The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP014583	Escherichia coli strain CFSAN004176 chromosome, complete genome	5193734	1605	10005	5193734	tail	Enterobacteria_phage(66.67%)	6	NA	NA
WP_000847298.1|1605_1935_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_141073548.1|3324_3957_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	97.6	2.7e-102
WP_069356987.1|4192_7672_+	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	95.3	0.0e+00
WP_001449501.1|7740_8364_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	60.4	8.7e-69
WP_069356988.1|8429_9734_+|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.2	1.6e-77
WP_044861268.1|9735_10005_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q9EYE9	Enterobacteria_phage	94.4	5.1e-42
>prophage 2
NZ_CP014583	Escherichia coli strain CFSAN004176 chromosome, complete genome	5193734	286953	352626	5193734	tail,transposase,protease,holin,terminase,integrase	Stx2-converting_phage(28.3%)	72	299946:300005	351426:352690
WP_000214712.1|286953_287157_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_044705919.1|287240_288653_-	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	30.1	6.4e-43
WP_001120551.1|290156_290399_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_001121225.1|290993_291644_+	type III secretion system effector NleG7	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_000491541.1|291868_292744_-	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	97.6	2.8e-158
WP_001023386.1|292884_293154_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJT0	Stx_converting_phage	95.5	6.0e-43
WP_071961467.1|293155_294469_-|tail	phage tail protein	tail	Q6H9S9	Enterobacteria_phage	98.9	1.1e-76
WP_085948186.1|294938_296095_-|transposase	IS3-like element IS600 family transposase	transposase	NA	NA	NA	NA
WP_001063025.1|298222_298444_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
299946:300005	attL	CTGAGGTGTACTGGCAATAGCGGACACTACCATTTGTTCTTTTTTTAAGCAGCCATCTGA	NA	NA	NA	NA
WP_085948186.1|299989_301146_-|transposase	IS3-like element IS600 family transposase	transposase	NA	NA	NA	NA
WP_069357033.1|301207_302512_-|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.8	8.3e-255
WP_000958380.1|302508_303072_-|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
WP_001303046.1|303361_303727_-	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	100.0	2.0e-65
WP_071961468.1|303768_303993_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	3.8e-19
WP_001303878.1|304074_304389_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_012816791.1|304915_305101_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000675931.1|305322_305436_-	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_085948186.1|305924_307081_-|transposase	IS3-like element IS600 family transposase	transposase	NA	NA	NA	NA
WP_000138558.1|307616_307889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024182511.1|308144_308360_-|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	97.2	1.7e-32
WP_032316861.1|308799_310650_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.4	0.0e+00
WP_000466957.1|311220_311652_-	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
WP_000762928.1|312217_313039_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.2	4.1e-82
WP_001217410.1|313035_313410_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.1e-33
WP_001265233.1|313422_314472_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.3	3.4e-110
WP_000191872.1|314473_314746_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_000756596.1|314867_315212_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000935259.1|315331_315544_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_069357035.1|316582_316927_-	ead/Ea22-like family protein	NA	NA	NA	NA	NA
WP_077886833.1|316913_317219_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	79.0	7.8e-39
WP_077886881.1|317215_317491_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.9e-28
WP_069357037.1|317523_318240_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	60.7	1.8e-70
WP_069357038.1|318269_319010_-	ATP-binding protein	NA	V5UQI5	Shigella_phage	87.1	6.4e-119
WP_069357039.1|319016_319982_-	hypothetical protein	NA	U5P0A0	Shigella_phage	60.6	6.5e-55
WP_069357040.1|319962_320484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071961527.1|320467_320740_-	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	63.4	4.2e-20
WP_042106857.1|320865_321258_+	helix-turn-helix domain-containing protein	NA	H6WRX4	Salmonella_phage	39.6	1.3e-14
WP_001022416.1|321304_321664_-	helix-turn-helix domain-containing protein	NA	A0A222YXG1	Escherichia_phage	94.1	7.2e-60
WP_042106859.1|321666_321969_-	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	42.2	4.9e-17
WP_077886834.1|322244_322397_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	6.6e-07
WP_069357042.1|322408_323047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001133037.1|323047_323257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069357044.1|323819_324008_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_069357045.1|324004_324193_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_069357046.1|324288_326760_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.0	5.7e-55
WP_042059548.1|326830_327082_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	4.9e-15
WP_001171554.1|327614_327995_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|327991_328339_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|328388_329927_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_085948186.1|330280_331437_-|transposase	IS3-like element IS600 family transposase	transposase	NA	NA	NA	NA
WP_000422741.1|331666_332092_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000624722.1|332088_332439_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_032285709.1|332469_334083_+|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.4	1.5e-181
WP_085948186.1|334118_335275_-|transposase	IS3-like element IS600 family transposase	transposase	NA	NA	NA	NA
WP_069357662.1|335336_335468_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	97.7	7.9e-17
WP_069357047.1|335751_337602_-	SASA family carbohydrate esterase	NA	H6WZJ9	Escherichia_phage	95.6	0.0e+00
WP_000261909.1|338369_339083_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_069357048.1|339703_340522_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000090265.1|340675_341047_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.0	1.0e-53
WP_001217436.1|341036_341408_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_069357049.1|341420_342470_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.0	2.1e-107
WP_069357663.1|342471_342750_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	50.8	7.4e-12
WP_001004961.1|343935_344586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000887491.1|344751_344964_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	97.1	1.7e-29
WP_001278454.1|345153_345258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000206794.1|345373_345958_-	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	83.5	5.5e-33
WP_069357050.1|346014_346410_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	50.7	2.3e-30
WP_085948186.1|347585_348741_+|transposase	IS3-like element IS600 family transposase	transposase	NA	NA	NA	NA
WP_077886835.1|348782_349712_-|integrase	site-specific integrase	integrase	Q20GI2	Phage_258-320	61.1	2.3e-105
WP_000005552.1|349731_349983_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_097310802.1|350055_351417_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	57.0	8.0e-59
WP_085948186.1|351469_352626_-|transposase	IS3-like element IS600 family transposase	transposase	NA	NA	NA	NA
351426:352690	attR	CTGAGGTGTACTGGCAATAGCGGACACTACCATTTGTTCTTTTTTTAAGCAGCCATCTGATGATATTTTTCCCTGAAGGCTGCCGGGGAGATATTCCCCAGACGAGAGTGACGACGCTGACGATTGTAGAAAATCTCAATGTATTCCCGTATTACTGAGATGGCTTCATCCCGGTTATTAAAACGATAGTGGCTCAGGCTCTCATTTTTCAGCGTTCCCCAGAAGCTTTCCATCGGAGCGTTGTCGTAACAGTTACCTTTACGCGACATTGATGTTTTCAGACCAAACTGCTCCTGTATGACCCGGTAATCGTATGCGCAGTACTGTGAACCTCGATCAGAGTGGTGGATTAGCCCGGCAGGTGGGCGCTGGCTCCTGAGCGCCATAAACAGGGCTTTACCTGTCAGCTCTTTTGTCATGCGCTCTCCCATGGCGTAGCCGACAATTTCGCACGTATAAACATCTTTGATGCCAGCGAGGTACAACCATCCCTCCTGTGTGGCAACATACGTCAGGTCCGCCACCCAGACCTGATTTGGTGCTGTAGGAGCGAACGTCTGGTTCAGCAGATTTGGCGCAACTGGCAGATTGTGGTTCGAGTTCGTAGTCGCTCTGAACTTGCGTTTCTGCTTACAGCGTAGCCTTAGCTCCTTACGAAGACGTGCCAGTCGGTCACGACCAACGATGATGCCATTCTCTGCCAGCTCCGTCTGGAGCCGCCGGGTTCCATATGTTTCGCGAGTGCGGATATGTGCCACCTTAATCTCCAGTTTTAGCCGCTCATCACTTTGTTTTCTGTCTGAGGGTTCATGCTGTACCCAGTTGTAATAACCGCTCCTGGATACACCAAATACCTGACACATCGCTTCAATGGGAAATTGTTGTCGCCATTGTTCGATTAACGCGTATTTTTCAGCGACTCCTGTGCAAAATACGCTGTTGCTTTTTTTAATATATCTCGCTCAAGGCGAGCTTCATTTAACGCCTTACGCAGTTGCAGAATTTCAGATTCCAGTTCAGCCACCGTGCGGGAACCAGGAGTACCGAGCCCTTTTCTGGCGGCGGTAACCCATTGTCCTAAAGTGCCTTCAGGAAGAGATAATCGGGAAGCGCCTTCACTGATCGAAAGTTGATTTTCAAGAACCGTTCTGACAGCTTCGGCTTTGAACTCTTTAGAGTAACGTTGGGTTTTTCTGCTCATTATTAGCTCCTTCTGATGCCATTCTATTTCAGGAAGGAGTGTCCGTTAAACTCAGGCTACCTCA	NA	NA	NA	NA
>prophage 3
NZ_CP014583	Escherichia coli strain CFSAN004176 chromosome, complete genome	5193734	604148	699266	5193734	portal,tail,tRNA,protease,holin,terminase	Enterobacteria_phage(43.55%)	102	NA	NA
WP_000984512.1|604148_605030_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_001315679.1|605221_607270_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	6.8e-86
WP_000431368.1|607289_607988_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_001043882.1|608084_608582_-	L-methionine (R)-S-oxide reductase	NA	NA	NA	NA	NA
WP_069357076.1|608711_609995_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_001297532.1|609963_612597_+	lipid-binding membrane homeostasis protein YebT	NA	NA	NA	NA	NA
WP_024226338.1|612676_614116_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_001295499.1|614233_614470_+	DUF1480 family protein	NA	NA	NA	NA	NA
WP_001296140.1|614574_614766_+	YebW family protein	NA	NA	NA	NA	NA
WP_069357077.1|614766_615423_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	49.8	1.5e-55
WP_000976472.1|615818_616160_-	YebY family protein	NA	NA	NA	NA	NA
WP_000879280.1|616172_617045_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000168747.1|617048_617423_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000916763.1|617561_617792_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000011652.1|617893_618550_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000944256.1|618573_619236_+	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
WP_000936951.1|619232_621293_-	oligopeptidase B	NA	NA	NA	NA	NA
WP_000024745.1|621501_622161_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_001295500.1|622487_622844_-	protein YebF	NA	NA	NA	NA	NA
WP_000257738.1|622910_623201_-	DNA damage-inducible protein YebG	NA	NA	NA	NA	NA
WP_069357078.1|623334_624513_+	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_069357079.1|624568_625210_-	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_001069467.1|625246_627058_-	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_000301727.1|627292_628768_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.5	4.4e-79
WP_001056694.1|629105_629975_+	DNA-binding transcriptional regulator HexR	NA	NA	NA	NA	NA
WP_000091148.1|630102_631545_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_000448381.1|631677_632649_-	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_024226335.1|634105_635038_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_000202996.1|635116_635872_+	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_000571478.1|635868_636654_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000568519.1|636802_637813_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000580323.1|637821_638433_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_072686579.1|638571_638637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024226333.1|638707_639310_+	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001295503.1|639311_639833_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_000907234.1|639867_640608_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001300367.1|640636_641089_-	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_001258662.1|641206_642979_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000891620.1|643288_643855_+	hydrolase	NA	NA	NA	NA	NA
WP_001261935.1|644161_644410_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	95.1	3.5e-37
WP_122993102.1|644780_645794_-	M85 family metallopeptidase	NA	NA	NA	NA	NA
WP_122988840.1|646008_646086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044861268.1|646195_646465_-|tail	phage tail fiber C-terminal domain-containing protein	tail	Q9EYE9	Enterobacteria_phage	94.4	5.1e-42
WP_069356988.1|646466_647771_-|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.2	1.6e-77
WP_001449501.1|647836_648460_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	60.4	8.7e-69
WP_069356987.1|648528_652008_-	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	95.3	0.0e+00
WP_141073548.1|652243_652876_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	97.6	2.7e-102
WP_069357080.1|652821_653565_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.2	2.5e-147
WP_069357081.1|653569_654268_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.4	2.6e-130
WP_000847298.1|654267_654597_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000918266.1|654593_657239_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	99.7	0.0e+00
WP_000532075.1|657282_657591_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	99.0	3.0e-54
WP_069357082.1|657617_658040_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	99.3	1.1e-72
WP_000235101.1|658053_658806_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.8	3.2e-134
WP_000682716.1|658813_659212_-|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000974958.1|659224_659848_-|tail	phage tail protein	tail	Q8VNN3	Enterobacteria_phage	100.0	8.9e-106
WP_001281348.1|659850_660132_-	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	100.0	2.1e-46
WP_001097065.1|660124_660451_-	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001114424.1|660538_662563_-|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.8	0.0e+00
WP_069357083.1|662507_664010_-|portal	phage portal protein	portal	S5MW34	Escherichia_phage	99.6	1.6e-289
WP_000102415.1|664009_664222_-	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_001077625.1|664218_666342_-|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	0.0e+00
WP_000348565.1|666338_666815_-	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	100.0	2.1e-83
WP_012816791.1|667330_667516_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001092902.1|668034_668568_-	lysozyme	NA	G9L6J6	Escherichia_phage	96.6	2.1e-100
WP_069357666.1|668604_669150_-	hypothetical protein	NA	Q08JA0	Stx2-converting_phage	80.5	1.1e-46
WP_000284510.1|669153_669369_-|holin	class II holin family protein	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_001290217.1|669445_669718_-	DUF826 domain-containing protein	NA	A0A0P0ZC09	Stx2-converting_phage	100.0	4.8e-24
WP_000143457.1|669758_669938_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	98.3	3.7e-25
WP_069357084.1|670074_672021_-	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	97.5	0.0e+00
WP_000738072.1|672531_672801_-	Shiga toxin Stx2a subunit B	NA	Q6DWN4	Enterobacteria_phage	100.0	1.2e-43
WP_000649753.1|672812_673772_-	Shiga toxin Stx2c subunit A	NA	Q776Q3	Enterobacteria_phage	100.0	5.6e-176
WP_000483505.1|674154_675213_-	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	98.0	2.9e-205
WP_000917741.1|675364_675562_-	hypothetical protein	NA	A0A0P0ZDH6	Stx2-converting_phage	100.0	8.0e-29
WP_001204809.1|675777_676158_-	antitermination protein Q	NA	S5M7R9	Escherichia_phage	99.2	1.4e-66
WP_001202271.1|676176_677166_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	98.2	8.9e-193
WP_001065352.1|677217_677475_-	hypothetical protein	NA	Q8W639	Enterobacteria_phage	71.1	1.2e-21
WP_000203852.1|677471_678872_-	replicative DNA helicase	NA	Q8W640	Enterobacteria_phage	92.4	1.7e-245
WP_069357085.1|678868_679747_-	ATP-binding protein	NA	Q8W641	Enterobacteria_phage	95.6	6.0e-140
WP_001247844.1|679757_680666_-	hypothetical protein	NA	Q8W642	Enterobacteria_phage	94.0	2.4e-59
WP_000621233.1|680652_680886_-	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	47.2	1.6e-12
WP_000587259.1|680882_681545_-	ash family protein	NA	Q8W643	Enterobacteria_phage	92.5	3.7e-110
WP_001090254.1|681653_682361_-	Rha family transcriptional regulator	NA	Q8W645	Enterobacteria_phage	90.2	1.6e-114
WP_000944728.1|682442_682676_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPK9	Escherichia_phage	77.0	1.2e-28
WP_000789654.1|682832_683522_+	LexA family transcriptional regulator	NA	A0A1B5FPF4	Escherichia_phage	88.2	3.0e-115
WP_000387836.1|683670_684372_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPB8	Escherichia_phage	59.7	1.5e-37
WP_000147364.1|684368_684569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000553977.1|684767_684950_+	hypothetical protein	NA	Q8W652	Enterobacteria_phage	52.7	2.9e-09
WP_001365075.1|684955_685528_+	hypothetical protein	NA	Q8W653	Enterobacteria_phage	71.3	5.5e-78
WP_000720006.1|685897_686725_+	hypothetical protein	NA	Q8W654	Enterobacteria_phage	97.5	1.2e-129
WP_001484100.1|686765_687137_+	DUF5406 family protein	NA	Q8W655	Enterobacteria_phage	95.1	2.3e-61
WP_001193437.1|687328_687583_+	excisionase family protein	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_000063650.1|687616_688903_+	DUF3596 domain-containing protein	NA	Q20GI2	Phage_258-320	99.8	6.9e-254
WP_069190626.1|688907_689684_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	4.7e-72
WP_000252980.1|689736_690132_+	MAPEG family protein	NA	NA	NA	NA	NA
WP_000019588.1|690172_690916_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000564725.1|690912_691884_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_069357086.1|692048_694478_-	trimethylamine N-oxide reductase TorZ	NA	NA	NA	NA	NA
WP_024226209.1|694502_695603_-	NapC/NirT family cytochrome c	NA	NA	NA	NA	NA
WP_069357087.1|695990_696737_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_001307851.1|696750_697317_-	VOC family protein	NA	NA	NA	NA	NA
WP_069357088.1|697532_699266_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.5	3.4e-86
>prophage 4
NZ_CP014583	Escherichia coli strain CFSAN004176 chromosome, complete genome	5193734	783128	812667	5193734	transposase,terminase,tail,holin	Escherichia_phage(44.12%)	43	NA	NA
WP_032316817.1|783128_783458_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q6H9S9	Enterobacteria_phage	100.0	6.9e-49
WP_069357095.1|783518_783941_-	hypothetical protein	NA	A0A291AWV9	Escherichia_phage	51.6	2.6e-32
WP_032312299.1|783942_784221_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_000422686.1|784521_784947_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	2.0e-48
WP_069356963.1|784943_785294_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	65.5	4.0e-39
WP_000080195.1|785324_786938_+|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
WP_000958398.1|788756_789320_-|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	94.1	7.3e-83
WP_001303046.1|789609_789975_-	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	100.0	2.0e-65
WP_069357096.1|790016_790244_+	DUF3950 domain-containing protein	NA	A0A0P0ZCA1	Stx2-converting_phage	98.7	1.5e-34
WP_000736096.1|790612_790837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047091958.1|790922_791108_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	98.3	1.3e-17
WP_001043239.1|791329_791548_-	hypothetical protein	NA	Q687G2	Enterobacteria_phage	93.3	1.0e-16
WP_085948186.1|792037_793193_+|transposase	IS3-like element IS600 family transposase	transposase	NA	NA	NA	NA
WP_000731190.1|793476_793821_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	3.8e-58
WP_024165672.1|793825_794041_-|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	98.6	7.7e-33
WP_069357098.1|794474_796325_-	SASA family carbohydrate esterase	NA	H6WZJ9	Escherichia_phage	99.0	0.0e+00
WP_069357099.1|796896_797325_-	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.1	6.4e-63
WP_069357100.1|797563_798253_-	antiterminator	NA	I6PDF8	Cronobacter_phage	47.1	6.3e-52
WP_069357101.1|798249_798615_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.7	7.9e-38
WP_069357102.1|798615_799674_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.6	8.0e-91
WP_069357667.1|799675_799954_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	50.8	3.7e-11
WP_001260977.1|800089_800347_+	type II toxin-antitoxin system ParD family antitoxin	NA	A0A0N7C055	Escherichia_phage	86.7	1.5e-30
WP_069357103.1|800352_800652_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2R2Z2Y1	Escherichia_phage	98.0	1.1e-50
WP_069357104.1|800854_801244_-	hypothetical protein	NA	A0A222YWE8	Escherichia_phage	52.1	5.9e-23
WP_069357105.1|801339_801696_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	99.2	2.3e-58
WP_069357106.1|801697_802159_-	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	65.2	6.2e-64
WP_000699805.1|802145_802379_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	50.7	3.6e-12
WP_077886885.1|802375_802657_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	3.6e-30
WP_069357108.1|802689_803457_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	67.3	4.3e-78
WP_157917783.1|803491_804034_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.0	1.7e-84
WP_069357109.1|803945_804986_-	phage replisome organizer	NA	A0A0U2RT81	Escherichia_phage	93.4	3.7e-104
WP_069357110.1|805057_805483_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_069357111.1|805466_805739_-	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	50.0	5.0e-13
WP_069357112.1|805848_806250_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	53.0	1.3e-12
WP_000100899.1|806277_806469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000936798.1|806468_806756_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_021523420.1|807030_807183_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	1.7e-07
WP_172907136.1|807194_807554_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	51.0	2.7e-06
WP_069357115.1|808282_808471_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199478.1|808467_808656_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_069357116.1|808748_811187_+	exonuclease	NA	V5UQJ3	Shigella_phage	45.1	1.3e-112
WP_069357117.1|811248_811455_+	excisionase	NA	NA	NA	NA	NA
WP_085948186.1|811511_812667_+|transposase	IS3-like element IS600 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP014583	Escherichia coli strain CFSAN004176 chromosome, complete genome	5193734	957495	1010451	5193734	tail,portal,head,capsid,transposase,protease,holin,terminase	Enterobacteria_phage(37.5%)	64	NA	NA
WP_000003671.1|957495_958083_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_001186424.1|958079_958787_-	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_069357138.1|958805_960599_-	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001058323.1|960595_961714_-	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_012817749.1|962829_963582_+	type III effector	NA	NA	NA	NA	NA
WP_001023445.1|963706_963976_-|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	97.8	2.1e-43
WP_085948186.1|964187_965343_+|transposase	IS3-like element IS600 family transposase	transposase	NA	NA	NA	NA
WP_069357139.1|966622_967246_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	61.8	2.3e-69
WP_069357140.1|967313_970790_-	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	96.5	0.0e+00
WP_158707114.1|971036_971669_-|tail	tail assembly protein	tail	A0A0P0ZDX8	Stx2-converting_phage	94.7	1.8e-101
WP_069357142.1|971614_972358_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.6	3.3e-147
WP_069357143.1|972368_973067_-|tail	phage minor tail protein L	tail	Q6H9T5	Enterobacteria_phage	95.7	4.6e-127
WP_032211147.1|973066_973396_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	97.2	5.2e-57
WP_069357144.1|973392_976008_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	81.7	0.0e+00
WP_071961477.1|975988_976402_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	84.2	1.9e-43
WP_069357145.1|976428_976851_-|tail	phage minor tail protein G	tail	S5MQJ3	Escherichia_phage	90.7	2.6e-64
WP_069357146.1|976866_977616_-|tail	phage tail protein	tail	S5M7Q5	Escherichia_phage	95.2	9.6e-131
WP_042106356.1|977623_978019_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	80.9	1.7e-57
WP_069357147.1|978015_978591_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	58.3	2.9e-50
WP_069357148.1|978606_978960_-|tail	phage tail protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.9e-41
WP_069357149.1|978952_979336_-	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_069357150.1|979387_980416_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	62.2	1.3e-114
WP_069357151.1|980473_980821_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	53.3	5.2e-23
WP_069357152.1|980857_982363_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.7	1.0e-99
WP_069357153.1|982352_983945_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	1.8e-182
WP_000259002.1|983941_984148_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_069357154.1|984131_986060_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.5	1.4e-263
WP_000235436.1|986031_986541_-|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_032176216.1|986942_987167_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.9	9.2e-21
WP_001302717.1|987248_987563_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_123056124.1|988047_988233_-	hypothetical protein	NA	A0A0P0ZCT3	Stx2-converting_phage	88.5	1.5e-13
WP_000459343.1|988454_988592_-	hypothetical protein	NA	Q687G2	Enterobacteria_phage	95.6	2.2e-17
WP_000992152.1|988751_989285_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	96.0	6.2e-100
WP_000731190.1|989335_989680_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	3.8e-58
WP_000284518.1|989684_989900_-|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_001290231.1|989976_990249_-	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000143462.1|990289_990469_-	DUF1378 family protein	NA	A0A0P0ZCJ7	Stx2-converting_phage	100.0	3.7e-25
WP_032212763.1|990604_992542_-	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	96.7	0.0e+00
WP_000466957.1|993020_993452_-	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
WP_097310795.1|993897_994611_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_069357156.1|994747_994945_-	TrmB family transcriptional regulator	NA	Q9MC00	Enterobacteria_phage	96.9	1.0e-28
WP_069357157.1|995168_995723_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	68.0	2.1e-66
WP_069357158.1|995731_996091_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.9	6.2e-35
WP_069357159.1|996103_997153_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	57.8	1.6e-115
WP_069357667.1|997154_997433_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	50.8	3.7e-11
WP_001260977.1|997568_997826_+	type II toxin-antitoxin system ParD family antitoxin	NA	A0A0N7C055	Escherichia_phage	86.7	1.5e-30
WP_069357103.1|997831_998131_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2R2Z2Y1	Escherichia_phage	98.0	1.1e-50
WP_077886843.1|998335_998836_-	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	64.8	9.8e-23
WP_001002669.1|998966_999278_-	hypothetical protein	NA	A0A222YY67	Escherichia_phage	82.5	1.2e-50
WP_069357160.1|999270_999525_-	hypothetical protein	NA	A0A0U2RK51	Escherichia_phage	98.8	6.7e-44
WP_179985401.1|999521_1000169_-	ead/Ea22-like family protein	NA	A0A0U2QW67	Escherichia_phage	79.6	4.2e-90
WP_069357161.1|1000155_1000461_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	96.0	9.8e-50
WP_069357162.1|1000457_1000880_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	93.6	9.4e-67
WP_000693883.1|1002051_1002477_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000747951.1|1002460_1002703_-	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_001397087.1|1003094_1003433_+	peptidase S24-like family protein	NA	H9C160	Pectobacterium_phage	30.7	2.5e-06
WP_172907137.1|1003778_1004078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045903484.1|1004149_1004368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069357164.1|1004390_1004798_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	40.9	1.0e-09
WP_000449192.1|1005568_1005757_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090200.1|1005753_1005945_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_085948186.1|1006385_1007541_+|transposase	IS3-like element IS600 family transposase	transposase	NA	NA	NA	NA
WP_085948186.1|1008435_1009592_-|transposase	IS3-like element IS600 family transposase	transposase	NA	NA	NA	NA
WP_000375138.1|1009791_1010451_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	54.9	5.2e-48
>prophage 6
NZ_CP014583	Escherichia coli strain CFSAN004176 chromosome, complete genome	5193734	1236580	1253347	5193734	transposase,tail,integrase,holin	Escherichia_phage(27.78%)	22	1233927:1233941	1253421:1253435
1233927:1233941	attL	TTAGTATAAAAAAGC	NA	NA	NA	NA
WP_085948186.1|1236580_1237736_+|transposase	IS3-like element IS600 family transposase	transposase	NA	NA	NA	NA
WP_069357675.1|1239755_1241069_-|tail	phage tail protein	tail	A0A0P0ZCC1	Stx2-converting_phage	97.0	1.4e-76
WP_000284515.1|1241293_1241509_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.0e-33
WP_033816266.1|1241651_1242050_+	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000499454.1|1242130_1242289_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|1242374_1243118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001235472.1|1243370_1243994_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.1	2.2e-112
WP_053884950.1|1243990_1244656_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.1	1.5e-130
WP_032205168.1|1244808_1244991_+	hypothetical protein	NA	A0A1I9LJN0	Stx_converting_phage	98.3	7.2e-24
WP_032205166.1|1244987_1245668_+	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	97.8	1.5e-130
WP_000682294.1|1245664_1245826_+	DUF1317 family protein	NA	A0A0N7CHV0	Escherichia_phage	96.0	7.7e-22
WP_000129285.1|1245818_1246376_+	phage N-6-adenine-methyltransferase	NA	E5AGF8	Erwinia_phage	62.3	2.0e-61
WP_000188870.1|1246452_1246668_+	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	100.0	1.0e-32
WP_000763378.1|1246766_1246988_+	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	97.3	8.4e-35
WP_069357193.1|1246984_1247686_+	ead/Ea22-like family protein	NA	A0A0U2QW67	Escherichia_phage	55.3	1.6e-50
WP_097310820.1|1247852_1249021_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	91.1	4.3e-170
WP_069357195.1|1249067_1249358_+	hypothetical protein	NA	Q9MCR3	Enterobacteria_phage	94.5	2.0e-20
WP_069357196.1|1249488_1250187_+	DUF1311 domain-containing protein	NA	J9Q6K3	Salmonella_phage	81.5	2.1e-100
WP_001303965.1|1250423_1250723_+	hypothetical protein	NA	G9L655	Escherichia_phage	100.0	2.4e-53
WP_085948186.1|1250861_1252018_-|transposase	IS3-like element IS600 family transposase	transposase	NA	NA	NA	NA
WP_071961483.1|1252056_1252299_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	1.6e-34
WP_069357197.1|1252276_1253347_+|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	99.7	1.5e-201
1253421:1253435	attR	TTAGTATAAAAAAGC	NA	NA	NA	NA
>prophage 7
NZ_CP014583	Escherichia coli strain CFSAN004176 chromosome, complete genome	5193734	1712748	1777061	5193734	transposase,holin	Staphylococcus_phage(16.67%)	59	NA	NA
WP_000131044.1|1712748_1714782_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
WP_001299022.1|1714910_1715498_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000089075.1|1715511_1716984_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001159102.1|1716997_1718668_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
WP_024230919.1|1718880_1719549_+	membrane protein	NA	NA	NA	NA	NA
WP_001364640.1|1719791_1720487_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_000023907.1|1720479_1721907_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_001102129.1|1721917_1722637_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_000339589.1|1723155_1724010_-	DNA-binding transcriptional regulator RclR	NA	NA	NA	NA	NA
WP_000474077.1|1725669_1725906_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_069357242.1|1725917_1726511_+	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_001299025.1|1726670_1727540_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	41.7	9.3e-53
WP_000621018.1|1727788_1728646_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_024230918.1|1728766_1733020_-	intimin-like adhesin FdeC	NA	NA	NA	NA	NA
WP_001174461.1|1733585_1734437_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	40.7	1.2e-47
WP_069357243.1|1734463_1735453_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_024226490.1|1735484_1736378_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000662258.1|1736840_1736942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000803999.1|1737305_1737569_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_024226489.1|1737568_1737709_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_001147277.1|1737743_1737971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001296902.1|1738793_1739336_+	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_000730974.1|1739410_1739998_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000716398.1|1740055_1740724_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_069357244.1|1740749_1743275_+	fimbrial usher EcpC	NA	NA	NA	NA	NA
WP_069357245.1|1743264_1744908_+	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_069357246.1|1744876_1745587_+	fimbrial chaperone EcpE	NA	NA	NA	NA	NA
WP_001303809.1|1745899_1746229_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_085948186.1|1746461_1747618_-|transposase	IS3-like element IS600 family transposase	transposase	NA	NA	NA	NA
WP_000893278.1|1748633_1749887_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
WP_001285288.1|1749898_1751002_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_069357247.1|1751289_1752345_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.6	2.9e-117
WP_000174677.1|1752383_1752785_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000189543.1|1752842_1754087_-	esterase FrsA	NA	NA	NA	NA	NA
WP_001291990.1|1754178_1754637_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001293016.1|1754897_1756355_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_071961488.1|1756411_1757002_-	peptide chain release factor H	NA	NA	NA	NA	NA
WP_025380665.1|1757055_1757481_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	97.9	5.8e-48
WP_069356963.1|1757477_1757828_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	65.5	4.0e-39
WP_000080195.1|1757858_1759472_+|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
WP_071961489.1|1760949_1761402_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001226164.1|1761398_1762454_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000207568.1|1762524_1763310_-	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001365368.1|1763254_1764622_+	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_000598760.1|1764726_1765005_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_001030484.1|1764997_1765354_+	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_000543899.1|1765410_1766184_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
WP_000729704.1|1766369_1766630_+	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_000615979.1|1766632_1766911_+	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_001225679.1|1767066_1767807_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001365365.1|1767777_1768545_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000284050.1|1768750_1769329_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_069357249.1|1769568_1772013_+	acyl-CoA dehydrogenase FadE	NA	NA	NA	NA	NA
WP_000532698.1|1772055_1772529_-	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_001118027.1|1772682_1773453_+	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_069357250.1|1773494_1774631_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_001077737.1|1775099_1775477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_176551833.1|1775476_1775755_-	type IV secretion protein Rhs	NA	NA	NA	NA	NA
WP_069357251.1|1775924_1777061_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP014583	Escherichia coli strain CFSAN004176 chromosome, complete genome	5193734	2037047	2109590	5193734	tail,tRNA,head,transposase,holin,terminase	Enterobacteria_phage(38.46%)	86	NA	NA
WP_069357277.1|2037047_2037734_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001303782.1|2038133_2038274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001194358.1|2038369_2039086_+	two-component system response regulator ArcA	NA	NA	NA	NA	NA
WP_000920343.1|2039145_2040498_-	cell envelope integrity protein CreD	NA	NA	NA	NA	NA
WP_069357278.1|2040555_2041980_-	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.4	2.7e-09
WP_069357279.1|2041995_2042676_-	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	34.7	1.8e-27
WP_000875487.1|2042688_2043162_-	protein CreA	NA	NA	NA	NA	NA
WP_000371666.1|2043372_2044242_+	MDR efflux pump AcrAB transcriptional activator RobA	NA	NA	NA	NA	NA
WP_000942344.1|2044238_2044886_-	2,3-diphosphoglycerate-dependent phosphoglycerate mutase GpmB	NA	NA	NA	NA	NA
WP_024177800.1|2044937_2045450_+	inosine/xanthosine triphosphatase	NA	NA	NA	NA	NA
WP_000068679.1|2045596_2045923_-	trp operon repressor	NA	NA	NA	NA	NA
WP_000409458.1|2046012_2047950_-	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	35.7	2.3e-11
WP_000046749.1|2048160_2049828_+	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	3.7e-42
WP_069357280.1|2050097_2051366_-	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.7	3.3e-83
WP_001029697.1|2051386_2052769_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_001132955.1|2052817_2053786_-	phosphoserine phosphatase	NA	NA	NA	NA	NA
WP_000124615.1|2053891_2054536_+	YtjB family periplasmic protein	NA	NA	NA	NA	NA
WP_000105889.1|2054563_2055580_+	lipoate--protein ligase LplA	NA	NA	NA	NA	NA
WP_000566153.1|2055611_2055761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000224877.1|2056035_2056755_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_000816471.1|2056834_2058058_-	phosphopentomutase	NA	NA	NA	NA	NA
WP_000477811.1|2058109_2059432_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	2.3e-79
WP_069357281.1|2059558_2060326_-	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_069357282.1|2060583_2062134_+	YjjI family glycine radical enzyme	NA	NA	NA	NA	NA
WP_001088381.1|2062105_2062969_+	YjjW family glycine radical enzyme activase	NA	NA	NA	NA	NA
WP_000563078.1|2063081_2063864_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_001299187.1|2063860_2064934_-	patatin family protein	NA	NA	NA	NA	NA
WP_000490275.1|2065055_2065217_-	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
WP_024225983.1|2065343_2065949_-	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000202564.1|2066341_2067928_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	24.9	5.3e-30
WP_001217539.1|2068147_2068396_+	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	100.0	1.1e-38
WP_001372053.1|2068822_2068936_+	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	77.8	1.4e-06
WP_000836769.1|2069004_2069238_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	6.4e-33
WP_060616940.1|2069617_2070208_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.3	4.7e-24
WP_085948186.1|2070764_2071920_+|transposase	IS3-like element IS600 family transposase	transposase	NA	NA	NA	NA
WP_069357283.1|2072147_2072966_-|tail	tail fiber protein	tail	K7PHC9	Enterobacteria_phage	66.1	8.5e-48
WP_069357284.1|2073065_2073809_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.4	4.9e-151
WP_001152535.1|2073814_2074513_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.3	1.8e-131
WP_000847347.1|2074512_2074842_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	99.1	3.6e-58
WP_044782212.1|2074838_2077400_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	97.3	0.0e+00
WP_024226131.1|2077392_2077827_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	98.3	5.8e-64
WP_000479169.1|2077808_2078231_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	3.1e-70
WP_024229183.1|2078246_2078987_-|tail	phage tail protein	tail	A0A2I6TC77	Escherichia_phage	95.9	1.5e-128
WP_069357285.1|2078994_2079390_-|tail	phage tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	99.2	2.2e-70
WP_069357286.1|2079386_2079965_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	96.9	8.6e-79
WP_000753007.1|2079976_2080330_-|head,tail	head-tail joining protein	head,tail	A0A0K2FJB7	Enterobacteria_phage	99.1	4.4e-62
WP_000158906.1|2080341_2080740_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000198149.1|2081229_2081436_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_069357287.1|2081432_2083358_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
WP_000422741.1|2083766_2084192_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000624722.1|2084188_2084539_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_032285709.1|2084569_2086183_+|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.4	1.5e-181
WP_032154345.1|2086806_2087001_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	95.2	3.7e-26
WP_000548594.1|2087251_2087458_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	80.9	2.6e-22
WP_001019207.1|2087753_2087927_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001443523.1|2088099_2088255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071961531.1|2088402_2088591_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|2088601_2088814_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071778.1|2089177_2089675_-	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
WP_001101173.1|2089671_2090205_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.8	1.4e-96
WP_001557934.1|2090318_2090579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000189900.1|2090526_2091078_-	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	51.1	1.0e-36
WP_000839581.1|2091082_2091298_-|holin	class II holin family protein	holin	A5LH82	Enterobacteria_phage	90.1	7.9e-30
WP_000066482.1|2092050_2092266_-	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	2.6e-25
WP_001557932.1|2092566_2092779_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_122993159.1|2092833_2092923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000203370.1|2093548_2093734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001557930.1|2094894_2095647_-	antitermination protein	NA	K7PGU5	Enterobacteria_phage	97.2	2.4e-134
WP_016235097.1|2095660_2096650_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	98.8	8.1e-194
WP_001061427.1|2096657_2097500_-	KilA-N domain-containing protein	NA	S5MC03	Escherichia_phage	91.5	1.1e-138
WP_000767113.1|2097519_2097909_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_069357288.1|2097905_2098559_-	phage N-6-adenine-methyltransferase	NA	K7PGU4	Enterobacteria_phage	97.2	5.2e-125
WP_072147590.1|2098558_2099053_-	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	98.1	4.3e-87
WP_069357289.1|2099049_2099868_-	helix-turn-helix domain-containing protein	NA	A0A291AWW0	Escherichia_phage	98.5	5.2e-122
WP_000933943.1|2099864_2100101_-	hypothetical protein	NA	A0A291AX25	Escherichia_phage	98.7	2.7e-39
WP_050922078.1|2100093_2100930_-	ash family protein	NA	A0A291AWU3	Escherichia_phage	96.8	4.8e-147
WP_000515860.1|2100926_2101478_-	hypothetical protein	NA	Q8SBF4	Shigella_phage	100.0	7.6e-101
WP_000649477.1|2101521_2101722_-	helix-turn-helix domain-containing protein	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000859462.1|2101812_2102487_+	LexA family transcriptional repressor	NA	Q8SBF6	Shigella_phage	100.0	1.2e-132
WP_000500990.1|2102689_2103202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024226706.1|2103670_2104033_+	hypothetical protein	NA	U5P4J6	Shigella_phage	94.2	1.3e-56
WP_024226707.1|2104098_2104923_+	DUF2303 family protein	NA	U5P439	Shigella_phage	99.6	3.0e-149
WP_000008177.1|2105050_2105587_+	5'-deoxynucleotidase	NA	A5LH62	Enterobacteria_phage	98.3	9.0e-99
WP_024226708.1|2105951_2106836_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024226709.1|2107006_2108143_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_106898618.1|2108422_2109590_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	91.1	4.3e-170
>prophage 9
NZ_CP014583	Escherichia coli strain CFSAN004176 chromosome, complete genome	5193734	2134627	2200625	5193734	transposase,integrase	Shigella_phage(20.0%)	59	2134585:2134644	2199093:2200356
2134585:2134644	attL	TGAGGTGTACTGGCAATAGCGGACACTACCATTTGTTCTTTTTTTAAGCAGCCATCTGAT	NA	NA	NA	NA
WP_085948186.1|2134627_2135784_-|transposase	IS3-like element IS600 family transposase	transposase	NA	NA	NA	NA
WP_120795393.1|2136873_2136957_+	iraD leader peptide IdlP	NA	NA	NA	NA	NA
WP_069357296.1|2136953_2137346_+	anti-adapter protein IraD	NA	NA	NA	NA	NA
WP_000340757.1|2137338_2138250_-	hypochlorite stress DNA-binding transcriptional regulator HypT	NA	NA	NA	NA	NA
WP_000568417.1|2138314_2139487_-	beta-aspartyl-peptidase	NA	NA	NA	NA	NA
WP_000211971.1|2139499_2139961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295597.1|2139957_2140641_-	nucleoside recognition pore and gate family inner membrane transporter	NA	NA	NA	NA	NA
WP_001151854.1|2140891_2141446_+	RNA 2'-phosphotransferase	NA	A0A2R2ZGT8	Clostridioides_phage	45.6	2.7e-37
WP_001141192.1|2141458_2142637_-	MFS transporter	NA	NA	NA	NA	NA
WP_001298932.1|2142704_2143565_-	YjiK family protein	NA	NA	NA	NA	NA
WP_000657676.1|2143629_2143887_-	DUF3343 domain-containing protein	NA	NA	NA	NA	NA
WP_000222495.1|2143883_2144651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024226720.1|2144660_2145812_-	2-hydroxyacyl-CoA dehydratase subunit D	NA	NA	NA	NA	NA
WP_001037377.1|2145927_2147208_-	DUF445 domain-containing protein	NA	NA	NA	NA	NA
WP_001137015.1|2147248_2148481_-	multidrug efflux MFS transporter MdtM	NA	NA	NA	NA	NA
WP_000181139.1|2148958_2149915_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	50.8	1.1e-59
WP_000394276.1|2151746_2151911_+	DUF1127 domain-containing protein	NA	NA	NA	NA	NA
WP_001324160.1|2154881_2155838_-	GTPase	NA	NA	NA	NA	NA
WP_000467859.1|2155848_2156052_-	YbdD/YjiX family protein	NA	NA	NA	NA	NA
WP_001298933.1|2156101_2158252_-	pyruvate/proton symporter BtsT	NA	NA	NA	NA	NA
WP_001175455.1|2158644_2159157_-	4-hydroxyphenylacetate 3-monooxygenase reductase subunit	NA	NA	NA	NA	NA
WP_000801478.1|2159174_2160737_-	4-hydroxyphenylacetate 3-monooxygenase, oxygenase component	NA	NA	NA	NA	NA
WP_000332891.1|2160987_2161878_-	4-hydroxyphenylacetate catabolism regulatory protein HpaA	NA	NA	NA	NA	NA
WP_001285769.1|2161887_2163264_-	4-hydroxyphenylacetate permease	NA	NA	NA	NA	NA
WP_000431706.1|2163438_2164227_-	4-hydroxy-2-oxoheptanedioate aldolase	NA	NA	NA	NA	NA
WP_069357297.1|2164237_2165041_-	2-oxo-hepta-3-ene-1,7-dioic acid hydratase	NA	NA	NA	NA	NA
WP_001119865.1|2165151_2165532_-	5-carboxymethyl-2-hydroxymuconate Delta-isomerase	NA	NA	NA	NA	NA
WP_000516970.1|2165541_2166393_-	3,4-dihydroxyphenylacetate 2,3-dioxygenase	NA	NA	NA	NA	NA
WP_024226716.1|2166394_2167861_-	5-carboxymethyl-2-hydroxymuconate semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000679092.1|2167857_2169147_-	4-hydroxyphenylacetate degradation bifunctional isomerase/decarboxylase	NA	NA	NA	NA	NA
WP_000543915.1|2169418_2169865_+	homoprotocatechuate degradation operon regulator HpaR	NA	NA	NA	NA	NA
WP_000919569.1|2169983_2171648_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.6	6.2e-13
WP_024226714.1|2171696_2173058_-	MFS transporter	NA	NA	NA	NA	NA
WP_000091570.1|2173272_2174187_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000106030.1|2174325_2175348_+	L-galactonate oxidoreductase	NA	A0A2K9L7I1	Tupanvirus	26.3	2.7e-11
WP_001292661.1|2175487_2177779_-	phosphatidylglycerol--membrane-oligosaccharide glycerophosphotransferase	NA	NA	NA	NA	NA
WP_001308243.1|2178032_2178527_-	DUF2501 domain-containing protein	NA	NA	NA	NA	NA
WP_000799911.1|2178575_2179313_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	50.8	7.6e-64
WP_000098818.1|2179315_2179855_-	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	62.8	2.9e-28
WP_000538183.1|2179961_2180435_-	threonine/serine exporter	NA	NA	NA	NA	NA
WP_069357298.1|2180425_2181196_-	threonine/serine exporter ThrE family protein	NA	NA	NA	NA	NA
WP_000936630.1|2181814_2182540_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_069357299.1|2182497_2183175_+	DNA-binding transcriptional activator BglJ	NA	NA	NA	NA	NA
WP_000331559.1|2183212_2184001_-	siderophore-iron reductase FhuF	NA	NA	NA	NA	NA
WP_001403902.1|2184141_2184378_+	DUF1435 domain-containing protein	NA	NA	NA	NA	NA
WP_001272319.1|2184804_2185836_-	16S rRNA (guanine(1207)-N(2))-methyltransferase RsmC	NA	NA	NA	NA	NA
WP_000204019.1|2185938_2186376_+	DNA polymerase III subunit psi	NA	NA	NA	NA	NA
WP_001092458.1|2186320_2186767_+	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_000870697.1|2186781_2187459_+	pyrimidine 5'-nucleotidase	NA	NA	NA	NA	NA
WP_001218281.1|2187843_2189067_+|integrase	site-specific integrase	integrase	A5LH57	Enterobacteria_phage	99.0	9.5e-237
WP_069357300.1|2189149_2190331_-	MFS transporter	NA	NA	NA	NA	NA
WP_106898618.1|2190324_2191493_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	91.1	4.3e-170
WP_069357301.1|2191549_2191885_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.1	5.9e-40
WP_000422741.1|2191881_2192307_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_097310792.1|2192853_2193843_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_069357303.1|2193971_2197487_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_085948186.1|2197952_2199108_+|transposase	IS3-like element IS600 family transposase	transposase	NA	NA	NA	NA
WP_069357304.1|2199133_2199457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085948186.1|2199468_2200625_-|transposase	IS3-like element IS600 family transposase	transposase	NA	NA	NA	NA
2199093:2200356	attR	ATCAGATGGCTGCTTAAAAAAAGAACAAATGGTAGTGTCCGCTATTGCCAGTACACCTCATATTCACACTCTTTCTTTATCAAGATTCCACATAATTCCTTGTGCAAATCAACATTAACTCCCTTTCCTTTCTGCGCTTTCTTCATACCGAGCTCACATGAACTGATTAATTCAACGGTACAGGGTTTCTTCAGATAATTCACACCATCAATTAAGCCCTGGAGAATGCATCTATTTGTGGTCGTATCACTGTAGGAGAAAGTCAGATATTTTATTTTTCCTTCGCATTCCAAAACAACCTCCGCCGAACCTTCACGTGTTGCAGCATCACAGTGAGGTGTACTGGCAATAGCGGACACTACCATTTGTTCTTTTTTTAAGCAGCCATCTGATGATATTTTTCCCTGAAGGCTGCCGGGGAGATATTCCCCAGACGAGAGTGACGACGCTGACGATTGTAGAAAATCTCAATGTATTCCCGTATTACTGAGATGGCTTCATCCCGGTTATTAAAACGATAGTGGCTCAGGCTCTCATTTTTCAGCGTTCCCCAGAAGCTTTCCATCGGAGCGTTGTCGTAACAGTTACCTTTACGCGACATTGATGTTTTCAGACCAAACTGCTCCTGTATGACCCGGTAATCGTATGCGCAGTACTGTGAACCTCGATCAGAGTGGTGGATTAGCCCGGCAGGTGGGCGCTGGCTCCTGAGCGCCATAAACAGGGCTTTACCTGTCAGCTCTTTTGTCATGCGCTCTCCCATGGCGTAGCCGACAATTTCGCACGTATAAACATCTTTGATGCCAGCGAGGTACAACCATCCCTCCTGTGTGGCAACATACGTCAGGTCCGCCACCCAGACCTGATTTGGTGCTGTAGGAGCGAACGTCTGGTTCAGCAGATTTGGCGCAACTGGCAGATTGTGGTTCGAGTTCGTAGTCGCTCTGAACTTGCGTTTCTGCTTACAGCGTAGCCTTAGCTCCTTACGAAGACGTGCCAGTCGGTCACGACCAACGATGATGCCATTCTCTGCCAGCTCCGTCTGGAGCCGCCGGGTTCCATATGTTTCGCGAGTGCGGATATGTGCCACCTTAATCTCCAGTTTTAGCCGCTCATCACTTTGTTTTCTGTCTGAGGGTTCATGCTGTACCCAGTTGTAATAACCGCTCCTGGATACACCAAATACCTGACACATCGCTTCAATGGGAAATTGTTGTCGCCATTGTTCGATTAACGCGTATTTTTCAGCGACTCCTGTGCAAAA	NA	NA	NA	NA
>prophage 10
NZ_CP014583	Escherichia coli strain CFSAN004176 chromosome, complete genome	5193734	2519237	2530878	5193734	transposase,tail	Enterobacteria_phage(33.33%)	16	NA	NA
WP_001217541.1|2519237_2519486_+	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_069357342.1|2519646_2520288_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	99.1	1.4e-106
WP_072140863.1|2520369_2520999_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	93.5	1.4e-79
WP_069357343.1|2521071_2521653_-	T3SS effector NleG family protein	NA	H6WZN1	Escherichia_phage	53.2	1.1e-46
WP_001023420.1|2521765_2522035_-|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	100.0	3.8e-45
WP_000268987.1|2522036_2523350_-|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.6	4.8e-77
WP_001427270.1|2523414_2524014_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	98.5	1.7e-109
WP_085948186.1|2524982_2526139_-|transposase	IS3-like element IS600 family transposase	transposase	NA	NA	NA	NA
WP_106898619.1|2526177_2526942_+	DUF2303 family protein	NA	Q8SBF9	Shigella_phage	98.8	2.8e-133
WP_000008177.1|2527070_2527607_+	5'-deoxynucleotidase	NA	A5LH62	Enterobacteria_phage	98.3	9.0e-99
WP_021567715.1|2527597_2527948_+	hypothetical protein	NA	A0A0P0ZBF8	Stx2-converting_phage	96.6	6.6e-58
WP_021567714.1|2527944_2528430_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	76.5	3.7e-67
WP_071961501.1|2528426_2529536_+	ead/Ea22-like family protein	NA	G9L6G3	Escherichia_phage	92.1	1.8e-77
WP_069357345.1|2529535_2530108_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	97.9	6.7e-108
WP_001093909.1|2530144_2530417_+	pyocin activator PrtN family protein	NA	S5MQM5	Escherichia_phage	86.7	5.9e-38
WP_000549966.1|2530443_2530878_-	type II toxin-antitoxin system YafO family toxin	NA	A0A0S2SYH1	Pseudomonas_phage	51.0	5.2e-36
>prophage 11
NZ_CP014583	Escherichia coli strain CFSAN004176 chromosome, complete genome	5193734	3758536	3818452	5193734	transposase,protease,integrase	Stx2-converting_phage(30.0%)	41	3775171:3775187	3818656:3818672
WP_001034520.1|3758536_3763105_+|protease	lipoprotein metalloprotease SslE	protease	NA	NA	NA	NA
WP_001297673.1|3763252_3764062_+	prepilin peptidase PppA	NA	NA	NA	NA	NA
WP_001324279.1|3764127_3764538_+	type II secretion system pilot lipoprotein GspS-beta	NA	NA	NA	NA	NA
WP_000135068.1|3764555_3765515_+	type II secretion system protein GspC	NA	NA	NA	NA	NA
WP_069357458.1|3765544_3767605_+	type II secretion system secretin GspD	NA	NA	NA	NA	NA
WP_000249348.1|3767604_3769098_+	type II secretion system ATPase GspE	NA	NA	NA	NA	NA
WP_001173448.1|3769097_3770321_+	type II secretion system inner membrane protein GspF	NA	NA	NA	NA	NA
WP_001087296.1|3770337_3770793_+	type II secretion system major pseudopilin GspG	NA	NA	NA	NA	NA
WP_001115140.1|3770796_3771360_+	type II secretion system minor pseudopilin GspH	NA	NA	NA	NA	NA
WP_000820106.1|3771356_3771728_+	type II secretion system minor pseudopilin GspI	NA	NA	NA	NA	NA
WP_001255034.1|3771724_3772324_+	type II secretion system minor pseudopilin GspJ	NA	NA	NA	NA	NA
WP_000633205.1|3772326_3773304_+	type II secretion system minor pseudopilin GspK	NA	NA	NA	NA	NA
WP_024226662.1|3773300_3774479_+	type II secretion system protein GspL	NA	NA	NA	NA	NA
WP_000942793.1|3774480_3775017_+	GspM family type II secretion system protein YghD	NA	NA	NA	NA	NA
3775171:3775187	attL	CCGGACTCGGAATCGAA	NA	NA	NA	NA
WP_069357459.1|3775346_3776189_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_069357460.1|3776273_3776465_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_069357461.1|3776837_3777215_-	toxin	NA	NA	NA	NA	NA
WP_069357462.1|3777304_3777673_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_069357463.1|3777747_3777969_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
WP_069357464.1|3778031_3778508_-	RadC family protein	NA	NA	NA	NA	NA
WP_069357465.1|3778523_3779009_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.0	2.0e-12
WP_085947772.1|3779167_3780381_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
WP_001121622.1|3782064_3783714_+	type III secretion system effector EspL2	NA	NA	NA	NA	NA
WP_069357327.1|3784322_3785312_+	type III secretion system effector arginine glycosyltransferase NleB	NA	Q8HAB2	Salmonella_phage	58.5	3.7e-98
WP_000609742.1|3785360_3786035_+	type III secretion system effector cysteine methyltransferase NleE	NA	NA	NA	NA	NA
WP_000422686.1|3798236_3798662_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	2.0e-48
WP_069356963.1|3798658_3799009_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	65.5	4.0e-39
WP_085948186.1|3800584_3801741_-|transposase	IS3-like element IS600 family transposase	transposase	NA	NA	NA	NA
WP_001369053.1|3802341_3802539_-	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_001013320.1|3802783_3803209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000270999.1|3803205_3803589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000221524.1|3803756_3804326_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_000236756.1|3804525_3804720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001342960.1|3805868_3806075_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000782722.1|3806163_3806772_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069357468.1|3809230_3810103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085947772.1|3810661_3811874_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
WP_085948186.1|3811986_3813143_-|transposase	IS3-like element IS600 family transposase	transposase	NA	NA	NA	NA
WP_000631719.1|3815177_3815525_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.0	1.0e-42
WP_001341423.1|3815521_3816196_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_001218841.1|3817186_3818452_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.3	2.7e-77
3818656:3818672	attR	CCGGACTCGGAATCGAA	NA	NA	NA	NA
>prophage 12
NZ_CP014583	Escherichia coli strain CFSAN004176 chromosome, complete genome	5193734	4081494	4088604	5193734		Escherichia_phage(66.67%)	6	NA	NA
WP_001279007.1|4081494_4082133_-	aldolase	NA	A0A077SK32	Escherichia_phage	74.5	4.1e-82
WP_000590409.1|4082129_4083392_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.7	4.4e-136
WP_069357503.1|4083388_4084267_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	73.8	5.2e-112
WP_024226287.1|4084462_4085230_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	2.5e-70
WP_001141339.1|4085280_4085937_-	protein-serine/threonine phosphatase	NA	K7P7V3	Enterobacteria_phage	45.3	5.6e-50
WP_001272924.1|4086042_4088604_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
>prophage 13
NZ_CP014583	Escherichia coli strain CFSAN004176 chromosome, complete genome	5193734	4456933	4561231	5193734	tail,portal,tRNA,plate,head,capsid,transposase,integrase,terminase,holin	Enterobacteria_phage(62.16%)	115	4538950:4539009	4561236:4562501
WP_097310774.1|4456933_4457629_-	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	96.1	8.3e-129
WP_069357539.1|4457704_4457911_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	94.3	2.6e-22
WP_000229809.1|4458138_4458345_+	hypothetical protein	NA	G9L683	Escherichia_phage	94.1	1.1e-25
WP_000810176.1|4458352_4458799_+	recombination protein NinB	NA	A0A0N7C2V1	Escherichia_phage	92.6	3.4e-75
WP_000153270.1|4458795_4459323_+	phage N-6-adenine-methyltransferase	NA	K7PJZ4	Enterobacterial_phage	100.0	9.5e-101
WP_001254221.1|4459319_4459502_+	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	98.3	1.3e-28
WP_000612803.1|4460005_4461778_-	hypothetical protein	NA	A0A1U9AJG3	Stx1_converting_phage	99.7	0.0e+00
WP_001108084.1|4462323_4462890_+	HNH endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	99.5	6.6e-108
WP_069357540.1|4462864_4463467_+	recombination protein NinG	NA	A0A1U9AJF8	Stx1_converting_phage	94.6	3.5e-91
WP_001028854.1|4463463_4464129_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001235461.1|4464125_4464749_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	100.0	3.0e-114
WP_000783734.1|4465289_4465613_+|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
WP_085948186.1|4465963_4467119_+|transposase	IS3-like element IS600 family transposase	transposase	NA	NA	NA	NA
WP_069357542.1|4467684_4468578_+	scaffolding protein	NA	A0A088CPT0	Enterobacteria_phage	97.6	2.6e-127
WP_085948123.1|4469040_4470209_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	91.5	8.7e-171
WP_069357543.1|4471312_4471774_+|head	head DNA stabilization protein	head	A5VW70	Enterobacteria_phage	99.3	3.5e-83
WP_069357544.1|4471783_4473202_+	packaged DNA stabilization protein gp10	NA	A0A088CQ70	Enterobacteria_phage	99.2	8.7e-274
WP_069357545.1|4473201_4474050_+	hypothetical protein	NA	Q716G6	Shigella_phage	96.8	3.8e-99
WP_069357546.1|4474049_4474505_+	DUF2824 family protein	NA	Q716G5	Shigella_phage	98.0	3.3e-86
WP_069357547.1|4474507_4475197_+	DNA transfer protein	NA	A0A2H4FUQ9	Salmonella_phage	98.7	2.3e-115
WP_069357548.1|4475206_4476622_+	DNA transfer protein	NA	I6RSG0	Salmonella_phage	80.5	2.4e-199
WP_069357549.1|4476621_4478460_+	DNA transfer protein	NA	A0A192Y934	Salmonella_phage	75.7	3.5e-251
WP_000890120.1|4478479_4478809_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000821222.1|4478927_4479347_+	hypothetical protein	NA	B9UDL3	Salmonella_phage	97.8	1.5e-72
WP_000090241.1|4479363_4479615_-	Arc family DNA-binding protein	NA	B9UDL4	Salmonella_phage	98.8	1.3e-39
WP_000677939.1|4479705_4479867_+	Arc family DNA-binding protein	NA	A8CG91	Salmonella_phage	98.1	2.7e-22
WP_033546471.1|4479935_4480814_+	antirepressor	NA	I6R977	Salmonella_phage	78.1	1.5e-95
WP_094188220.1|4480915_4482943_+	hypothetical protein	NA	Q716G1	Shigella_phage	58.4	3.0e-78
WP_069357550.1|4483035_4484193_-|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	99.2	6.9e-221
WP_000368131.1|4484504_4485437_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
WP_000776768.1|4485730_4486486_+	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_024226479.1|4486667_4487726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001296861.1|4488091_4489432_-	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_001296869.1|4489803_4490088_+	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_000531955.1|4490268_4491579_+	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_000426156.1|4491578_4493723_+	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_001195819.1|4493925_4494411_+	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_024226478.1|4495085_4495649_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_024231067.1|4495730_4498373_+	fimbrial usher protein YfcU	NA	NA	NA	NA	NA
WP_001281615.1|4498392_4499145_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000842082.1|4499119_4499668_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000730291.1|4500120_4500645_+	fimbrial protein	NA	NA	NA	NA	NA
WP_001356216.1|4500631_4501504_+	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
WP_000730806.1|4501625_4502177_-	endonuclease SmrB	NA	NA	NA	NA	NA
WP_069357551.1|4502342_4503275_+	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000918470.1|4503309_4504395_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	48.4	9.1e-90
WP_069357552.1|4504398_4505223_+	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_069357553.1|4505222_4506032_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_069357554.1|4506031_4506580_+	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_000559764.1|4506613_4506892_+	YfcL family protein	NA	NA	NA	NA	NA
WP_000683799.1|4507012_4509019_-|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000817183.1|4509177_4510398_+	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_069357555.1|4510681_4511503_+	arabinose transporter	NA	NA	NA	NA	NA
WP_000615813.1|4511499_4512495_-	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_000215750.1|4512724_4513516_-	site-specific DNA-methyltransferase	NA	Q775B4	Bordetella_phage	52.6	8.7e-66
WP_032144146.1|4513460_4513658_-	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_032140709.1|4513907_4514048_-	Hok/Gef family protein	NA	S5M7Q0	Escherichia_phage	65.2	3.8e-09
WP_085948186.1|4514210_4515367_-|transposase	IS3-like element IS600 family transposase	transposase	NA	NA	NA	NA
WP_000290462.1|4515892_4516405_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	97.1	1.5e-90
WP_069357556.1|4516460_4516835_+|tail	phage tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	72.4	2.6e-36
WP_000333503.1|4516843_4516999_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	96.1	9.7e-22
WP_069357557.1|4516985_4519793_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	98.2	0.0e+00
WP_000979957.1|4519805_4520294_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	3.0e-85
WP_000954205.1|4520450_4521023_+	serine acetyltransferase	NA	NA	NA	NA	NA
WP_069357558.1|4521066_4521645_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	89.0	3.5e-96
WP_077775673.1|4521644_4522499_-|tail	tail fiber protein	tail	K7PHC9	Enterobacteria_phage	89.8	9.8e-39
WP_000071720.1|4523784_4524315_-|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	99.4	1.1e-93
WP_001111960.1|4524307_4525204_-|plate	baseplate J/gp47 family protein	plate	A0A0A7NPY5	Enterobacteria_phage	98.3	6.0e-156
WP_001067552.1|4525207_4525537_-	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	99.1	1.1e-54
WP_077886894.1|4525554_4526121_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	97.9	8.6e-100
WP_000356339.1|4526132_4526768_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	100.0	1.1e-114
WP_000920594.1|4526760_4527228_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	100.0	2.6e-86
WP_077886868.1|4527214_4527772_-	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	94.1	2.2e-63
WP_000072327.1|4527768_4528161_-	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	100.0	5.8e-71
WP_000104350.1|4528157_4528481_-|holin	phage holin family protein	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_032197599.1|4528483_4528684_-|tail	tail protein X	tail	A0A0A7NV57	Enterobacteria_phage	97.0	5.1e-31
WP_069357560.1|4528683_4529178_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	98.2	3.5e-89
WP_069357561.1|4529279_4530080_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	91.4	5.1e-130
WP_069357562.1|4530125_4531178_-|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	95.7	4.0e-191
WP_001262673.1|4531200_4532037_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	100.0	2.7e-150
WP_000613781.1|4532191_4533943_+	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	97.9	0.0e+00
WP_000087814.1|4533942_4534989_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.7	2.2e-202
WP_069357563.1|4535003_4535528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001519213.1|4536087_4536495_-	hypothetical protein	NA	A0A0A7NRY2	Enterobacteria_phage	90.0	3.4e-21
WP_001163782.1|4536491_4536824_-	carboxylate--amine ligase	NA	A0A0A7NV51	Enterobacteria_phage	96.4	5.5e-54
WP_069357564.1|4536887_4537199_-	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	95.1	9.4e-48
WP_069357565.1|4537203_4538163_-	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	3.8e-180
4538950:4539009	attL	TGAGGTAGCCTGAGTTTAACGGACACTCCTTCCTGAAATAGAATGGCATCAGAAGGAGCT	NA	NA	NA	NA
WP_085948186.1|4539013_4540169_+|transposase	IS3-like element IS600 family transposase	transposase	NA	NA	NA	NA
WP_001471916.1|4542335_4542701_-	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	1.9e-60
WP_077886869.1|4542697_4543294_-	ash family protein	NA	S5MQL6	Escherichia_phage	44.6	1.3e-08
WP_069357567.1|4543325_4543625_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	88.9	1.1e-40
WP_000153707.1|4543621_4543888_-	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	77.3	3.1e-31
WP_000985163.1|4543884_4544088_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	1.9e-25
WP_029392824.1|4544111_4544528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000021655.1|4544620_4544734_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	6.2e-10
WP_069357568.1|4544730_4544973_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	5.2e-38
WP_000159462.1|4544984_4545263_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	81.5	3.6e-35
WP_054192163.1|4545273_4545624_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	92.2	5.2e-55
WP_000203260.1|4545743_4545950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000004248.1|4545956_4546244_-	hypothetical protein	NA	A0A0M4RCW1	Salmonella_phage	53.7	6.7e-24
WP_000581441.1|4546359_4546680_+	helix-turn-helix transcriptional regulator	NA	Q1JS29	Enterobacteria_phage	45.0	1.3e-12
WP_069357569.1|4546776_4547781_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	55.7	2.2e-98
WP_024231164.1|4547939_4549097_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	7.9e-23
WP_069357570.1|4549162_4550176_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_024226472.1|4550175_4550988_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_000364335.1|4551070_4551730_+	DedA family protein	NA	NA	NA	NA	NA
WP_000118404.1|4551885_4552800_+	acetyl-CoA carboxylase, carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_024226471.1|4552869_4554138_+	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_000146992.1|4554127_4554790_+	cell division protein DedD	NA	NA	NA	NA	NA
WP_000262113.1|4555048_4555537_+	colicin V production protein	NA	NA	NA	NA	NA
WP_000334220.1|4555573_4557091_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	5.9e-87
WP_000825704.1|4557185_4557755_+	flavin prenyltransferase UbiX	NA	NA	NA	NA	NA
WP_000422741.1|4557971_4558397_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000624722.1|4558393_4558744_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_085948186.1|4560074_4561231_-|transposase	IS3-like element IS600 family transposase	transposase	NA	NA	NA	NA
4561236:4562501	attR	AGCTCCTTCTGATGCCATTCTATTTCAGGAAGGAGTGTCCGTTAAACTCAGGCTACCTCAGACAGGTAAAGCCCTGTTTATGGCGCTCAGGAGCCAGCGCCCACCTGCCGGGCTAATCCACCACTCTGATCGAGGTTCACAGTACTGCGCATACGATTACCGGGTCATACAGGAGCAGTTTGGTCTGAAAACATCAATGTCGCGTAAAGGTAACTGTTACGACAACGCTCCGATGGAAAGCTTCTGGGGAACGCTGAAAAATGAGAGCCTGAGCCACTATCGTTTTAATAACCGGGATGAAGCCATCTCAGTAATACGGGAATACATTGAGATTTTCTACAATCGTCAGCGTCGTCACTCTCGTCTGGGGAATATCTCCCCGGCAGCCTTCAGGGAAAAATATCATCAGATGGCTGCTTAAAAAAAGAACAAATGGTAGTGTCCGCTATTGCCAGTACACCTCATACACCGCCTGGAGCCAGAAGAAAGCTGTTGCCCGGAGTGTGGCGGTGAGCTGGATTATCTGGGGGAAGTCAGCGCTGAACAGCTGGAACTGGTGAGCAGTGCCCTGAAAGTGATCCGCACAGAACGGGTAAAAAAAGCCTGTACAAAATGTGACTGTATTGTTGAAGCACCGGCGCCGTCCCGCCCGATAGAGCGTGGTATCGCGGGCCCCGGATTACTTGCCCGCGTGTTAACGGGAAAATACTGCGAACATCTGCCACTGTATCGTCAGAGTGAAATCTTTGCCCGCCAGGGTGTCGAACTGAGCCGGGCCTTACTCTCCAACTGGGTTGACGCGTGCTGCCAGTTAATGACACCGGTGAATGATGCCCTGTACCGTTATGTAATGAACACCCGCAAGGTTCACACTGATGACACACCGGTAAAGGTACTGGCACCGGGTCAGAAAAAGGCGAAAACAGGGCGTATCTGGACGTATGTCCGGGATGATCGCAATGTGGGTTCGTCATCTCCTCCAGCGGTCTGGTTCGCGTACTCGCCGAACCGGCAGGGGAAACACCCGGAGCAACACCTCCGTCCCTTCCGGGGTATCCTGCAGGCGGATGCGTTCACAGGTTACGACAGGTTGTTCAGTGCAGAACGTGAAGGTGGTGCACTGACAGAAGTTGCGTGCTGGGCCCATGCCCGGCGAAAAATCCACGATGTATACATCAGCAGCAAAAGTGCGACGGCAGAAGAAGCCCTGAAGCGAATCAGTGAACTGTACGCCATCGAGGATGAAATACGGGGATTACCGGAGTC	NA	NA	NA	NA
>prophage 14
NZ_CP014583	Escherichia coli strain CFSAN004176 chromosome, complete genome	5193734	4828492	4837299	5193734	terminase,tail	Enterobacteria_phage(44.44%)	14	NA	NA
WP_069357603.1|4828492_4829182_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	47.6	5.8e-58
WP_001302581.1|4829366_4830110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499454.1|4830195_4830354_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_100224537.1|4831346_4831577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000992175.1|4831735_4832269_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	96.0	6.2e-100
WP_001303555.1|4832424_4832607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001280929.1|4832619_4832751_+	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	88.4	9.4e-10
WP_001208680.1|4832978_4833164_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001303878.1|4833690_4834005_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001299328.1|4834086_4834311_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.7	4.1e-21
WP_000235436.1|4834705_4835215_+|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_106898625.1|4835471_4836041_+|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB7	Enterobacteria_phage	100.0	1.7e-39
WP_001023460.1|4836042_4836312_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	97.8	7.1e-44
WP_000950982.1|4836417_4837299_+	hypothetical protein	NA	A5LH48	Enterobacteria_phage	90.4	3.9e-147
>prophage 15
NZ_CP014583	Escherichia coli strain CFSAN004176 chromosome, complete genome	5193734	4927091	5029337	5193734	tail,tRNA,head,capsid,transposase,protease,integrase,terminase,lysis,holin	Enterobacteria_phage(33.96%)	91	4940617:4940676	5008461:5009726
WP_087891248.1|4927091_4928298_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	62.2	3.9e-97
WP_001128468.1|4930714_4930879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000973176.1|4931343_4931889_+	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_024226617.1|4931885_4932629_+	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_024226619.1|4932640_4933720_+	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000986346.1|4933781_4934717_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001011483.1|4935173_4936091_+	nitrogen assimilation transcriptional regulator NAC	NA	NA	NA	NA	NA
WP_069357618.1|4936192_4937143_+	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_122985555.1|4937260_4938904_+	toxic metabolite efflux MATE transporter YeeO	NA	NA	NA	NA	NA
WP_000532912.1|4939532_4940249_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
4940617:4940676	attL	GTGAGGTAGCCTGAGTTTAACGGACACTCCTTCCTGAAATAGAATGGCATCAGAAGGAGC	NA	NA	NA	NA
WP_085948186.1|4940681_4941837_+|transposase	IS3-like element IS600 family transposase	transposase	NA	NA	NA	NA
WP_069357619.1|4941834_4943313_-	AMP nucleosidase	NA	NA	NA	NA	NA
WP_000477884.1|4945044_4946097_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_122367527.1|4946358_4953435_-	inverse autotransporter adhesin YeeJ	NA	NA	NA	NA	NA
WP_001515476.1|4953924_4954722_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_024226620.1|4954957_4955983_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	58.2	1.2e-102
WP_000096344.1|4955982_4956186_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_069357621.1|4957198_4957351_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	1.1e-06
WP_001003379.1|4957542_4957950_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	45.4	7.2e-24
WP_000476986.1|4958027_4958255_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_069357622.1|4958238_4958790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000020543.1|4958761_4959802_+	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	86.7	1.9e-89
WP_157909734.1|4959713_4960256_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	4.4e-85
WP_001340033.1|4960362_4960563_+	hypothetical protein	NA	A0A0U2SAW4	Escherichia_phage	93.9	5.9e-11
WP_001227887.1|4961006_4961849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000827089.1|4962887_4964261_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_001124204.1|4964247_4964883_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_000887487.1|4965139_4965352_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	81.4	1.1e-23
WP_032285709.1|4965709_4967323_-|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.4	1.5e-181
WP_000624722.1|4967353_4967704_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000422741.1|4967700_4968126_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_069357623.1|4968179_4970105_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	97.1	0.0e+00
WP_001063106.1|4970149_4970371_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	98.6	2.2e-35
WP_000125988.1|4972897_4973224_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_069357624.1|4973233_4973584_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	99.1	1.0e-58
WP_000573391.1|4973580_4974027_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001275476.1|4974435_4975152_+	immunoglobulin domain-containing protein	NA	A0A0P0ZD29	Stx2-converting_phage	98.7	5.6e-128
WP_001030043.1|4975157_4975532_+|tail	phage tail assembly chaperone	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	1.7e-64
WP_122993730.1|4975627_4975837_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	92.8	2.6e-30
WP_069357625.1|4975887_4979130_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	95.4	0.0e+00
WP_000807944.1|4979122_4979464_+|tail	phage tail protein	tail	H6WZM2	Escherichia_phage	98.2	1.2e-61
WP_069357626.1|4979463_4980162_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	96.1	3.2e-128
WP_069357142.1|4980172_4980916_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.6	3.3e-147
WP_158707115.1|4980861_4981494_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	98.1	1.2e-102
WP_000649829.1|4981762_4982290_-	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_069357629.1|4982423_4985900_+	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	96.8	0.0e+00
WP_053888632.1|4985966_4986566_+	Ail/Lom family outer membrane beta-barrel protein	NA	B6ETG5	Enterobacteria_phage	98.5	1.7e-109
WP_069357630.1|4986630_4987944_+|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.9	2.8e-77
WP_001023386.1|4987945_4988215_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJT0	Stx_converting_phage	95.5	6.0e-43
WP_069357631.1|4988327_4988903_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	60.0	4.1e-57
WP_001118087.1|4989193_4989775_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	54.3	7.9e-48
WP_075209616.1|4989842_4990478_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	90.7	1.6e-73
WP_001144080.1|4991737_4992388_-	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001132165.1|4992570_4993161_+	bfpT-regulated chaperone	NA	NA	NA	NA	NA
WP_000799399.1|4993439_4994303_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531601.1|4994286_4995423_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	9.4e-29
WP_069357632.1|4995672_4996899_+	peptidase T	NA	NA	NA	NA	NA
WP_064226077.1|4996947_4998069_-	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000735412.1|4998144_4999605_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265481.1|4999604_5000276_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423729.1|5000444_5001815_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001297479.1|5001818_5002460_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001297484.1|5002495_5003602_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476089.1|5003655_5004117_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248692.1|5004126_5004780_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444487.1|5004951_5006202_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_077886876.1|5006315_5007230_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z02	Phage_21	99.0	3.3e-173
WP_085948186.1|5007298_5008455_-|transposase	IS3-like element IS600 family transposase	transposase	NA	NA	NA	NA
WP_000088653.1|5008714_5008951_-	excisionase	NA	NA	NA	NA	NA
WP_000488406.1|5009090_5009330_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	94.9	3.9e-38
WP_000763364.1|5009377_5009596_-	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	95.8	1.8e-34
WP_000188880.1|5009694_5009910_-	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	98.6	2.9e-32
5008461:5009726	attR	GCTCCTTCTGATGCCATTCTATTTCAGGAAGGAGTGTCCGTTAAACTCAGGCTACCTCACTTAATATTTGTCGGGTACGTTGTTCAGCAATAATGGTATTTGCTTCAGTAGCAACCTGTTTTGCTTCATTCTCATCAGTTCCTAAACTATGAAAACGACCGGATAGTGGATGTTTGTATTGCCAATATACCTTTCCGGTTCGCTTATCTAATTTGCAATATAAATTGGGTATAGAGATTTTGTGAGATCGGGGTCTAGCAGCCATCAGCGATTATCCGTTGGAGTTTTGGGTTTGCGTTGATTGGGAGTTGCGGTTCTGCAAGCGTTCCTACAAAACGGGAATTTCGGTCAATCATCCAGTAGCGACCAACTTTTATAGCGGGTGGGGCCATCATTTTCCCTTGCGCGTATTTTTTCAGAACTCGCTCACTTGGTGCTAAGTCCCCAAATTCTTCTTTAGCCCAGTCCTGTAAAGTGATTAGTCGAGACATTTGTCCTCCTCTTAGCTGCTGAGGGAGTTTGTGACCGATATATCTGACATGATATTAAGCTTATGGCAGGTACATCTCTTGACTGGTCATAGAGATAAATTTAATGCTGAGAAATGCAGTATTGAATTTATCAATTTTTCTATTTCCTGCGTATGGCACGTAACTTCTTAATGTGTTCTGCCGTTTCGATCTCTTCTGCTATCCGATCTGCATCAGCTTTATTCACAGGTTCAAAGTCATGATTAAAGCGGAACATGCTGGCGATACATGTTCTGCCTTTTCGGATGTAGTGAACTTTGTTGTGGGTAGAACGCAGGATTTTGCAGGGAGTGCCGTGGTGATCGACGTACCAGGTGTTAGGAAAAATGATTCTGAACATTTTTACACCTCAATTGGACGATGTTGAAATTTGCTGCTTTGAGGCCATCACAGTCCCCATTGTTTGTTCTTAAGTTCGATCTCCTCCTGGCAACTTGCACAAGTCCGACAACCCTGAACGGCCAGGCGTCTTCGTTCATCTATCGGATCGCCACACTCACAACAATGAGTGGCAGATATAGCCTGGTGGTTCAGGCGGCGCATTTTTATTGCTGTGTTGCGCTGTAATTCTTCAATTTCTGATGCTGAATCAATGATGTCTGCCATCTTTCATTAATCCCTGAATTGTTGGTTAATACGCTTGAGGGTGAATGCGAATAATAAAAAAGGAGCCTGTAGCTCCATGATGATTTTGTTTTTCATGTTCACCGTTCCTTAAAGACGCCGTTTAACATGC	NA	NA	NA	NA
WP_000544528.1|5010827_5011133_+|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001180491.1|5011119_5011596_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	96.8	1.0e-85
WP_012738274.1|5011812_5011995_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	100.0	1.7e-17
WP_000738495.1|5012085_5012379_-	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	99.0	1.5e-47
WP_000079504.1|5012681_5013092_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	2.7e-71
WP_069357633.1|5013377_5013584_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	98.5	2.2e-29
WP_001300120.1|5013748_5013943_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	1.5e-27
WP_000453622.1|5014331_5014877_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	3.1e-94
WP_047651814.1|5014851_5016777_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.8	0.0e+00
WP_000198149.1|5016773_5016980_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_069357634.1|5019015_5022087_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	U5N099	Enterobacteria_phage	82.1	1.9e-68
WP_000885594.1|5022086_5022668_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	2.3e-103
WP_069357635.1|5022787_5023678_-	manganese catalase family protein	NA	NA	NA	NA	NA
WP_001079482.1|5023696_5024203_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001166090.1|5024239_5024740_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000134810.1|5024818_5025001_-	general stress protein	NA	NA	NA	NA	NA
WP_000239870.1|5025498_5026167_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_024226582.1|5026712_5028197_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_032205137.1|5028383_5029337_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
>prophage 16
NZ_CP014583	Escherichia coli strain CFSAN004176 chromosome, complete genome	5193734	5131191	5166687	5193734	portal,tail,transposase,holin,terminase,integrase	Escherichia_phage(46.43%)	33	5126223:5126237	5173110:5173124
5126223:5126237	attL	GCGGTCATCAAACTT	NA	NA	NA	NA
WP_077886897.1|5131191_5131674_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	52.3	7.0e-42
WP_085948186.1|5131654_5132811_-|transposase	IS3-like element IS600 family transposase	transposase	NA	NA	NA	NA
WP_069357646.1|5133097_5134138_+	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_157832601.1|5134049_5134592_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.5e-85
WP_001449026.1|5135254_5136013_+	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_000961821.1|5136291_5136504_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	72.9	1.3e-16
WP_069357647.1|5136777_5137038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071961523.1|5137104_5137383_+	hypothetical protein	NA	A0A077KB22	Edwardsiella_phage	37.1	1.4e-05
WP_069357649.1|5137384_5138440_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.4	1.2e-89
WP_000140002.1|5138440_5138806_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	1.6e-38
WP_069357650.1|5138802_5139492_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.5	2.8e-60
WP_069357651.1|5141011_5142862_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.1	0.0e+00
WP_024164617.1|5143300_5143516_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	7.7e-33
WP_001135302.1|5143515_5144013_+	lysozyme RrrD	NA	A0A1B5FP97	Escherichia_phage	97.6	1.4e-90
WP_001208681.1|5144229_5144415_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	78.7	2.9e-20
WP_001303878.1|5144941_5145256_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000074669.1|5145337_5145562_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.5	2.7e-20
WP_001377217.1|5145603_5146134_+	HNH endonuclease	NA	H6WZK7	Escherichia_phage	93.2	1.2e-90
WP_069357653.1|5146249_5146813_+|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	93.0	4.7e-82
WP_085948186.1|5147434_5148590_+|transposase	IS3-like element IS600 family transposase	transposase	NA	NA	NA	NA
WP_185768400.1|5148673_5149729_+|terminase	terminase large subunit	terminase	H6WZK9	Escherichia_phage	97.2	1.0e-199
WP_054192414.1|5151773_5151995_+	hypothetical protein	NA	H6WZL1	Escherichia_phage	90.4	1.1e-31
WP_054446607.1|5151940_5153305_+|portal	phage portal protein	portal	B6DZX6	Stx2-converting_phage	96.5	8.1e-253
WP_158707113.1|5153301_5156538_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	78.9	0.0e+00
WP_069357654.1|5156530_5156872_+|tail	phage tail protein	tail	H6WZM2	Escherichia_phage	98.2	9.6e-62
WP_069357655.1|5156871_5157570_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	96.1	6.4e-129
WP_071961524.1|5157580_5158381_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.2	5.1e-146
WP_069357656.1|5161118_5161388_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q6H9S8	Enterobacteria_phage	95.5	3.5e-43
WP_069357657.1|5161607_5162150_+	hypothetical protein	NA	Q9LA55	Enterobacteria_phage	68.6	1.4e-51
WP_106409363.1|5162094_5162289_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A2R2Z347	Escherichia_phage	87.2	1.1e-09
WP_001025663.1|5162631_5163954_-	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	83.9	2.1e-221
WP_106409364.1|5165546_5165669_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	91.3	3.8e-05
WP_069357658.1|5165775_5166687_+	type III secretion system effector kinase NleH1-2	NA	A5LH48	Enterobacteria_phage	81.5	1.6e-132
5173110:5173124	attR	GCGGTCATCAAACTT	NA	NA	NA	NA
>prophage 17
NZ_CP014583	Escherichia coli strain CFSAN004176 chromosome, complete genome	5193734	5172406	5190303	5193734		Enterobacteria_phage(54.55%)	23	NA	NA
WP_169301324.1|5172406_5173057_+	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	32.4	8.6e-27
WP_000063650.1|5173936_5175223_-	DUF3596 domain-containing protein	NA	Q20GI2	Phage_258-320	99.8	6.9e-254
WP_001193437.1|5175256_5175511_-	excisionase family protein	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_001484100.1|5175702_5176074_-	DUF5406 family protein	NA	Q8W655	Enterobacteria_phage	95.1	2.3e-61
WP_000720006.1|5176114_5176942_-	hypothetical protein	NA	Q8W654	Enterobacteria_phage	97.5	1.2e-129
WP_001365075.1|5177311_5177884_-	hypothetical protein	NA	Q8W653	Enterobacteria_phage	71.3	5.5e-78
WP_000553977.1|5177889_5178072_-	hypothetical protein	NA	Q8W652	Enterobacteria_phage	52.7	2.9e-09
WP_000147364.1|5178270_5178471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000387836.1|5178467_5179169_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPB8	Escherichia_phage	59.7	1.5e-37
WP_000789654.1|5179317_5180007_-	LexA family transcriptional regulator	NA	A0A1B5FPF4	Escherichia_phage	88.2	3.0e-115
WP_000944728.1|5180163_5180397_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPK9	Escherichia_phage	77.0	1.2e-28
WP_001090254.1|5180478_5181186_+	Rha family transcriptional regulator	NA	Q8W645	Enterobacteria_phage	90.2	1.6e-114
WP_000587259.1|5181294_5181957_+	ash family protein	NA	Q8W643	Enterobacteria_phage	92.5	3.7e-110
WP_000621233.1|5181953_5182187_+	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	47.2	1.6e-12
WP_001247844.1|5182173_5183082_+	hypothetical protein	NA	Q8W642	Enterobacteria_phage	94.0	2.4e-59
WP_069357085.1|5183092_5183971_+	ATP-binding protein	NA	Q8W641	Enterobacteria_phage	95.6	6.0e-140
WP_000203852.1|5183967_5185368_+	replicative DNA helicase	NA	Q8W640	Enterobacteria_phage	92.4	1.7e-245
WP_001065352.1|5185364_5185622_+	hypothetical protein	NA	Q8W639	Enterobacteria_phage	71.1	1.2e-21
WP_001202271.1|5185673_5186663_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	98.2	8.9e-193
WP_001204809.1|5186681_5187062_+	antitermination protein Q	NA	S5M7R9	Escherichia_phage	99.2	1.4e-66
WP_000917741.1|5187277_5187475_+	hypothetical protein	NA	A0A0P0ZDH6	Stx2-converting_phage	100.0	8.0e-29
WP_000483505.1|5187626_5188685_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	98.0	2.9e-205
WP_000738072.1|5190033_5190303_+	Shiga toxin Stx2a subunit B	NA	Q6DWN4	Enterobacteria_phage	100.0	1.2e-43
>prophage 1
NZ_CP012493	Escherichia coli strain CFSAN004176 plasmid pCFSAN004176G_02, complete sequence	52297	30126	37603	52297	integrase	Escherichia_phage(33.33%)	10	22399:22412	36149:36162
22399:22412	attL	CCGTTAAAGCCATT	NA	NA	NA	NA
WP_074384196.1|30126_30621_+|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	95.5	5.3e-53
WP_021499534.1|30758_31034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069356972.1|31027_31672_-	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	43.5	8.8e-40
WP_001103690.1|31900_32872_+	hypothetical protein	NA	A0A222YXF2	Escherichia_phage	42.9	7.4e-67
WP_000340832.1|32876_33269_+	plasmid partitioning/stability family protein	NA	NA	NA	NA	NA
WP_069356973.1|33273_34533_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	59.0	4.7e-138
WP_000618110.1|34965_35214_-	DinI-like family protein	NA	Q2A098	Sodalis_phage	48.0	1.9e-14
WP_021499538.1|35632_36535_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
36149:36162	attR	AATGGCTTTAACGG	NA	NA	NA	NA
WP_001732000.1|36531_36843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069356974.1|36919_37603_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.4	3.9e-30
>prophage 1
NZ_CP012492	Escherichia coli strain CFSAN004176 plasmid pCFSAN004176P_01, complete sequence	34714	25053	34554	34714	transposase	Enterobacteria_phage(37.5%)	8	NA	NA
WP_024257415.1|25053_26259_+	AAA family ATPase	NA	Q1MVJ3	Enterobacteria_phage	89.0	4.3e-205
WP_001233382.1|26255_27227_+	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	67.9	3.4e-112
WP_000080195.1|28502_30116_-|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
WP_069356963.1|30146_30497_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	65.5	4.0e-39
WP_000422686.1|30493_30919_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	2.0e-48
WP_001297096.1|31477_32257_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_069356965.1|32256_33237_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	94.7	2.1e-186
WP_085948186.1|33398_34554_+|transposase	IS3-like element IS600 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
>prophage 1
NZ_CP012491	Escherichia coli strain CFSAN004176 plasmid pCFSAN004176P_03, complete sequence	95721	0	95101	95721	portal,tail,head,holin,integrase	Escherichia_phage(61.11%)	112	31865:31881	82927:82943
WP_024183070.1|459_936_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	58.2	1.2e-46
WP_001408994.1|946_1408_+|tail	tail fiber protein	tail	Q9MCR6	Enterobacteria_phage	69.6	2.0e-54
WP_023154361.1|1418_1886_+|tail	tail fiber protein	tail	Q9MCR6	Enterobacteria_phage	65.8	1.4e-50
WP_023156927.1|1896_2325_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	54.9	1.3e-39
WP_064754908.1|2353_2839_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	53.6	2.0e-41
WP_042004948.1|2867_3278_+|tail	tail fiber protein	tail	K7PH60	Enterobacterial_phage	70.4	1.9e-48
WP_071852594.1|3306_3786_+|tail	tail fiber protein	tail	K7P7Q7	Enterobacteria_phage	54.4	3.2e-39
WP_000367945.1|3791_4403_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	78.6	3.6e-83
WP_077886821.1|4402_6982_-|tail	tail fiber protein	tail	A0A1B0V7G4	Salmonella_phage	45.5	8.7e-14
WP_001286325.1|6993_7428_-	hypothetical protein	NA	A0A077SLL3	Escherichia_phage	99.3	7.4e-75
WP_001189832.1|7506_8343_-	hypothetical protein	NA	A0A1B0V7F2	Salmonella_phage	100.0	1.4e-154
WP_000047923.1|8342_9776_-	bleomycin hydrolase	NA	A0A1B0VAD6	Salmonella_phage	100.0	3.7e-272
WP_000002800.1|9772_10129_-	hypothetical protein	NA	Q71TP1	Escherichia_phage	100.0	1.0e-61
WP_023351689.1|10128_13503_-	transglycosylase SLT domain-containing protein	NA	Q1MVL3	Enterobacteria_phage	85.9	0.0e+00
WP_000926345.1|13584_14466_-	hypothetical protein	NA	A0A1B0VBL3	Salmonella_phage	99.7	3.7e-174
WP_000523975.1|14480_15092_-	hypothetical protein	NA	Q71TN8	Escherichia_phage	98.0	2.7e-107
WP_000188920.1|15102_15669_-	hypothetical protein	NA	A0A077SK12	Escherichia_phage	99.5	6.6e-100
WP_024174696.1|15823_16993_-	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_000780957.1|16994_17501_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032346387.1|17589_18108_-	hypothetical protein	NA	Q71TC4	Escherichia_phage	92.2	3.1e-19
WP_000245708.1|18508_18730_+	host cell division inhibitor Icd-like protein	NA	A0A077SLM6	Escherichia_phage	98.6	2.8e-38
WP_000743162.1|18726_19770_+	phage antirepressor Ant	NA	Q71TN2	Escherichia_phage	94.8	3.6e-176
WP_001187871.1|19934_20735_+	phage antirepressor KilAC domain-containing protein	NA	Q1MVK4	Enterobacteria_phage	99.6	5.4e-148
WP_023154394.1|20764_21610_+	hypothetical protein	NA	Q1MVK3	Enterobacteria_phage	99.3	3.8e-152
WP_059339312.1|21660_21906_+	hypothetical protein	NA	A0A1B0VDM5	Salmonella_phage	46.2	3.5e-13
WP_001313475.1|22087_22243_+	type I toxin-antitoxin system toxin HokD	NA	A0A1I9LJU7	Stx_converting_phage	92.2	1.0e-15
WP_000509939.1|22359_22869_-	hypothetical protein	NA	Q1MVJ9	Enterobacteria_phage	100.0	1.3e-91
WP_000035301.1|22880_23462_-	hypothetical protein	NA	Q1MVJ8	Enterobacteria_phage	97.4	7.3e-102
WP_046659860.1|23497_24313_-	hypothetical protein	NA	A0A1B0V835	Salmonella_phage	100.0	6.8e-114
WP_000085143.1|24322_25912_-	hypothetical protein	NA	Q71TB2	Escherichia_phage	100.0	1.1e-306
WP_000067710.1|25972_27679_-	hypothetical protein	NA	Q71TM1	Escherichia_phage	100.0	0.0e+00
WP_000038866.1|27904_28906_-	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	100.0	1.7e-178
WP_001285362.1|28922_30119_-	AAA family ATPase	NA	A0A077SL49	Escherichia_phage	100.0	1.6e-225
WP_001076427.1|30676_31537_-	replication protein RepA	NA	Q71TL8	Escherichia_phage	100.0	4.7e-158
WP_001281116.1|31854_32247_-	hypothetical protein	NA	A0A077SLJ1	Escherichia_phage	99.2	2.0e-71
31865:31881	attL	CTTTCGATAAGAAGACC	NA	NA	NA	NA
WP_000007769.1|32424_32847_-	hypothetical protein	NA	A0A1B0VCB0	Salmonella_phage	100.0	2.7e-58
WP_000890198.1|32886_33675_-	hypothetical protein	NA	A0A1B0V830	Salmonella_phage	99.6	7.3e-121
WP_161403143.1|33688_33841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001177860.1|34137_34422_+	hypothetical protein	NA	Q71TA2	Escherichia_phage	100.0	3.5e-49
WP_000472529.1|34414_35320_+	recombination-associated protein RdgC	NA	A0A077SK17	Escherichia_phage	99.7	1.6e-159
WP_023155377.1|35316_37335_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	Q1MVI4	Enterobacteria_phage	95.1	0.0e+00
WP_000467133.1|38986_39421_+	tellurite resistance TerB family protein	NA	Q1MVI3	Enterobacteria_phage	100.0	8.1e-74
WP_000146942.1|39420_39585_+	DUF3927 family protein	NA	Q1MVI2	Enterobacteria_phage	98.1	6.9e-18
WP_059339311.1|40057_41422_+	replicative DNA helicase	NA	O80281	Escherichia_phage	99.3	5.3e-252
WP_023155375.1|41421_42420_+	hypothetical protein	NA	Q71TK3	Escherichia_phage	99.1	1.4e-193
WP_000535201.1|42466_43099_-	hypothetical protein	NA	A0A077SK50	Escherichia_phage	99.4	9.0e-90
WP_000212015.1|43091_44108_-	hypothetical protein	NA	A0A077SLQ1	Escherichia_phage	99.7	4.5e-192
WP_000602717.1|44109_44895_-	hypothetical protein	NA	Q71T90	Escherichia_phage	99.6	4.6e-144
WP_000896801.1|44881_45610_-	hypothetical protein	NA	A0A077SK19	Escherichia_phage	100.0	9.3e-139
WP_001141908.1|45613_46831_-	hypothetical protein	NA	A0A077SL53	Escherichia_phage	100.0	1.1e-224
WP_000235789.1|46840_47218_-	hypothetical protein	NA	Q38620	Escherichia_phage	99.2	6.4e-67
WP_000840931.1|47364_47610_+	hypothetical protein	NA	Q71T86	Escherichia_phage	100.0	5.7e-40
WP_000943612.1|47612_48191_+	VRR-NUC domain-containing protein	NA	A0A077SLK0	Escherichia_phage	100.0	8.8e-108
WP_000095380.1|48257_48413_+	hypothetical protein	NA	A0A077SK20	Escherichia_phage	100.0	1.2e-19
WP_032144601.1|48354_49017_+	hypothetical protein	NA	A0A077SL54	Escherichia_phage	100.0	4.5e-124
WP_069356943.1|48914_49541_+	norphogenetic protein	NA	A0A077SK52	Escherichia_phage	99.5	3.6e-123
WP_001354545.1|49537_50215_+	metallophosphoesterase	NA	A0A077SLQ6	Escherichia_phage	100.0	7.6e-135
WP_000684849.1|50211_50913_+	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	100.0	7.1e-144
WP_000107690.1|51214_52477_+	hypothetical protein	NA	A0A1B0V7L1	Salmonella_phage	99.8	1.6e-234
WP_032275633.1|52549_53056_+	3'-phosphatase 5'-polynucleotide kinase phage-associated protein	NA	A0A077SK53	Escherichia_phage	97.0	3.8e-91
WP_000675633.1|53250_53979_+	hypothetical protein	NA	Q71T76	Escherichia_phage	97.8	3.5e-138
WP_000158003.1|54062_54266_+	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	94.0	6.8e-31
WP_000476202.1|54258_54498_+	hypothetical protein	NA	S5MQM0	Escherichia_phage	92.4	2.0e-34
WP_001290016.1|54494_55196_+	ead/Ea22-like family protein	NA	A0A0U2QW67	Escherichia_phage	55.0	2.7e-50
WP_001018057.1|55192_55483_+	DUF4752 family protein	NA	A0A2I6TCB0	Escherichia_phage	82.3	1.2e-36
WP_059336898.1|55479_56214_+	hypothetical protein	NA	A0A2I6TCG8	Escherichia_phage	54.6	3.8e-39
WP_000215167.1|56210_56510_+	hypothetical protein	NA	A5VWB2	Enterobacteria_phage	99.0	1.3e-57
WP_000161574.1|56511_56997_+	ead/Ea22-like family protein	NA	A5VWB3	Enterobacteria_phage	88.9	3.1e-45
WP_000951712.1|56998_57208_+	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	92.8	2.0e-33
WP_000207969.1|57204_57567_+	hypothetical protein	NA	A0A1B0V865	Salmonella_phage	98.3	4.0e-58
WP_000797279.1|57739_57928_+	hypothetical protein	NA	A0A1I9LJM4	Stx_converting_phage	98.4	1.4e-30
WP_000628758.1|58441_59011_+	DUF551 domain-containing protein	NA	G9L6B4	Escherichia_phage	95.7	1.4e-102
WP_000382636.1|59001_59259_+	hypothetical protein	NA	A0A077SLR0	Escherichia_phage	97.6	2.0e-40
WP_000002126.1|59258_59540_+	ASCH domain-containing protein	NA	A0A077SLL0	Escherichia_phage	100.0	3.4e-49
WP_000267998.1|59563_59857_+	hypothetical protein	NA	A0A077SK23	Escherichia_phage	99.0	4.2e-50
WP_000988652.1|59863_60238_+	hypothetical protein	NA	A0A077SL57	Escherichia_phage	100.0	1.2e-68
WP_000057460.1|60219_60894_+	hypothetical protein	NA	A0A077SK55	Escherichia_phage	97.6	1.1e-114
WP_001261541.1|60890_61253_+	hypothetical protein	NA	A0A1B0VBR1	Salmonella_phage	99.2	2.2e-56
WP_001062547.1|62328_62685_-	hypothetical protein	NA	A0A1B0VCG1	Salmonella_phage	99.2	3.1e-63
WP_001133673.1|62685_63270_-	hypothetical protein	NA	Q1MVE8	Enterobacteria_phage	99.0	1.5e-110
WP_000506724.1|63444_63834_+	DNA repair protein	NA	A0A077SK24	Escherichia_phage	99.2	6.4e-70
WP_001190712.1|63906_64128_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
WP_001216045.1|64127_64508_+	type II toxin-antitoxin system death-on-curing family toxin	NA	Q71T66	Escherichia_phage	100.0	1.9e-63
WP_000113018.1|64512_64692_+	hypothetical protein	NA	Q71TH5	Escherichia_phage	98.3	1.2e-23
WP_000648833.1|64719_65763_+	DUF968 domain-containing protein	NA	A0A077SLM1	Escherichia_phage	99.7	1.1e-206
WP_001326849.1|65851_66304_+	late promoter-activating protein	NA	Q71T63	Escherichia_phage	100.0	3.0e-79
WP_000219618.1|66389_67583_+	hypothetical protein	NA	A0A077SL59	Escherichia_phage	99.7	4.7e-180
WP_000124159.1|67582_69067_+	hypothetical protein	NA	Q5QBP2	Enterobacteria_phage	99.8	4.3e-292
WP_000611656.1|69091_69943_-	hypothetical protein	NA	A0A077SLM8	Escherichia_phage	99.6	6.1e-158
WP_000874154.1|70053_70263_-	hypothetical protein	NA	Q5XLQ8	Enterobacteria_phage	100.0	4.8e-32
WP_000542336.1|70867_71089_+	hypothetical protein	NA	Q5QBN7	Enterobacteria_phage	100.0	4.5e-36
WP_001776219.1|71096_72128_+|integrase	tyrosine-type recombinase/integrase	integrase	Q71TG5	Escherichia_phage	99.7	4.9e-194
WP_001749391.1|72178_72490_+	hypothetical protein	NA	Q5QBN5	Enterobacteria_phage	100.0	2.1e-47
WP_001776220.1|72737_73298_+	Ref family protein	NA	Q5QBN4	Enterobacteria_phage	98.9	5.0e-100
WP_001408825.1|73486_74128_+	hypothetical protein	NA	A0A077SK30	Escherichia_phage	97.2	2.5e-111
WP_000072647.1|74327_74936_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000747846.1|75018_75267_-	hypothetical protein	NA	Q71TG0	Escherichia_phage	100.0	1.8e-41
WP_000224043.1|75263_75704_-	hypothetical protein	NA	A0A077SLF0	Escherichia_phage	100.0	1.7e-79
WP_069356944.1|75737_82505_-	N-6 DNA methylase	NA	Q1MVN7	Enterobacteria_phage	98.9	0.0e+00
WP_069356945.1|82580_84290_+|portal	phage portal protein	portal	Q1MVN6	Enterobacteria_phage	99.5	0.0e+00
82927:82943	attR	CTTTCGATAAGAAGACC	NA	NA	NA	NA
WP_000132937.1|84282_85302_+|head	head processing protein	head	Q71TR6	Escherichia_phage	96.8	4.4e-179
WP_001345478.1|85593_86151_-	lysozyme	NA	Q71TF3	Escherichia_phage	100.0	4.2e-107
WP_000068865.1|86319_86808_+	single-stranded DNA-binding protein	NA	A0A1B0VAF5	Salmonella_phage	100.0	5.0e-88
WP_001776225.1|87005_87794_+	hypothetical protein	NA	A0A077SK34	Escherichia_phage	98.8	4.0e-143
WP_001165936.1|87823_88132_-	hypothetical protein	NA	O21974	Escherichia_phage	97.1	5.4e-48
WP_001776226.1|88121_91109_-	hypothetical protein	NA	A0A1B0VFX4	Salmonella_phage	99.6	0.0e+00
WP_024200403.1|91121_91487_-	hypothetical protein	NA	Q1MVM8	Enterobacteria_phage	98.3	3.9e-45
WP_059339291.1|91483_93403_-	hypothetical protein	NA	A0A1B0V7H1	Salmonella_phage	96.9	0.0e+00
WP_001345482.1|93404_94007_-	hypothetical protein	NA	Q1MVM6	Enterobacteria_phage	100.0	5.4e-100
WP_000580776.1|93993_94437_-	hypothetical protein	NA	A0A077SK09	Escherichia_phage	100.0	1.3e-82
WP_000887652.1|94433_94763_-|holin	holin	holin	Q37876	Escherichia_phage	100.0	1.3e-52
WP_000145199.1|94837_95101_-	hypothetical protein	NA	Q71TD9	Escherichia_phage	67.1	1.1e-22
