	A0A077SK54	Escherichia_phage	35.4	3.0e-13
WP_004191566.1|4319684_4320281_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	54.3	1.2e-56
WP_071854273.1|4320286_4320454_+	NinE family protein	NA	NA	NA	NA	NA
WP_065807617.1|4320450_4321119_+	metallophosphoesterase	NA	K7P6H8	Enterobacteria_phage	76.0	4.1e-101
WP_065807618.1|4321111_4321720_+	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	65.7	2.3e-50
WP_065807619.1|4321716_4321947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004136182.1|4321943_4322084_+	YlcG family protein	NA	NA	NA	NA	NA
WP_065807620.1|4322080_4322770_+	antiterminator	NA	I6PDF8	Cronobacter_phage	54.9	1.1e-56
WP_012967717.1|4323544_4323859_+	hypothetical protein	NA	H6WRZ3	Salmonella_phage	86.1	8.3e-44
WP_040181191.1|4323861_4324365_+	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	78.4	5.0e-75
WP_040181192.1|4324361_4324829_+|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	73.5	7.5e-57
WP_087749278.1|4324831_4324969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074422973.1|4325325_4325814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040181195.1|4325764_4327165_+|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.2	7.2e-188
WP_039108763.1|4327402_4328854_+	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	68.4	7.2e-191
WP_025714257.1|4328909_4329458_+	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.9	1.0e-49
WP_025714258.1|4329503_4329698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040181203.1|4329707_4330910_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	52.8	5.3e-107
WP_040181205.1|4330913_4331408_+	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	61.5	2.1e-49
WP_064162991.1|4331997_4333227_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1V0E8G8	Vibrio_phage	40.5	3.6e-74
WP_048265733.1|4333350_4333563_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_071854257.1|4334348_4334873_+	host cell division inhibitor Icd-like protein	NA	A0A2H4JGN8	uncultured_Caudovirales_phage	43.7	1.4e-14
WP_069377377.1|4334865_4335048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064162993.1|4335040_4335919_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_064162994.1|4335911_4336091_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064162995.1|4336087_4336351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064162996.1|4336347_4336566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071854258.1|4336571_4336790_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_069377378.1|4336786_4339132_+	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	39.9	1.3e-146
WP_069377379.1|4340136_4340805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069377380.1|4341305_4341821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069377382.1|4342376_4342895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040181209.1|4343729_4344011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065802501.1|4343979_4344399_+	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	60.7	4.4e-40
WP_064151821.1|4344395_4345010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065519890.1|4345009_4345396_+|head,tail	head-tail adaptor	head,tail	A0A2H4J1A4	uncultured_Caudovirales_phage	75.8	5.8e-47
WP_004152176.1|4345490_4345931_+	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.7	1.6e-40
WP_065802503.1|4345934_4347080_+	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	77.7	1.3e-166
WP_023312781.1|4347089_4347533_+	DUF3277 family protein	NA	A0A0M5M1K6	Salmonella_phage	80.0	2.1e-61
WP_065802505.1|4347536_4347956_+	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	66.7	3.0e-41
WP_065802507.1|4347997_4348150_+	NTP pyrophosphohydrolase	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	76.0	1.0e-15
WP_065802509.1|4348139_4350137_+	lytic transglycosylase domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	61.7	7.5e-231
WP_065802512.1|4350136_4350712_+	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	71.2	1.7e-66
WP_074422975.1|4350787_4351015_+	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	49.3	1.3e-17
4350878:4350895	attR	GGCGCCGACCTGCTGGCG	NA	NA	NA	NA
WP_065807621.1|4351017_4352079_+	hypothetical protein	NA	A0A0M4QX01	Salmonella_phage	69.9	2.1e-139
WP_065807629.1|4352114_4352423_+	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	90.9	2.4e-35
WP_050008892.1|4352434_4352791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065807623.1|4353013_4353670_+	translation initiation factor IF-2	NA	A0A0M5M1K7	Salmonella_phage	64.8	1.7e-83
WP_048289810.1|4353666_4354020_+	bacteriophage protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	78.6	3.0e-50
WP_065807624.1|4354019_4355219_+|plate	baseplate J/gp47 family protein	plate	A0A0M4RD32	Salmonella_phage	75.3	5.8e-162
WP_040181232.1|4355215_4355989_+	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	51.0	1.8e-68
WP_069377383.1|4355988_4356762_+	hypothetical protein	NA	A0A248SL44	Klebsiella_phage	49.2	8.6e-26
WP_119183683.1|4356780_4358763_+	hypothetical protein	NA	A0A286S1P0	Klebsiella_phage	27.6	1.2e-26
WP_071854259.1|4358772_4359573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064172271.1|4359677_4359917_+	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	50.6	1.4e-14
WP_040181238.1|4359916_4360234_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	52.0	1.8e-22
>prophage 8
NZ_CP012560	Klebsiella pneumoniae strain UCLAOXA232KP_Pt0 chromosome, complete genome	5312744	5052733	5063621	5312744		Escherichia_phage(87.5%)	9	NA	NA
WP_040182019.1|5052733_5055841_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
WP_004176258.1|5055895_5057161_+	MFS transporter	NA	NA	NA	NA	NA
WP_040182017.1|5057191_5058280_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	99.7	8.8e-210
WP_004176262.1|5058366_5058627_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
WP_001620095.1|5058924_5059785_+	class A broad-spectrum beta-lactamase SHV-1	NA	A0A077SL40	Escherichia_phage	99.7	4.4e-156
WP_002210513.1|5059805_5060567_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_002903955.1|5060828_5061731_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_032423485.1|5061742_5063008_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.3	6.6e-233
WP_002210516.1|5063000_5063621_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 9
NZ_CP012560	Klebsiella pneumoniae strain UCLAOXA232KP_Pt0 chromosome, complete genome	5312744	5238269	5312464	5312744	protease,holin,terminase,tRNA,head,portal,tail,plate,capsid	Klebsiella_phage(69.7%)	74	NA	NA
WP_002902422.1|5238269_5239205_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	93.0	3.5e-138
WP_004151591.1|5239250_5240624_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.3	8.6e-53
WP_004148192.1|5241149_5242133_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_023302015.1|5242412_5243156_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.1	1.0e-15
WP_023302016.1|5243118_5244237_+	oxidoreductase	NA	NA	NA	NA	NA
WP_004176404.1|5244473_5244668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019705261.1|5244780_5245527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004892563.1|5246594_5247263_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002902393.1|5248276_5249083_-	methionine-binding protein	NA	NA	NA	NA	NA
WP_023285056.1|5249303_5250479_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_004179583.1|5250523_5251558_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004179582.1|5251646_5252195_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_024622999.1|5252249_5253161_-	NmrA/HSCARG family protein	NA	NA	NA	NA	NA
WP_020324664.1|5253153_5254023_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_052455031.1|5254719_5255034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004190483.1|5255053_5255959_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_021440014.1|5256103_5257033_+	aromatic alcohol reductase	NA	NA	NA	NA	NA
WP_004179576.1|5257058_5257265_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_004151595.1|5257315_5258194_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_004151596.1|5258352_5259108_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_021440012.1|5259112_5259706_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023302022.1|5259779_5260493_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_009309032.1|5260559_5261054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040181981.1|5261181_5261724_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_004176418.1|5261701_5262787_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_021440010.1|5262750_5264505_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004183804.1|5264583_5266176_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_021440009.1|5266172_5269622_-	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_021440008.1|5269611_5270793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040181978.1|5270741_5270999_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_023302028.1|5273427_5273958_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_021440005.1|5273982_5274759_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_024623002.1|5274762_5277132_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	33.0	2.4e-18
WP_023302030.1|5277133_5279788_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	33.4	7.7e-98
WP_002902160.1|5280052_5280544_-	type VI secretion system effector Hcp	NA	NA	NA	NA	NA
WP_021440002.1|5280548_5282255_-	OmpA family protein	NA	NA	NA	NA	NA
WP_004176431.1|5282251_5282941_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_004179544.1|5282937_5284281_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_023302033.1|5284290_5285835_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_004176434.1|5285877_5286369_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_019705237.1|5287214_5287463_+	DinI-like family protein	NA	S5MQI1	Escherichia_phage	70.4	1.0e-25
WP_040186352.1|5288564_5289365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048322138.1|5291414_5294483_-	kinase	NA	A0A286S259	Klebsiella_phage	97.2	0.0e+00
WP_004152651.1|5294479_5294860_-	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	99.2	1.8e-72
WP_040182606.1|5294869_5295352_-	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	98.8	6.0e-86
WP_004899614.1|5295338_5295818_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	98.7	1.7e-93
WP_040182604.1|5295817_5298265_-|tail	phage tail tape measure protein	tail	A0A286S1S3	Klebsiella_phage	66.5	5.9e-278
WP_004143894.1|5298309_5298777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004143895.1|5298842_5299106_-	hypothetical protein	NA	A0A286S1P2	Klebsiella_phage	98.8	5.9e-43
WP_001177591.1|5299138_5299492_-|tail	phage tail assembly chaperone family protein, TAC	tail	A0A286S1N4	Klebsiella_phage	99.1	4.9e-61
WP_000115125.1|5299535_5300027_-	hypothetical protein	NA	A0A286S1Q8	Klebsiella_phage	100.0	2.3e-88
WP_000561415.1|5300082_5300448_-	DUF3168 domain-containing protein	NA	A0A286S1R1	Klebsiella_phage	92.6	3.9e-61
WP_004216814.1|5300444_5300984_-	HK97 gp10 family phage protein	NA	A0A286S249	Klebsiella_phage	99.4	3.0e-94
WP_040186341.1|5300976_5301309_-|head	phage head closure protein	head	A0A286S2A2	Klebsiella_phage	98.2	1.0e-55
WP_004899632.1|5301310_5301508_-	hypothetical protein	NA	A0A286S2A5	Klebsiella_phage	96.9	2.4e-25
WP_040186860.1|5301568_5301895_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A286S294	Klebsiella_phage	99.1	9.8e-56
WP_044067369.1|5301842_5302085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040186862.1|5302121_5303285_-|capsid	phage major capsid protein	capsid	A0A286S1R4	Klebsiella_phage	99.2	3.8e-211
WP_077255528.1|5303296_5303977_-|head,protease	HK97 family phage prohead protease	head,protease	A0A286S1N1	Klebsiella_phage	99.6	2.7e-124
WP_017880221.1|5303982_5305260_-|portal	phage portal protein	portal	A0A286S1N5	Klebsiella_phage	100.0	6.2e-247
WP_004143904.1|5305262_5306795_-|terminase	terminase	terminase	A0A286S1M9	Klebsiella_phage	100.0	3.9e-296
WP_004143905.1|5306804_5307239_-	hypothetical protein	NA	A0A286S1P9	Klebsiella_phage	100.0	6.2e-74
WP_040182582.1|5307360_5307570_-	hypothetical protein	NA	A0A286N2R4	Klebsiella_phage	84.1	2.4e-23
WP_040182580.1|5307582_5307873_-	HNH endonuclease	NA	A0A286N2R3	Klebsiella_phage	94.8	2.9e-51
WP_071854263.1|5307943_5308150_-	DUF551 domain-containing protein	NA	A0A286N2R2	Klebsiella_phage	97.1	1.1e-33
WP_032408647.1|5308230_5308467_-	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	94.9	1.6e-31
WP_023304730.1|5308791_5309064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031591489.1|5309196_5309481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040182576.1|5309716_5309992_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	41.6	9.9e-09
WP_023304728.1|5309999_5310629_-	glycoside hydrolase family 19 protein	NA	G8C7W0	Escherichia_phage	90.9	6.9e-106
WP_019705280.1|5310628_5310910_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	80.6	3.9e-37
WP_017145563.1|5310896_5311292_-|holin	phage holin family protein	holin	K7PHB9	Enterobacterial_phage	98.5	2.6e-63
WP_031280381.1|5311854_5312301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004184721.1|5312206_5312464_-	hypothetical protein	NA	A0A286N2Q3	Klebsiella_phage	100.0	1.3e-42
