The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP012430	Enterococcus faecium strain ISMMS_VRE_1 chromosome, complete genome	3130373	4749	73604	3130373	integrase,transposase	Bacillus_phage(25.0%)	59	3153:3197	55585:55629
3153:3197	attL	TGTAGTGACCCCCAAAAGTTAGACTTTTTTGGAGTGGAGAAATCC	NA	NA	NA	NA
WP_086953894.1|4749_6176_-|transposase	IS3-like element ISEfa10 family transposase	transposase	A0A1B1P773	Bacillus_phage	40.2	2.3e-48
WP_002301718.1|6417_6873_+|transposase	IS200/IS605 family transposase	transposase	A0A0H3UZM0	Geobacillus_virus	37.5	1.3e-16
WP_002289255.1|7458_7689_-	resolvase	NA	NA	NA	NA	NA
WP_002289254.1|7918_8737_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002289253.1|8897_9587_+	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_002289252.1|9600_11103_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_002300328.1|11115_11592_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_158514236.1|11688_11865_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_108676098.1|12089_13252_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	51.3	1.6e-79
WP_002305874.1|13754_14003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002287870.1|14369_14888_+	ClbS/DfsB family four-helix bundle protein	NA	NA	NA	NA	NA
WP_002329899.1|16024_16432_-	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
WP_002290351.1|16428_16662_-	addiction module antitoxin	NA	NA	NA	NA	NA
WP_002290352.1|16995_18081_+	tyrosine recombinase XerS	NA	NA	NA	NA	NA
WP_002324528.1|18364_19030_-|integrase	site-specific integrase	integrase	A0A1B2AQ00	Phage_Wrath	32.0	4.4e-18
WP_002290356.1|19183_19333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002290357.1|19325_19535_-	DUF3173 domain-containing protein	NA	NA	NA	NA	NA
WP_002335326.1|21039_22500_-	sucrose phosphorylase	NA	NA	NA	NA	NA
WP_002342361.1|22496_23717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002290367.1|23777_25961_-	alpha-galactosidase	NA	NA	NA	NA	NA
WP_002290368.1|26000_26831_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_002290370.1|26842_27715_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_002290371.1|27724_28984_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_002329911.1|29131_30442_-	alpha-glucosidase/alpha-galactosidase	NA	NA	NA	NA	NA
WP_002350071.1|30473_31298_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_002350067.1|32292_33402_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002338088.1|33695_34721_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_002290379.1|34965_36237_-	substrate-binding domain-containing protein	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	45.0	4.1e-17
WP_002290382.1|37479_37953_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A097PAS9	Streptococcus_pyogenes_phage	44.2	2.3e-13
WP_002290383.1|38125_38680_-|integrase	tyrosine-type recombinase/integrase	integrase	W8CYP1	Bacillus_phage	46.1	8.6e-36
WP_002300314.1|39152_40322_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_002319325.1|41341_41959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002311006.1|43022_43244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008271463.1|43341_43587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002344895.1|44810_45812_-	DUF4062 domain-containing protein	NA	NA	NA	NA	NA
WP_002344896.1|45970_46237_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002344897.1|46226_46583_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_016252778.1|46717_47398_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.1	4.5e-127
WP_044383143.1|47609_50759_-	type I restriction endonuclease subunit R	NA	NA	NA	NA	NA
WP_016922464.1|50772_51990_-	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	26.9	3.4e-24
WP_044383147.1|51979_53575_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	51.1	1.8e-126
WP_002326540.1|53699_54485_+	SinI family restriction endonuclease	NA	NA	NA	NA	NA
WP_002324480.1|54477_54720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010731484.1|55846_56980_-	ATP-binding protein	NA	NA	NA	NA	NA
55585:55629	attR	GGATTTCTCCACTCCAAAAAAGTCTAACTTTTGGGGGTCACTACA	NA	NA	NA	NA
WP_002350430.1|56970_57639_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	32.4	8.8e-27
WP_002350432.1|58094_59081_-	tagatose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_002350433.1|59093_60020_-	tagatose-6-phosphate kinase	NA	NA	NA	NA	NA
WP_010731482.1|60032_60548_-	galactose-6-phosphate isomerase subunit LacB	NA	NA	NA	NA	NA
WP_010731481.1|60566_60995_-	galactose-6-phosphate isomerase subunit LacA	NA	NA	NA	NA	NA
WP_010731480.1|61014_61788_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_002350438.1|61952_62432_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_002350439.1|62488_62791_+	PTS fructose transporter subunit IIB	NA	NA	NA	NA	NA
WP_002350440.1|62812_64270_+	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_002350442.1|64862_65615_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_016922316.1|67239_68922_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_002350447.1|68932_69256_-	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_016922317.1|69278_70685_-	6-phospho-beta-galactosidase	NA	NA	NA	NA	NA
WP_002350449.1|71151_72159_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_044383156.1|72923_73604_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	83.6	3.2e-109
>prophage 2
NZ_CP012430	Enterococcus faecium strain ISMMS_VRE_1 chromosome, complete genome	3130373	89375	130418	3130373	transposase	Streptococcus_phage(33.33%)	40	NA	NA
WP_002336308.1|89375_90335_-|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	26.8	2.2e-10
WP_010729754.1|90884_91793_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_010729753.1|91851_93654_-	3'-5' exoribonuclease	NA	I6R9X8	Croceibacter_phage	30.1	1.4e-10
WP_002342384.1|93716_94559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002331328.1|94574_94796_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002336713.1|95291_95972_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.1	5.8e-127
WP_002339142.1|96029_97250_-	PAS domain-containing protein	NA	A0A2P0ZL82	Lactobacillus_phage	58.5	3.9e-57
WP_002339141.1|97269_97881_-	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	53.2	1.7e-56
WP_002350224.1|97923_98856_-	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_002350223.1|99276_100137_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002322961.1|101002_101170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002298077.1|101202_102603_-	putative basic amino acid antiporter YfcC	NA	NA	NA	NA	NA
WP_002296840.1|103137_104325_+|transposase	IS256-like element IS16 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.3	8.2e-92
WP_002288620.1|104382_105624_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_010729750.1|105659_106370_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002288615.1|106437_107253_-	fructoselysine 6-kinase	NA	NA	NA	NA	NA
WP_002336724.1|107263_108232_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_010729749.1|108994_110287_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	37.5	3.9e-55
WP_002285758.1|110365_110560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002287659.1|110549_110903_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_002296127.1|111003_112551_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_002302440.1|112779_114081_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	33.6	1.6e-48
WP_002389879.1|114259_114529_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A1S5SCV8	Streptococcus_phage	48.8	8.7e-18
WP_014748823.1|114518_114785_-	antitoxin	NA	NA	NA	NA	NA
WP_077974475.1|114853_115081_-	ADP-ribosylglycohydrolase family protein	NA	NA	NA	NA	NA
WP_010729807.1|115285_115918_-	HAD family phosphatase	NA	A0A1D8KNV9	Synechococcus_phage	27.9	3.0e-08
WP_010729806.1|115930_118654_-	sigma 54-interacting transcriptional regulator	NA	NA	NA	NA	NA
WP_002322451.1|118790_119756_-	SIS domain-containing protein	NA	A0A2P1EMF5	Moumouvirus	21.7	6.2e-05
WP_002298371.1|119809_120622_-	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_010729805.1|120635_121409_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002298375.1|121422_121893_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002298377.1|121889_122306_-	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002311511.1|122630_123473_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_010729802.1|124931_125840_-|transposase	IS982-like element ISEfm1 family transposase	transposase	NA	NA	NA	NA
WP_002299197.1|126055_126667_+	VanZ family protein	NA	NA	NA	NA	NA
WP_002299198.1|126739_127669_+	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_074394709.1|127826_128564_+	TraM recognition domain-containing protein	NA	NA	NA	NA	NA
WP_010729801.1|128611_129790_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_171002450.1|129887_129986_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_080114943.1|130016_130418_+|transposase	transposase	transposase	A0A0N9S006	Staphylococcus_phage	49.2	2.5e-24
>prophage 3
NZ_CP012430	Enterococcus faecium strain ISMMS_VRE_1 chromosome, complete genome	3130373	161724	208135	3130373	transposase	Streptococcus_phage(28.57%)	41	NA	NA
WP_002297404.1|161724_162975_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002295674.1|163211_163553_-	DUF5406 domain-containing protein	NA	F0PIH7	Enterococcus_phage	62.5	1.5e-35
WP_002323647.1|164171_164504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002326172.1|165327_166368_-	replication initiator protein A	NA	NA	NA	NA	NA
WP_002348857.1|167719_167914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002323589.1|168620_169769_-|transposase	transposase	transposase	A0A288TXV8	Enterococcus_phage	93.7	9.0e-205
WP_002287522.1|169785_170190_-|transposase	IS200/IS605-like element ISEfa4 family transposase	transposase	A0A286QN76	Streptococcus_phage	73.8	1.3e-52
WP_002323399.1|170548_170803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002290394.1|170803_171121_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_002323400.1|171679_172615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002338109.1|173698_174553_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_002314387.1|174649_176899_+	alpha-galactosidase	NA	NA	NA	NA	NA
WP_002336205.1|176901_178077_+	MFS transporter	NA	NA	NA	NA	NA
WP_002297422.1|179221_179485_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_002314366.1|179484_179757_+	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_002292678.1|179833_180163_+	AbrB family transcriptional regulator	NA	NA	NA	NA	NA
WP_002292680.1|180724_181582_+	ParA family protein	NA	F0PIG8	Enterococcus_phage	30.7	8.1e-33
WP_002331383.1|181829_182510_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.1	5.8e-127
WP_086968564.1|183915_185057_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	57.7	3.8e-78
WP_069314644.1|185138_185435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010729386.1|185590_186040_+	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_087121905.1|186069_187232_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	54.2	4.1e-80
WP_002301194.1|187481_188759_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002298083.1|188768_189425_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.1	1.3e-22
WP_002301195.1|189424_190801_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002302275.1|193359_194331_+	radical SAM protein	NA	NA	NA	NA	NA
WP_002322470.1|194408_194645_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_077828694.1|194613_194745_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_002330694.1|194820_195204_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002302270.1|195236_196022_-	histidinol phosphate phosphatase	NA	NA	NA	NA	NA
WP_002302268.1|196199_197300_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_002302267.1|197289_198114_+	alkaline phosphatase family protein	NA	NA	NA	NA	NA
WP_002330693.1|198110_198926_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_002313180.1|198922_199753_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002302261.1|199759_200791_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.6	1.8e-26
WP_016922460.1|202397_202583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002348630.1|202706_203423_+	aminotransferase class V-fold PLP-dependent enzyme	NA	Q2XUY6	environmental_halophage	50.0	4.5e-45
WP_002285815.1|204132_204786_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.2	4.0e-24
WP_002300494.1|204782_206102_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_001015311.1|206203_206884_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	1.5e-127
WP_086968564.1|206994_208135_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	57.7	3.8e-78
>prophage 4
NZ_CP012430	Enterococcus faecium strain ISMMS_VRE_1 chromosome, complete genome	3130373	212801	258645	3130373	holin,integrase,transposase	Streptococcus_phage(37.5%)	49	222633:222652	257366:257385
WP_001224538.1|212801_213419_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	33.1	5.1e-13
WP_000366408.1|213459_213759_+	BRCT domain-containing protein	NA	NA	NA	NA	NA
WP_000824191.1|213792_213960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010729776.1|214004_214475_-	recombinase family protein	NA	NA	NA	NA	NA
WP_002319817.1|214480_215161_-|transposase	IS6-like element ISS1N family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	84.1	2.5e-109
WP_086968564.1|216373_217515_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	57.7	3.8e-78
WP_025189010.1|218065_218458_+	GNAT family N-acetyltransferase	NA	A0A0N7GFH7	Staphylococcus_phage	96.9	1.4e-69
WP_001028141.1|218458_219898_+	bifunctional aminoglycoside N-acetyltransferase AAC(6')-Ie/aminoglycoside O-phosphotransferase APH(2'')-Ia	NA	A0A0N9SKF6	Staphylococcus_phage	100.0	8.5e-285
WP_001015311.1|220364_221045_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	1.5e-127
WP_002300493.1|221384_222554_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
222633:222652	attL	ATTTACACAAAATATTTTAC	NA	NA	NA	NA
WP_001015311.1|223093_223774_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	1.5e-127
WP_002302237.1|223844_224510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305788.1|224553_224823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296377.1|225054_225351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010729773.1|225352_225775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296379.1|225793_227386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086968564.1|227887_229029_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	57.7	3.8e-78
WP_002322479.1|229276_229471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002330536.1|229606_230857_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	3.0e-113
WP_025481134.1|231239_231800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002313122.1|231826_233638_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002313123.1|233698_235168_+	toprim domain-containing protein	NA	NA	NA	NA	NA
WP_002303486.1|235178_237188_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	52.6	1.6e-111
WP_002295632.1|237303_237453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002299811.1|237533_238130_+	type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein	NA	NA	NA	NA	NA
WP_002301800.1|238142_239042_+	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_002301801.1|239044_239176_+	single-stranded DNA-binding protein	NA	A8ATZ7	Listeria_phage	83.3	1.3e-11
WP_002305808.1|239197_239530_+	single-stranded DNA-binding protein	NA	W6LM61	Streptococcus_phage	53.2	6.1e-21
WP_002295625.1|239551_239809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002295624.1|239967_240090_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_074399798.1|240279_240504_+	hypothetical protein	NA	A0A0S2MYI8	Enterococcus_phage	56.9	3.6e-09
WP_002324499.1|240951_241158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002287517.1|241157_241409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305049.1|241424_241862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305050.1|241854_242550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305052.1|243388_243820_+	type II toxin-antitoxin system HicB family antitoxin	NA	F0PIL2	Enterococcus_phage	64.9	4.3e-43
WP_000222572.1|243993_244947_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002323715.1|245249_246524_+	MFS transporter	NA	NA	NA	NA	NA
WP_002361237.1|246577_248005_+	glycoside hydrolase family 32 protein	NA	NA	NA	NA	NA
WP_002322785.1|248017_248890_+	ROK family protein	NA	NA	NA	NA	NA
WP_002305056.1|248984_249980_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_002297185.1|250334_251630_-|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	3.8e-10
WP_002323453.1|252184_252802_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	39.5	6.5e-16
WP_010729769.1|252959_254186_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_071870188.1|254259_254427_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002328876.1|254973_255882_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_002328877.1|255937_256435_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002328878.1|256471_257167_-	HisJ family histidinol phosphate phosphatase	NA	NA	NA	NA	NA
WP_000997695.1|257466_258645_+|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
257366:257385	attR	GTAAAATATTTTGTGTAAAT	NA	NA	NA	NA
>prophage 5
NZ_CP012430	Enterococcus faecium strain ISMMS_VRE_1 chromosome, complete genome	3130373	272885	339692	3130373	tRNA,integrase,transposase	Bacillus_phage(26.67%)	59	270458:270474	341377:341393
270458:270474	attL	CCCTTATGATCCAGAAA	NA	NA	NA	NA
WP_143344080.1|272885_274048_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	50.5	3.9e-78
WP_000997695.1|274744_275923_+|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_002295743.1|276047_276956_-|transposase	IS982-like element ISEfm1 family transposase	transposase	NA	NA	NA	NA
WP_002300833.1|277358_279305_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_002300835.1|279307_279763_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_002300836.1|279776_281105_+	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_002300838.1|281138_281423_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002300840.1|281424_281940_+	YjbQ family protein	NA	NA	NA	NA	NA
WP_002300841.1|281955_282618_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_002300842.1|282624_283197_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_002300843.1|283383_284904_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_002305884.1|285146_285332_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_002300846.1|285315_285498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002301839.1|286451_287051_+|integrase	tyrosine-type recombinase/integrase	integrase	D2XR58	Bacillus_phage	36.1	1.3e-29
WP_002322465.1|287114_287714_+	bacteriophage abortive infection AbiH family protein	NA	NA	NA	NA	NA
WP_002292418.1|288729_289602_-	ROK family protein	NA	NA	NA	NA	NA
WP_002293868.1|289865_291812_-	PTS beta-glucoside transporter subunit IIBCA	NA	NA	NA	NA	NA
WP_002302078.1|291996_293436_+	sucrose-6-phosphate hydrolase	NA	NA	NA	NA	NA
WP_002302077.1|293437_294400_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	25.8	2.3e-20
WP_002297218.1|294620_295916_-|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_086953894.1|296091_297518_-|transposase	IS3-like element ISEfa10 family transposase	transposase	A0A1B1P773	Bacillus_phage	40.2	2.3e-48
WP_002301718.1|297760_298216_+|transposase	IS200/IS605 family transposase	transposase	A0A0H3UZM0	Geobacillus_virus	37.5	1.3e-16
WP_002289255.1|298801_299032_-	resolvase	NA	NA	NA	NA	NA
WP_002289254.1|299261_300080_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002289253.1|300240_300930_+	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_002300328.1|302456_302933_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_158514107.1|303028_303139_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_002287966.1|304796_305171_+	iron-sulfur cluster biosynthesis family protein	NA	NA	NA	NA	NA
WP_002287965.1|305284_305914_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_002296289.1|306544_306709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002294080.1|307003_308332_+	C1 family peptidase	NA	R4TV59	Phaeocystis_globosa_virus	38.1	7.3e-73
WP_002287963.1|308533_309367_+	fructosamine kinase family protein	NA	NA	NA	NA	NA
WP_002287962.1|309382_310120_+	acyl-ACP thioesterase	NA	NA	NA	NA	NA
WP_002287961.1|310274_311243_-	asparaginase	NA	NA	NA	NA	NA
WP_002287960.1|311474_312308_+	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_002287959.1|312341_313181_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_002287958.1|313206_313767_+	haloacid dehalogenase	NA	A0A0H3UZF4	Geobacillus_virus	45.1	2.3e-28
WP_002287957.1|313965_315687_+	septation ring formation regulator EzrA	NA	NA	NA	NA	NA
WP_002287956.1|315851_316994_+	cysteine desulfurase	NA	NA	NA	NA	NA
WP_002287955.1|317009_318221_+|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
WP_002287954.1|318793_319441_+	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_002287953.1|319833_322479_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	42.9	4.0e-163
WP_002294071.1|322788_324102_+	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_002287951.1|324091_324745_+	HAD family phosphatase	NA	NA	NA	NA	NA
WP_002294069.1|324799_325492_+	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_002294067.1|325641_325842_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	71.2	3.7e-21
WP_002297218.1|326087_327383_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002287948.1|327617_329297_-	ribonuclease J	NA	NA	NA	NA	NA
WP_002287947.1|329298_329511_-	DNA-dependent RNA polymerase auxiliary subunit epsilon family protein	NA	NA	NA	NA	NA
WP_002296290.1|329903_331634_+	multidrug efflux ABC transporter subunit EfrA	NA	W8CYL7	Bacillus_phage	27.6	2.1e-43
WP_002289400.1|331630_333391_+	multidrug efflux ABC transporter subunit EfrB	NA	W8CYL7	Bacillus_phage	28.6	2.5e-52
WP_002296291.1|333485_333683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002289401.1|333835_334321_+	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_002289402.1|334424_335018_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.6	8.9e-55
WP_002289403.1|335197_335725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002289404.1|335815_336553_+	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	40.0	2.3e-12
WP_002289405.1|336556_337474_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_002289406.1|337475_338705_+	GTPase HflX	NA	NA	NA	NA	NA
WP_000222572.1|338738_339692_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
341377:341393	attR	TTTCTGGATCATAAGGG	NA	NA	NA	NA
>prophage 6
NZ_CP012430	Enterococcus faecium strain ISMMS_VRE_1 chromosome, complete genome	3130373	470795	522807	3130373	holin,tRNA,transposase	Bacillus_phage(23.08%)	42	NA	NA
WP_002289566.1|470795_471146_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_002289568.1|471312_472251_+	HPr kinase/phosphorylase	NA	NA	NA	NA	NA
WP_002289570.1|472265_473096_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_002289572.1|473139_474165_+	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_002289574.1|474179_475118_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	51.2	4.2e-75
WP_002289575.1|475242_475683_+	DUF948 domain-containing protein	NA	NA	NA	NA	NA
WP_002289576.1|475685_476288_+	YtxH domain-containing protein	NA	NA	NA	NA	NA
WP_002297218.1|476394_477690_-|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002304593.1|477855_478962_-	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_002289442.1|479171_480173_+	catabolite control protein A	NA	NA	NA	NA	NA
WP_002289443.1|480509_482855_-	penicillin-binding protein	NA	NA	NA	NA	NA
WP_069314649.1|483133_484036_+	deoxyribonuclease IV	NA	A0A2H4UU70	Bodo_saltans_virus	30.7	8.8e-22
WP_002289445.1|484248_486024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002326755.1|486089_487676_-	Nramp family divalent metal transporter	NA	NA	NA	NA	NA
WP_002294955.1|487926_488151_+	YneF family protein	NA	NA	NA	NA	NA
WP_002304603.1|488291_490043_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	31.2	4.8e-56
WP_069314650.1|490042_491827_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.4	4.6e-46
WP_002289170.1|492152_493004_+	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_002289171.1|493100_494981_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002289172.1|495020_495923_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002304606.1|496153_497557_+	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_002304608.1|497556_498990_+	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_002296150.1|499134_500061_+	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	52.4	5.0e-89
WP_002299465.1|500274_502002_+	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	63.7	1.5e-211
WP_002321425.1|502016_502367_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000122610.1|502539_503832_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	38.9	3.2e-57
WP_002304612.1|503965_504826_-	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_002287322.1|504917_505346_+	transcriptional repressor	NA	NA	NA	NA	NA
WP_002287321.1|505507_505684_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_002287318.1|505710_506157_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	39.5	5.3e-20
WP_002296623.1|506311_507607_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	37.5	3.9e-55
WP_002326809.1|507864_509160_-|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	5.0e-10
WP_002288744.1|509343_510723_-	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_002291698.1|511427_512399_+	PhoH family protein	NA	W8D063	Erwinia_phage	49.8	3.5e-48
WP_002299470.1|512422_514615_+	HDIG domain-containing protein	NA	NA	NA	NA	NA
WP_002288749.1|514631_515108_+	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_002330764.1|515091_515487_+	diacylglycerol kinase family protein	NA	NA	NA	NA	NA
WP_002304617.1|515501_516401_+	GTPase Era	NA	NA	NA	NA	NA
WP_002288755.1|516543_517356_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_002304619.1|517739_518657_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_002340445.1|518658_520734_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_002297185.1|521511_522807_+|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	3.8e-10
>prophage 7
NZ_CP012430	Enterococcus faecium strain ISMMS_VRE_1 chromosome, complete genome	3130373	554008	695893	3130373	capsid,portal,tRNA,holin,head,plate,integrase,transposase,terminase,tail,protease	Enterococcus_phage(20.0%)	152	610713:610730	699650:699667
WP_002326704.1|554008_554917_-|transposase	IS982-like element ISEfm1 family transposase	transposase	NA	NA	NA	NA
WP_002304673.1|556465_557395_-	membrane protein insertase YidC	NA	NA	NA	NA	NA
WP_002289550.1|557562_557910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002289551.1|558110_558386_-	acylphosphatase	NA	NA	NA	NA	NA
WP_002327792.1|558493_559258_+	RNA methyltransferase	NA	A0A2D1A6G0	Rhodococcus_phage	26.8	7.5e-06
WP_002289559.1|559380_559884_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_002289561.1|560291_560939_+	elongation factor G-binding protein	NA	NA	NA	NA	NA
WP_086953915.1|561121_562460_+|transposase	IS3-like element ISEnfa3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.7	2.6e-78
WP_002289547.1|562520_563789_+	voltage-gated chloride channel family protein	NA	A0A1X9I5Z9	Streptococcus_phage	31.1	2.2e-42
WP_002340453.1|563815_565015_-	YdcF family protein	NA	NA	NA	NA	NA
WP_002304680.1|565133_566441_-	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_002288760.1|566911_568030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002297185.1|568481_569777_-|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	3.8e-10
WP_002323868.1|570053_570374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288762.1|570825_571026_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	74.2	2.5e-22
WP_002304681.1|571172_573962_+	DEAD/DEAH box helicase family protein	NA	A0A1X9I5C8	Streptococcus_phage	30.9	1.1e-89
WP_002348809.1|574008_574536_+	DUF5590 domain-containing protein	NA	NA	NA	NA	NA
WP_002304682.1|574556_575747_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_002288767.1|575786_577085_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	30.3	1.2e-59
WP_002304684.1|578137_578812_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_002326717.1|578808_579150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288776.1|579179_579539_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_002304688.1|580062_582144_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	35.6	2.4e-115
WP_002288779.1|582454_583921_+	amino acid permease	NA	NA	NA	NA	NA
WP_002304690.1|584535_585075_+	topology modulation protein	NA	A0A097BYE2	Leuconostoc_phage	34.5	3.8e-20
WP_002294855.1|585148_585589_+	CopY/TcrY family copper transport repressor	NA	NA	NA	NA	NA
WP_002289040.1|585601_585811_+	copper chaperone CopZ	NA	NA	NA	NA	NA
WP_002312937.1|585810_587997_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	38.6	5.3e-121
WP_002299539.1|588016_590188_+	copper/silver-translocating P-type ATPase CopB	NA	A0A218MNH6	uncultured_virus	32.3	5.0e-71
WP_002304699.1|593982_594924_-	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_002304700.1|595068_595917_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_002294839.1|596270_597083_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002304701.1|597236_597560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002294835.1|597633_598203_+	prevent-host-death protein	NA	NA	NA	NA	NA
WP_002301695.1|598639_599332_+	hypothetical protein	NA	Q9MCC6	Lactobacillus_phage	43.4	4.0e-30
WP_145974683.1|599371_600711_-|transposase	IS3-like element ISEnfa3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.7	2.6e-78
WP_099098442.1|600815_601977_+|transposase	IS3-like element ISEfa8 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	54.2	1.8e-80
WP_002295743.1|602279_603188_+|transposase	IS982-like element ISEfm1 family transposase	transposase	NA	NA	NA	NA
WP_002326711.1|603348_604527_-|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_002305693.1|604765_605197_+	DUF4231 domain-containing protein	NA	NA	NA	NA	NA
WP_002295273.1|605428_605686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002297404.1|605971_607222_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002301623.1|607631_608606_+	choloylglycine hydrolase family protein	NA	M1HVK5	Paramecium_bursaria_Chlorella_virus	31.8	7.1e-25
WP_002285758.1|609078_609273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002287659.1|609262_609616_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_002296127.1|609717_611265_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
610713:610730	attL	ATTTTTCGAAGCAATTCC	NA	NA	NA	NA
WP_010729462.1|611337_612288_-|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	26.8	2.2e-10
WP_002326708.1|613029_613347_+	SdpI family protein	NA	NA	NA	NA	NA
WP_002289810.1|613437_613803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002300070.1|614010_614493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002289807.1|614689_615580_+	phosphate ABC transporter substrate-binding protein PstS family protein	NA	NA	NA	NA	NA
WP_002326707.1|615866_617141_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	35.9	9.5e-54
WP_002297196.1|617413_619885_+	cation-translocating P-type ATPase	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	28.8	7.0e-45
WP_002303966.1|619987_621724_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	34.1	1.2e-27
WP_002293705.1|621720_622425_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.2	1.4e-38
WP_002297194.1|622555_623059_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_002293708.1|623018_623357_+	putative DNA-binding protein	NA	NA	NA	NA	NA
WP_002293709.1|623377_624796_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_002293710.1|624907_625486_+	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_002297192.1|625489_626011_+	dihydrofolate reductase	NA	NA	NA	NA	NA
WP_002293714.1|626089_626644_-	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	29.3	2.3e-12
WP_002290274.1|626896_627172_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_002290277.1|627183_627435_+	KH domain-containing protein	NA	NA	NA	NA	NA
WP_002297190.1|627559_628351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002293716.1|628520_629042_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_002293717.1|629031_629793_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_002286913.1|629928_630276_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_033794991.1|630407_631544_-|integrase	site-specific integrase	integrase	A0A1P8BMN3	Lactococcus_phage	36.2	5.5e-53
WP_002371140.1|631660_632353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002371138.1|632490_633144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002371136.1|633193_633622_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_002337457.1|633626_634001_-	helix-turn-helix transcriptional regulator	NA	A0A2P0ZLA1	Lactobacillus_phage	44.6	6.9e-21
WP_002337458.1|634285_634471_+	helix-turn-helix transcriptional regulator	NA	Q5YAA3	Bacillus_phage	55.0	1.1e-11
WP_002371134.1|634483_634732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002371131.1|634762_634942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286568.1|634984_635455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286562.1|635541_636240_+	phage regulatory protein	NA	D2IYT0	Enterococcus_phage	34.6	1.7e-25
WP_002286559.1|636417_636759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286557.1|636751_637423_+	DUF1071 domain-containing protein	NA	A0A1B1P7F0	Bacillus_phage	47.4	4.2e-29
WP_069314654.1|637428_638115_+	hypothetical protein	NA	C9E2N1	Enterococcus_phage	70.9	4.4e-90
WP_002330650.1|638117_638345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002319843.1|638347_639175_+	hypothetical protein	NA	A0A0S2MYA8	Enterococcus_phage	54.9	3.9e-40
WP_069314655.1|639186_639456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002301521.1|639460_639625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002371792.1|639617_639920_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002371790.1|639916_640228_+	MazG-like family protein	NA	A0A0D3MVS9	Staphylococcus_phage	57.0	2.0e-26
WP_002371788.1|640224_640443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002304472.1|640453_641269_+	prohibitin family protein	NA	A0A288TXV9	Enterococcus_phage	69.4	1.8e-82
WP_002371787.1|641407_641764_+	DUF1140 family protein	NA	A0A2H4JAZ4	uncultured_Caudovirales_phage	36.4	5.2e-10
WP_002367600.1|641750_641969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002371784.1|641965_642364_+	YopX family protein	NA	D2IZL0	Enterococcus_phage	60.3	1.7e-33
WP_069314656.1|642360_642699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002369131.1|642695_642926_+	hypothetical protein	NA	A0A0S2MYD2	Enterococcus_phage	50.7	1.8e-11
WP_002353687.1|642932_643136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002369129.1|643132_643426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002341971.1|643455_643896_+	transcriptional regulator	NA	D2IYV6	Enterococcus_phage	38.4	5.3e-20
WP_002305391.1|643970_644438_+	ArpU family transcriptional regulator	NA	D7RWH7	Brochothrix_phage	28.5	2.4e-07
WP_002341729.1|644837_645191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002315371.1|645737_645950_+	hypothetical protein	NA	D2IZF7	Enterococcus_phage	59.6	3.8e-08
WP_002315370.1|645956_646184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002315369.1|646180_646465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002371779.1|646505_647078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002371777.1|647078_647390_+	HNH endonuclease	NA	A0A1S5SFB3	Streptococcus_phage	60.2	1.7e-28
WP_002371775.1|647380_647641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002371773.1|647844_648363_+	helix-turn-helix transcriptional regulator	NA	A0A2H4JA84	uncultured_Caudovirales_phage	55.8	7.6e-26
WP_002371772.1|648365_650057_+|terminase	terminase large subunit	terminase	A0A059T7Q8	Listeria_phage	51.9	2.5e-166
WP_158514237.1|650127_650427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000997695.1|650455_651634_-|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_069314658.1|651869_652301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002371768.1|652429_653602_+|portal	phage portal protein	portal	A0A2P0ZLC9	Lactobacillus_phage	46.8	9.9e-82
WP_002371767.1|653588_654293_+|protease	Clp protease ClpP	protease	A0A2H4J8Y7	uncultured_Caudovirales_phage	45.9	9.5e-48
WP_069314659.1|654297_655458_+|capsid	phage major capsid protein	capsid	D2XR18	Bacillus_phage	39.2	9.2e-64
WP_002371763.1|655533_655812_+	hypothetical protein	NA	A0A1W6JQ66	Staphylococcus_phage	48.2	1.8e-13
WP_073357576.1|655792_656164_+|head,tail	phage head-tail adapter protein	head,tail	A0A059T6F2	Listeria_phage	55.4	1.2e-28
WP_002371760.1|656179_656584_+	hypothetical protein	NA	A0A2H4J7V9	uncultured_Caudovirales_phage	38.6	3.1e-19
WP_002371758.1|656580_656991_+	hypothetical protein	NA	A0A059T681	Listeria_phage	47.2	3.1e-22
WP_002371756.1|657051_657639_+|tail	phage tail protein	tail	A0A2P0ZLF5	Lactobacillus_phage	41.0	2.7e-35
WP_002371755.1|657711_658179_+	Ig domain-containing protein	NA	C9E2K1	Enterococcus_phage	43.9	8.1e-19
WP_002337251.1|658224_658533_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002371753.1|658727_665492_+|tail	phage tail tape measure protein	tail	J7KDT4	Streptococcus_phage	38.4	1.5e-17
WP_002371751.1|665495_666317_+|tail	phage tail family protein	tail	Q9T1A6	Listeria_phage	43.0	9.4e-55
WP_002371749.1|666325_667369_+|tail	phage tail protein	tail	Q9T1A5	Listeria_phage	54.1	2.4e-103
WP_002371747.1|667368_668400_+	hypothetical protein	NA	A0A0B5D0C2	Listeria_phage	29.1	1.4e-23
WP_002371746.1|668399_670502_+|plate	BppU family phage baseplate upper protein	plate	A0A060AI60	Enterococcus_phage	70.1	2.3e-137
WP_002352447.1|670502_670949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002290625.1|670950_671088_+	XkdX family protein	NA	NA	NA	NA	NA
WP_002312831.1|671122_671365_+	hemolysin XhlA family protein	NA	D2J075	Enterococcus_phage	62.0	2.0e-21
WP_002352448.1|671380_671578_+|holin	phage holin	holin	A0A0S2MYF6	Enterococcus_phage	82.8	1.1e-22
WP_069314660.1|671588_672608_+	peptidoglycan recognition protein	NA	A0A1G5SA77	Enterococcus_phage	66.1	3.2e-60
WP_087046766.1|673547_674709_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	54.2	4.1e-80
WP_002286474.1|675632_676040_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296902.1|676053_676455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286473.1|676456_676828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286680.1|676863_677166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076005172.1|677414_677615_-|integrase	tyrosine-type recombinase/integrase	integrase	Q9AZR0	Lactococcus_phage	75.7	4.6e-08
WP_002348827.1|677919_679152_-	aminopeptidase	NA	NA	NA	NA	NA
WP_002286467.1|679408_679978_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002297963.1|680155_680596_-	flavodoxin	NA	NA	NA	NA	NA
WP_002294533.1|680753_681518_+	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_002286461.1|681549_682473_+	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_002286457.1|682548_683688_+	undecaprenyl/decaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase	NA	NA	NA	NA	NA
WP_002286455.1|683680_684481_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_002286453.1|684480_685308_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_002321540.1|685285_686020_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_002286449.1|686119_686986_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	62.5	3.7e-102
WP_002286442.1|686999_687572_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	49.2	8.3e-42
WP_002294532.1|687593_688622_+	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	42.9	6.4e-69
WP_002286428.1|688719_689571_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	39.0	1.7e-38
WP_002348826.1|689604_691638_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002371302.1|691681_692962_+	EpaQ family protein	NA	NA	NA	NA	NA
WP_002297185.1|693058_694354_-|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	3.8e-10
WP_010782578.1|694618_695893_-|transposase	ISL3-like element IS1476 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	36.1	8.6e-55
699650:699667	attR	ATTTTTCGAAGCAATTCC	NA	NA	NA	NA
>prophage 8
NZ_CP012430	Enterococcus faecium strain ISMMS_VRE_1 chromosome, complete genome	3130373	771370	846114	3130373	tRNA,transposase	Streptococcus_phage(25.0%)	59	NA	NA
WP_002287651.1|771370_773311_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	35.2	3.3e-114
WP_002287653.1|773534_774383_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002302928.1|774777_776931_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_002296740.1|777116_777926_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_002295362.1|778218_779655_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	29.0	3.8e-43
WP_002290958.1|779824_781021_+	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_002295359.1|781082_781268_-	YjzD family protein	NA	NA	NA	NA	NA
WP_002303521.1|781498_784813_+	DNA polymerase III subunit alpha	NA	R4TB75	Streptomyces_phage	33.0	1.8e-149
WP_002304759.1|784980_785943_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_002295355.1|786016_787801_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_002295354.1|787835_788738_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002295352.1|788923_789493_+	DUF177 domain-containing protein	NA	NA	NA	NA	NA
WP_002290970.1|789550_789730_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_002295350.1|789899_791321_+	NADP-dependent phosphogluconate dehydrogenase	NA	A0A1D8KPW3	Synechococcus_phage	31.1	4.2e-34
WP_002290973.1|791513_792200_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	31.2	4.8e-28
WP_002298265.1|792196_793702_+	HAMP domain-containing histidine kinase	NA	Q8QNA2	Ectocarpus_siliculosus_virus	25.1	3.9e-06
WP_002288811.1|802182_802947_+	carbohydrate deacetylase	NA	NA	NA	NA	NA
WP_002321325.1|802933_804376_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_002288813.1|804386_805718_+	maltose-6'-phosphate glucosidase	NA	NA	NA	NA	NA
WP_002288815.1|805730_806189_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002288817.1|806480_807782_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002295336.1|807808_808069_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_002287522.1|808933_809338_+|transposase	IS200/IS605-like element ISEfa4 family transposase	transposase	A0A286QN76	Streptococcus_phage	73.8	1.3e-52
WP_002287525.1|809354_810503_+|transposase	transposase	transposase	A0A288TXV8	Enterococcus_phage	93.4	1.2e-204
WP_002288819.1|810958_812194_-	glycosyl transferase	NA	NA	NA	NA	NA
WP_002288821.1|812761_813589_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002288823.1|813861_814632_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_002288825.1|814849_815917_+	L-ascorbate 6-phosphate lactonase	NA	NA	NA	NA	NA
WP_002295331.1|815934_816396_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_002288827.1|816415_817900_+	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_002288830.1|817942_818242_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002288832.1|818256_818895_+	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_002289048.1|818899_819760_+	L-ribulose-5-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_002295327.1|819749_820460_+	L-ribulose-5-phosphate 4-epimerase	NA	NA	NA	NA	NA
WP_069314662.1|820691_821126_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002289065.1|821222_821522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002289063.1|821790_821985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002324322.1|822179_823358_+|transposase	IS256-like element ISEfm2 family transposase	transposase	NA	NA	NA	NA
WP_000222572.1|823584_824538_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002297183.1|824762_826625_+	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_002291790.1|826624_826957_+	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_002287107.1|827099_828350_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002288314.1|828759_829116_+	glycine-rich SFCGS family protein	NA	NA	NA	NA	NA
WP_002288312.1|829131_829482_+	DUF4312 family protein	NA	NA	NA	NA	NA
WP_002288309.1|829510_830290_+	DUF4311 domain-containing protein	NA	NA	NA	NA	NA
WP_002296962.1|830300_830978_+	DUF4310 family protein	NA	NA	NA	NA	NA
WP_002288305.1|830996_832103_+	amidohydrolase/deacetylase family metallohydrolase	NA	NA	NA	NA	NA
WP_002288304.1|832092_833184_+	DgaE family pyridoxal phosphate-dependent ammonia lyase	NA	NA	NA	NA	NA
WP_002288301.1|833196_833937_+	KDGP aldolase family protein	NA	NA	NA	NA	NA
WP_002288299.1|834224_836165_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_002288297.1|836251_838174_+	transcription antiterminator	NA	NA	NA	NA	NA
WP_002288294.1|838453_838876_-	arsenate reductase (thioredoxin)	NA	A0A2H4PQT9	Staphylococcus_phage	48.9	2.0e-29
WP_002288292.1|839267_840290_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002288290.1|840414_840849_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002288289.1|840963_841938_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_002288288.1|842335_843289_-	1-phosphofructokinase family hexose kinase	NA	NA	NA	NA	NA
WP_002288287.1|843254_844046_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	29.4	1.4e-18
WP_002288286.1|844269_844728_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_002287107.1|844863_846114_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
>prophage 9
NZ_CP012430	Enterococcus faecium strain ISMMS_VRE_1 chromosome, complete genome	3130373	997395	1006551	3130373	transposase	Lysinibacillus_phage(16.67%)	9	NA	NA
WP_002297185.1|997395_998691_-|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	3.8e-10
WP_002297115.1|998965_999343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002288021.1|999598_1000327_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	E3SPA9	Prochlorococcus_phage	41.4	4.6e-45
WP_002295474.1|1000326_1000581_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_002288017.1|1000582_1001254_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_002288015.1|1001254_1003477_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.3	1.9e-150
WP_002288013.1|1003461_1004901_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	33.1	5.3e-53
WP_002288011.1|1004923_1005976_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.7	2.7e-62
WP_002288010.1|1005972_1006551_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	37.4	1.3e-26
>prophage 10
NZ_CP012430	Enterococcus faecium strain ISMMS_VRE_1 chromosome, complete genome	3130373	1305340	1331546	3130373	integrase,transposase,protease	Streptococcus_phage(28.57%)	24	1305257:1305273	1337653:1337669
1305257:1305273	attL	AAAAGGCTCTTTGTCAA	NA	NA	NA	NA
WP_000122610.1|1305340_1306633_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	38.9	3.2e-57
WP_002296638.1|1307372_1307579_+	DUF3955 domain-containing protein	NA	NA	NA	NA	NA
WP_002296637.1|1307780_1308782_-	alpha/beta hydrolase	NA	M1PGN2	Moumouvirus	31.8	2.5e-09
WP_002296634.1|1310866_1311373_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_002296633.1|1311532_1311973_+	Spx/MgsR family RNA polymerase-binding regulatory protein	NA	NA	NA	NA	NA
WP_002296632.1|1311998_1313156_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002296631.1|1313158_1313515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296629.1|1313812_1314787_-	LPXTG-anchored fibrinogen/nidogen-binding adhesin SgrA	NA	NA	NA	NA	NA
WP_002378019.1|1314982_1315822_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_002296627.1|1316006_1316894_+	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_002311093.1|1317487_1318183_-	fructose-6-phosphate aldolase	NA	E3SKN5	Synechococcus_phage	31.5	1.0e-22
WP_002296624.1|1318166_1318565_-	PTS glucitol/sorbitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_002287107.1|1318973_1320224_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002296760.1|1320365_1321361_-	PTS glucitol/sorbitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_002289423.1|1321378_1321933_-	PTS glucitol/sorbitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_002289422.1|1321920_1322412_-	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002378335.1|1322404_1324273_-	HTH domain-containing protein	NA	NA	NA	NA	NA
WP_002289420.1|1324291_1325092_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	26.2	2.6e-09
WP_002289418.1|1325315_1325531_+	DUF378 domain-containing protein	NA	NA	NA	NA	NA
WP_002303864.1|1325669_1326155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002289415.1|1326610_1327024_+	Hsp20/alpha crystallin family protein	NA	A0A1B2LRT2	Wolbachia_phage	31.5	2.1e-07
WP_000997695.1|1328074_1329253_+|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_000222572.1|1329408_1330362_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002288357.1|1330418_1331546_+|integrase	site-specific integrase	integrase	A0A2I7SCV1	Paenibacillus_phage	55.5	1.8e-109
1337653:1337669	attR	TTGACAAAGAGCCTTTT	NA	NA	NA	NA
>prophage 11
NZ_CP012430	Enterococcus faecium strain ISMMS_VRE_1 chromosome, complete genome	3130373	1480366	1610507	3130373	capsid,tRNA,portal,holin,head,transposase,terminase,tail,protease	Enterococcus_phage(20.0%)	146	NA	NA
WP_002294137.1|1480366_1482076_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_002294136.1|1482143_1483412_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_002294135.1|1483572_1484373_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_002294134.1|1484369_1485182_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	46.8	2.0e-25
WP_069314672.1|1485590_1486841_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.0	1.2e-112
WP_002293875.1|1487159_1487717_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_002293877.1|1487719_1488442_-	UMP kinase	NA	NA	NA	NA	NA
WP_002293878.1|1488577_1489459_-	elongation factor Ts	NA	NA	NA	NA	NA
WP_002293880.1|1489557_1490340_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_002293881.1|1490698_1491178_+	ArgR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002326698.1|1491394_1492486_+	2-aminoethylphosphonate--pyruvate transaminase	NA	NA	NA	NA	NA
WP_002326699.1|1492478_1492607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288430.1|1492610_1493156_+	phosphonoacetaldehyde hydrolase	NA	NA	NA	NA	NA
WP_002288432.1|1493608_1495300_-|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	32.6	2.9e-74
WP_002288434.1|1495719_1496667_-	carbamate kinase	NA	NA	NA	NA	NA
WP_002288437.1|1496781_1497801_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_002288439.1|1497891_1499121_-	arginine deiminase	NA	NA	NA	NA	NA
WP_002288442.1|1499581_1500283_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_002326809.1|1500454_1501750_+|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	5.0e-10
WP_002301319.1|1502413_1503430_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	41.0	5.4e-60
WP_002288445.1|1503426_1503891_-	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_002348676.1|1503897_1504440_-	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_002288447.1|1504423_1505248_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_002288449.1|1505336_1506317_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.9	5.8e-19
WP_002288451.1|1506340_1507825_-	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_002288452.1|1507836_1508826_-	UDP-glucose 4-epimerase GalE	NA	A0A1V0SG19	Hokovirus	36.8	2.1e-48
WP_002288457.1|1509073_1509241_+	DUF3042 family protein	NA	NA	NA	NA	NA
WP_002288458.1|1509302_1511114_-	FAD/NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_002288459.1|1511110_1511476_-	DUF488 family protein	NA	NA	NA	NA	NA
WP_002288461.1|1511638_1512034_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_002288462.1|1512051_1513014_-	ROK family glucokinase	NA	NA	NA	NA	NA
WP_002293902.1|1513013_1513226_-	YqgQ family protein	NA	NA	NA	NA	NA
WP_002289885.1|1513246_1513945_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_002289886.1|1513964_1514507_-	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_002301321.1|1514638_1515643_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_002293904.1|1515639_1516629_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_002293905.1|1516625_1517432_-	ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	32.1	1.0e-13
WP_002293906.1|1517597_1518554_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002296121.1|1518630_1519149_-	dihydrofolate reductase	NA	G3MBI7	Bacillus_virus	39.1	7.1e-24
WP_002296119.1|1519236_1519386_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_002288531.1|1519613_1520060_+	DUF2188 domain-containing protein	NA	NA	NA	NA	NA
WP_002288533.1|1520254_1522150_-	asparagine synthase (glutamine-hydrolyzing)	NA	F2Y2L7	Organic_Lake_phycodnavirus	26.2	6.0e-20
WP_002303934.1|1522474_1523449_-	choloylglycine hydrolase family protein	NA	M1H001	Paramecium_bursaria_Chlorella_virus	29.7	3.0e-23
WP_002296332.1|1524014_1524581_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002296334.1|1524836_1526168_+	DUF1576 domain-containing protein	NA	NA	NA	NA	NA
WP_002296335.1|1526133_1526484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002297629.1|1526575_1526995_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_002296337.1|1526995_1527340_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_002301399.1|1527605_1528565_+|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	26.8	2.2e-10
WP_002287776.1|1528754_1529351_+	TVP38/TMEM64 family protein	NA	M1Q152	Streptococcus_phage	41.7	8.7e-34
WP_002287775.1|1529474_1531274_+	glycerophosphoryl diester phosphodiesterase membrane domain-containing protein	NA	I6XE30	Staphylococcus_phage	26.5	5.3e-10
WP_002297633.1|1531551_1531764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002293931.1|1532225_1532375_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002311774.1|1532627_1533587_-|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	27.2	7.5e-11
WP_002295743.1|1533799_1534708_+|transposase	IS982-like element ISEfm1 family transposase	transposase	NA	NA	NA	NA
WP_002288573.1|1534756_1535143_+	YxeA family protein	NA	NA	NA	NA	NA
WP_002288574.1|1535450_1536797_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_002288575.1|1536908_1538258_-	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_002288576.1|1538374_1539628_+	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4PQX1	Staphylococcus_phage	55.3	7.7e-24
WP_002288577.1|1539698_1540184_-|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
WP_002288579.1|1540206_1540965_-	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	36.4	1.9e-25
WP_002288581.1|1540980_1542159_-	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	48.9	3.9e-102
WP_002303943.1|1542388_1544509_+	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	58.0	8.2e-220
WP_002297218.1|1544626_1545922_-|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002296838.1|1546253_1546979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288586.1|1546968_1547478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288588.1|1547547_1548996_-	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	29.3	1.7e-19
WP_002288590.1|1548995_1549712_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.7	1.0e-33
WP_002288595.1|1549692_1550043_-	SdpI family protein	NA	NA	NA	NA	NA
WP_002288592.1|1550186_1550960_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_002302293.1|1551716_1552019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000997695.1|1552300_1553479_+|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_002321266.1|1553815_1554055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002289617.1|1554416_1554677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002297218.1|1554962_1556258_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002289618.1|1556383_1556881_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_002289619.1|1557010_1557721_-	acetolactate decarboxylase	NA	NA	NA	NA	NA
WP_002289620.1|1557733_1559398_-	acetolactate synthase AlsS	NA	NA	NA	NA	NA
WP_002300930.1|1559602_1560265_-	DUF624 domain-containing protein	NA	NA	NA	NA	NA
WP_002303949.1|1560274_1561090_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_002288989.1|1561351_1561795_-	LysR family transcriptional regulator substrate-binding protein	NA	NA	NA	NA	NA
WP_002296800.1|1561825_1561939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002321036.1|1561928_1562267_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_069314673.1|1562254_1562632_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_069314674.1|1562855_1564049_+	MFS transporter	NA	NA	NA	NA	NA
WP_002288984.1|1564214_1564637_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002303955.1|1565226_1565682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288982.1|1565843_1567016_-	class C sortase	NA	NA	NA	NA	NA
WP_002303963.1|1570146_1572474_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_002288970.1|1573316_1573610_-	DUF2087 domain-containing protein	NA	NA	NA	NA	NA
WP_002299614.1|1574111_1574342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002330703.1|1574347_1574647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286473.1|1574682_1575054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296902.1|1575055_1575457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286474.1|1575470_1575878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087046766.1|1576800_1577963_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	54.2	4.1e-80
WP_002349643.1|1578902_1579928_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A139ZVY1	Enterococcus_phage	61.3	2.8e-64
WP_002286683.1|1579924_1580149_-|holin	phage holin	holin	NA	NA	NA	NA
WP_002286686.1|1580145_1580439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296594.1|1580476_1580614_-	XkdX family protein	NA	NA	NA	NA	NA
WP_002286491.1|1580615_1581062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002290627.1|1581058_1581208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286495.1|1581224_1583351_-	hypothetical protein	NA	A0A060AI60	Enterococcus_phage	40.1	1.4e-62
WP_002286497.1|1583374_1585666_-|tail	phage tail protein	tail	A0A1D3SNL1	Enterococcus_phage	30.0	9.6e-89
WP_002286500.1|1585675_1586413_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_002348716.1|1586463_1589895_-|tail	phage tail tape measure protein	tail	A0A1D3SNL5	Enterococcus_phage	44.4	3.1e-67
WP_002286510.1|1590096_1590459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286512.1|1590478_1591087_-	hypothetical protein	NA	Q8W5Z9	Listeria_phage	41.1	3.0e-34
WP_002286516.1|1591098_1591503_-	hypothetical protein	NA	R4IBU7	Listeria_phage	29.5	6.1e-07
WP_002296598.1|1591495_1591897_-	hypothetical protein	NA	A0A1B1P759	Bacillus_phage	33.3	1.1e-13
WP_002286522.1|1591886_1592240_-|head	phage head closure protein	head	NA	NA	NA	NA
WP_002286523.1|1592229_1592541_-	hypothetical protein	NA	A0A1B1P751	Bacillus_phage	42.1	6.3e-12
WP_002286524.1|1592537_1593413_-	hypothetical protein	NA	D2IYX3	Enterococcus_phage	74.2	5.6e-130
WP_002286525.1|1593422_1594583_-|capsid	phage major capsid protein	capsid	A0A1B1P752	Bacillus_phage	50.1	1.8e-99
WP_002286527.1|1594582_1595269_-|protease	Clp protease ClpP	protease	A0A2I6PDD0	Staphylococcus_phage	39.7	1.0e-30
WP_002286530.1|1595231_1596410_-|portal	phage portal protein	portal	A0A1B1P754	Bacillus_phage	40.4	5.4e-80
WP_002286533.1|1596429_1598124_-|terminase	terminase large subunit	terminase	A0A1B1P766	Bacillus_phage	49.6	3.0e-148
WP_002286538.1|1598101_1598416_-|terminase	terminase	terminase	A0A1S7FYW6	Listeria_phage	37.9	3.3e-08
WP_002296599.1|1598517_1598799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286540.1|1598803_1599148_-	HNH endonuclease	NA	A0A1B1P757	Bacillus_phage	57.1	3.8e-26
WP_002296600.1|1599173_1599341_-	thymidylate synthase	NA	NA	NA	NA	NA
WP_002311723.1|1599536_1599743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002300143.1|1600196_1600472_+	hypothetical protein	NA	A0A2H4JEH2	uncultured_Caudovirales_phage	45.7	9.9e-17
WP_002296602.1|1600468_1600621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286542.1|1600929_1601343_-	autolysin	NA	C9E2P5	Enterococcus_phage	81.0	1.5e-56
WP_002286693.1|1601419_1601716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286545.1|1601712_1602270_-	DUF1642 domain-containing protein	NA	A0A0C5KKV2	Enterococcus_phage	36.2	2.8e-10
WP_002286547.1|1602266_1602686_-	YopX family protein	NA	D2IZL0	Enterococcus_phage	54.3	4.1e-30
WP_002322165.1|1602682_1602901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069314675.1|1602887_1603244_-	DUF1140 family protein	NA	A0A2H4JAZ4	uncultured_Caudovirales_phage	37.4	4.0e-10
WP_002286694.1|1603243_1603549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296606.1|1603545_1603707_-	antitoxin	NA	NA	NA	NA	NA
WP_002286695.1|1603703_1604006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296607.1|1603998_1604163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286696.1|1604167_1604437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286552.1|1604448_1605198_-	helix-turn-helix domain-containing protein	NA	A0A1L2BY83	Clostridium_phage	54.0	1.7e-31
WP_069314676.1|1605200_1605887_-	hypothetical protein	NA	C9E2N1	Enterococcus_phage	70.0	8.3e-89
WP_002286557.1|1605892_1606564_-	DUF1071 domain-containing protein	NA	A0A1B1P7F0	Bacillus_phage	47.4	4.2e-29
WP_002286559.1|1606556_1606898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286562.1|1607075_1607774_-	phage regulatory protein	NA	D2IYT0	Enterococcus_phage	34.6	1.7e-25
WP_002286568.1|1607860_1608331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296610.1|1608373_1608553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286573.1|1608539_1608878_-	DUF771 domain-containing protein	NA	NA	NA	NA	NA
WP_002296611.1|1608893_1609097_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002290310.1|1609111_1609888_-	phage antirepressor	NA	A0A1Q1PVU2	Staphylococcus_phage	53.8	1.1e-73
WP_002296612.1|1610186_1610507_+	helix-turn-helix transcriptional regulator	NA	A0A1S5SDR1	Streptococcus_phage	40.2	2.0e-13
>prophage 12
NZ_CP012430	Enterococcus faecium strain ISMMS_VRE_1 chromosome, complete genome	3130373	1685138	1693610	3130373		Streptococcus_phage(66.67%)	9	NA	NA
WP_002288083.1|1685138_1687328_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0C5KKX3	Enterococcus_phage	66.6	1.8e-286
WP_002288081.1|1687642_1688245_+	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A288TZV3	Enterococcus_phage	58.6	1.7e-53
WP_002294035.1|1688298_1689420_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_002288078.1|1689528_1690401_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	60.4	3.1e-88
WP_002288076.1|1690469_1690817_-	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	41.1	5.1e-18
WP_002288073.1|1690809_1691634_-	stage 0 sporulation family protein	NA	NA	NA	NA	NA
WP_002288071.1|1691669_1692608_-	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	34.4	3.3e-35
WP_002292340.1|1692621_1692951_-	cyclic-di-AMP receptor	NA	NA	NA	NA	NA
WP_002294039.1|1692965_1693610_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	52.6	4.2e-58
>prophage 13
NZ_CP012430	Enterococcus faecium strain ISMMS_VRE_1 chromosome, complete genome	3130373	1756900	1814872	3130373	tRNA,transposase	Streptococcus_phage(37.5%)	49	NA	NA
WP_002287066.1|1756900_1757374_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_002287068.1|1757496_1758477_-	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_002287072.1|1759434_1760304_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_002287073.1|1760329_1760845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002287074.1|1760891_1761485_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002291570.1|1761509_1761689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002287075.1|1761765_1762275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002287076.1|1762369_1762750_-	VOC family protein	NA	NA	NA	NA	NA
WP_002287078.1|1763079_1763829_+	nicotinamide mononucleotide transporter	NA	A0A2H4PB74	Lactobacillus_phage	70.7	5.1e-92
WP_002287080.1|1764012_1765290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002287081.1|1765368_1766013_-	pyroglutamyl-peptidase I	NA	NA	NA	NA	NA
WP_002287082.1|1766211_1767156_-	DUF979 domain-containing protein	NA	NA	NA	NA	NA
WP_002287083.1|1767157_1767844_-	DUF969 domain-containing protein	NA	NA	NA	NA	NA
WP_002287086.1|1768317_1768638_+	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_002287087.1|1768791_1769697_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	39.4	6.8e-38
WP_069314678.1|1769693_1770467_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_002287090.1|1770647_1772072_-	amino acid permease	NA	NA	NA	NA	NA
WP_002287091.1|1772282_1772729_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	NA	NA	NA	NA
WP_002287092.1|1772793_1774776_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002287094.1|1774789_1775686_-	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_002296173.1|1775688_1776750_-	DUF871 domain-containing protein	NA	NA	NA	NA	NA
WP_002304258.1|1776960_1777527_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_002296175.1|1777554_1779057_-	ABC-F type ribosomal protection protein Eat(A)	NA	A0A1B0RXA0	Streptococcus_phage	26.1	1.4e-27
WP_000122610.1|1779266_1780559_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	38.9	3.2e-57
WP_002348781.1|1780821_1781943_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	31.3	7.6e-23
WP_002296177.1|1782068_1783010_+	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_002290034.1|1783159_1784056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296179.1|1784324_1785665_+	amino acid permease	NA	NA	NA	NA	NA
WP_002296181.1|1785882_1786326_+	DUF305 domain-containing protein	NA	NA	NA	NA	NA
WP_002296182.1|1786829_1788248_-	Na+/H+ antiporter NhaC	NA	NA	NA	NA	NA
WP_002293788.1|1788650_1789874_-	M20 family metallopeptidase	NA	NA	NA	NA	NA
WP_002296185.1|1789904_1790744_-	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002293786.1|1790760_1791441_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002296186.1|1791442_1792516_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	35.5	5.8e-28
WP_002296187.1|1793162_1793834_-	HAD family phosphatase	NA	NA	NA	NA	NA
WP_002304253.1|1793920_1796599_-	magnesium-translocating P-type ATPase	NA	M1HXH2	Paramecium_bursaria_Chlorella_virus	25.6	1.1e-48
WP_002293327.1|1797257_1797695_+	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	46.2	4.1e-25
WP_002296189.1|1797716_1798583_-	Rgg/GadR/MutR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002293776.1|1798742_1800836_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	47.1	4.5e-162
WP_002293828.1|1801584_1802208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002297293.1|1804011_1805199_+|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	28.7	4.6e-26
WP_000195429.1|1805743_1806916_+|transposase	IS256-like element IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	100.0	3.5e-135
WP_001028141.1|1807045_1808485_-	bifunctional aminoglycoside N-acetyltransferase AAC(6')-Ie/aminoglycoside O-phosphotransferase APH(2'')-Ia	NA	A0A0N9SKF6	Staphylococcus_phage	100.0	8.5e-285
WP_000393259.1|1808485_1808878_-	GNAT family N-acetyltransferase	NA	A0A0N7GFH7	Staphylococcus_phage	100.0	6.9e-72
WP_000195429.1|1808934_1810107_-|transposase	IS256-like element IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	100.0	3.5e-135
WP_001015311.1|1810256_1810937_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	1.5e-127
WP_010730188.1|1811385_1811709_+	quaternary ammonium compound efflux SMR transporter QacH	NA	NA	NA	NA	NA
WP_025192524.1|1812521_1813445_-	protein rep	NA	NA	NA	NA	NA
WP_001015311.1|1814191_1814872_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	1.5e-127
>prophage 14
NZ_CP012430	Enterococcus faecium strain ISMMS_VRE_1 chromosome, complete genome	3130373	2119155	2164262	3130373	tRNA,transposase	Bacillus_phage(28.57%)	40	NA	NA
WP_002297185.1|2119155_2120451_+|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	3.8e-10
WP_098381422.1|2121717_2122844_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	54.1	5.0e-75
WP_002300890.1|2123529_2124228_-	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002300896.1|2125590_2126424_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_002300898.1|2126657_2127401_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_002294730.1|2127591_2128227_-	DUF998 domain-containing protein	NA	NA	NA	NA	NA
WP_002300900.1|2128373_2129615_-	serine/threonine transporter SstT	NA	NA	NA	NA	NA
WP_025477866.1|2129935_2130613_-	DUF4767 domain-containing protein	NA	NA	NA	NA	NA
WP_002300904.1|2130863_2131406_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_002300905.1|2131410_2131638_-	cation transporter	NA	NA	NA	NA	NA
WP_002300907.1|2131716_2133597_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	33.9	1.9e-98
WP_002300909.1|2133882_2134218_+	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_000997695.1|2134296_2135475_-|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_002341883.1|2135711_2136671_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002300328.1|2136829_2137306_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002289252.1|2137318_2138821_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_002289253.1|2138834_2139524_-	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_002289254.1|2139684_2140503_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002289255.1|2140732_2140963_+	resolvase	NA	NA	NA	NA	NA
WP_086953915.1|2141549_2142888_+|transposase	IS3-like element ISEnfa3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.7	2.6e-78
WP_002291912.1|2143740_2144793_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002291914.1|2144805_2145744_-	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_002298023.1|2146194_2146845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002301781.1|2146944_2147454_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	34.8	2.8e-17
WP_002331215.1|2147816_2148200_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002336652.1|2148440_2149055_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002336651.1|2149870_2150845_-	tagatose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_002336650.1|2150863_2151319_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_002336649.1|2151346_2152792_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_002331209.1|2152788_2153724_-	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_002331208.1|2153891_2154650_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002345001.1|2155144_2156344_-	MFS transporter	NA	NA	NA	NA	NA
WP_002331206.1|2156786_2157278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002331205.1|2157304_2158450_-	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	33.4	1.2e-52
WP_002336647.1|2158464_2159832_-	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_002331203.1|2159856_2160135_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002336646.1|2160153_2160612_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_002336645.1|2160623_2161244_-	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_002336644.1|2161254_2163297_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_001015311.1|2163581_2164262_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	1.5e-127
>prophage 15
NZ_CP012430	Enterococcus faecium strain ISMMS_VRE_1 chromosome, complete genome	3130373	2171098	2190116	3130373		Streptococcus_phage(85.71%)	16	NA	NA
WP_002345005.1|2171098_2173018_-	tetracycline resistance ribosomal protection protein Tet(M)	NA	A0A1S5SF82	Streptococcus_phage	96.6	0.0e+00
WP_001814923.1|2173033_2173150_-	tetracycline resistance determinant leader peptide	NA	NA	NA	NA	NA
WP_002345006.1|2173394_2174309_-	conjugal transfer protein	NA	A0A1S5SF22	Streptococcus_phage	92.1	4.7e-156
WP_002345007.1|2174323_2175325_-	lysozyme family protein	NA	A0A1S5SEZ8	Streptococcus_phage	95.5	1.3e-183
WP_002345008.1|2175321_2177505_-	membrane protein	NA	A0A1S5SF30	Streptococcus_phage	82.3	2.9e-305
WP_000331148.1|2177507_2179955_-	ATP-binding protein	NA	A0A1S5SF64	Streptococcus_phage	98.4	0.0e+00
WP_002345009.1|2179938_2180331_-	conjugal transfer protein	NA	A0A1S5SEX7	Streptococcus_phage	99.2	4.6e-68
WP_002345010.1|2180417_2180915_-	antirestriction protein ArdA	NA	A0A1S5SF25	Streptococcus_phage	97.6	1.3e-88
WP_069314689.1|2181031_2181283_-	hypothetical protein	NA	A0A1S5SEY0	Streptococcus_phage	97.1	7.3e-27
WP_002286940.1|2181358_2183269_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	29.8	7.1e-37
WP_000398284.1|2184052_2185258_-	replication initiation factor domain-containing protein	NA	A0A1S5SEX3	Streptococcus_phage	100.0	2.8e-233
WP_000813488.1|2185436_2186822_-	DNA translocase FtsK	NA	A0A1S5SFB5	Streptococcus_phage	100.0	1.1e-265
WP_000985015.1|2186850_2187237_-	YdcP family protein	NA	A0A1S5SF96	Streptococcus_phage	100.0	3.0e-64
WP_000420682.1|2187252_2187567_-	YdcP family protein	NA	A0A1S5SF38	Streptococcus_phage	100.0	5.2e-54
WP_002345011.1|2187919_2188399_-	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_002290101.1|2188826_2190116_+	trypsin-like peptidase domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	30.2	5.7e-22
>prophage 16
NZ_CP012430	Enterococcus faecium strain ISMMS_VRE_1 chromosome, complete genome	3130373	2197865	2238068	3130373	tRNA,transposase	Lysinibacillus_phage(20.0%)	36	NA	NA
WP_002297218.1|2197865_2199161_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002294157.1|2199258_2200677_-	dipeptidase PepV	NA	NA	NA	NA	NA
WP_002299303.1|2200825_2201671_+	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_002301667.1|2201674_2202115_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_002315615.1|2202164_2202359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002289316.1|2202494_2203181_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002302159.1|2203588_2204278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002341584.1|2204252_2206382_-	hydantoinase/oxoprolinase	NA	NA	NA	NA	NA
WP_080388548.1|2206429_2207326_-	citrate transporter	NA	NA	NA	NA	NA
WP_002296840.1|2207422_2208610_+|transposase	IS256-like element IS16 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.3	8.2e-92
WP_002341586.1|2208716_2209058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002289310.1|2209493_2209853_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_002289309.1|2209905_2210106_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_002293357.1|2210177_2210702_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.3	1.4e-14
WP_002300053.1|2211021_2211654_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_002300052.1|2211655_2212561_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_002352356.1|2212645_2213305_-	deoxynucleoside kinase	NA	C1KFI3	Lactobacillus_virus	51.8	5.6e-58
WP_002288231.1|2213620_2214565_+	mevalonate kinase	NA	NA	NA	NA	NA
WP_002300050.1|2214557_2215535_+	diphosphomevalonate decarboxylase	NA	NA	NA	NA	NA
WP_002288233.1|2215547_2216633_+	phosphomevalonate kinase	NA	NA	NA	NA	NA
WP_002300048.1|2216629_2217694_+	type 2 isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_033582433.1|2217942_2218746_-	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_002300046.1|2218765_2219071_-	5-dehydro-4-deoxy-D-glucuronate isomerase	NA	NA	NA	NA	NA
WP_126145175.1|2219052_2219259_-	TRAP transporter large permease subunit	NA	NA	NA	NA	NA
WP_086953915.1|2219302_2220642_-|transposase	IS3-like element ISEnfa3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.7	2.6e-78
WP_002300788.1|2221267_2221747_-	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_002288261.1|2222793_2223900_-	glycosyl hydrolase	NA	NA	NA	NA	NA
WP_002296567.1|2224128_2226726_-	bifunctional acetaldehyde-CoA/alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_002294182.1|2227030_2227411_-	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
WP_002294183.1|2227507_2228653_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	40.9	2.5e-82
WP_002296566.1|2228870_2229569_+	DUF975 family protein	NA	NA	NA	NA	NA
WP_002289743.1|2229736_2232376_-	cation-translocating P-type ATPase	NA	A0A1J0FA34	Only_Syngen_Nebraska_virus	31.2	1.6e-84
WP_002297185.1|2233017_2234313_-|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	3.8e-10
WP_002296565.1|2234516_2235548_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_002287525.1|2236498_2237647_-|transposase	transposase	transposase	A0A288TXV8	Enterococcus_phage	93.4	1.2e-204
WP_002287522.1|2237663_2238068_-|transposase	IS200/IS605-like element ISEfa4 family transposase	transposase	A0A286QN76	Streptococcus_phage	73.8	1.3e-52
>prophage 17
NZ_CP012430	Enterococcus faecium strain ISMMS_VRE_1 chromosome, complete genome	3130373	2393218	2421503	3130373	integrase,transposase	Streptococcus_phage(77.27%)	31	2390174:2390189	2406598:2406613
2390174:2390189	attL	TCGGAACTTTTCTTTG	NA	NA	NA	NA
WP_002298578.1|2393218_2394784_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	30.6	3.5e-18
WP_000237797.1|2394851_2396045_-|integrase	site-specific integrase	integrase	A0A0S2MV79	Bacillus_phage	34.2	8.3e-44
WP_000633907.1|2396071_2396272_-	DUF3173 domain-containing protein	NA	NA	NA	NA	NA
WP_000845143.1|2396769_2397000_-	helix-turn-helix domain-containing protein	NA	A0A1S5SEX1	Streptococcus_phage	78.9	1.0e-27
WP_000804879.1|2396996_2397419_-	sigma-70 family RNA polymerase sigma factor	NA	A0A1S5SEW0	Streptococcus_phage	68.6	7.5e-48
WP_001227350.1|2397949_2398303_+	helix-turn-helix domain-containing protein	NA	A0A1S5SFA6	Streptococcus_phage	89.7	2.2e-53
WP_032506803.1|2398360_2398549_-	cysteine-rich KTR domain-containing protein	NA	D0R0F6	Streptococcus_phage	61.4	7.4e-16
WP_001817446.1|2398646_2399687_-	hypothetical protein	NA	A0A1S5SF82	Streptococcus_phage	95.7	3.6e-192
WP_000868795.1|2400048_2400546_+	trimethoprim-resistant dihydrofolate reductase DfrG	NA	G3MBI7	Bacillus_virus	49.1	4.0e-40
WP_000163792.1|2400617_2402570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001159903.1|2402576_2402813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002345019.1|2403047_2403851_-	GTP-binding protein	NA	A0A1S5SF82	Streptococcus_phage	98.9	6.0e-147
WP_127836267.1|2403866_2403932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002297218.1|2404044_2405340_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_078066630.1|2405421_2405505_-	tetracycline resistance determinant leader peptide	NA	NA	NA	NA	NA
WP_000584387.1|2405749_2406679_-	conjugal transfer protein	NA	A0A1S5SF22	Streptococcus_phage	56.6	1.1e-83
2406598:2406613	attR	TCGGAACTTTTCTTTG	NA	NA	NA	NA
WP_000768373.1|2406695_2407718_-	lysozyme family protein	NA	A0A1S5SEZ8	Streptococcus_phage	75.5	2.4e-132
WP_000192393.1|2407714_2409742_-	membrane protein	NA	A0A1S5SF30	Streptococcus_phage	65.3	5.1e-195
WP_000331165.1|2409738_2412192_-	ATP-binding protein	NA	A0A1S5SF64	Streptococcus_phage	78.9	0.0e+00
WP_000723887.1|2412175_2412571_-	conjugal transfer protein	NA	A0A1S5SEX7	Streptococcus_phage	72.6	5.9e-47
WP_000248477.1|2412642_2413281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000870467.1|2413336_2413831_-	antirestriction protein ArdA	NA	A0A1S5SF25	Streptococcus_phage	63.4	2.8e-54
WP_000675717.1|2413897_2414677_-	abortive infection family protein	NA	NA	NA	NA	NA
WP_001009054.1|2414718_2414940_-	hypothetical protein	NA	A0A1S5SEY0	Streptococcus_phage	93.2	3.1e-29
WP_000055376.1|2414936_2415227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000426689.1|2415223_2416408_-	replication initiation factor domain-containing protein	NA	A0A1S5SEX3	Streptococcus_phage	68.1	6.3e-161
WP_001130244.1|2416589_2417993_-	DUF87 domain-containing protein	NA	A0A1S5SFB5	Streptococcus_phage	66.5	2.2e-176
WP_000185761.1|2418014_2418788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001234191.1|2418797_2419175_-	YdcP family protein	NA	A0A1S5SF96	Streptococcus_phage	76.4	9.6e-47
WP_000421279.1|2419195_2419510_-	YdcP family protein	NA	A0A1S5SF38	Streptococcus_phage	77.7	1.2e-42
WP_000181735.1|2419709_2421503_-	ATP-dependent helicase	NA	E3T5J8	Cafeteria_roenbergensis_virus	23.8	6.9e-26
>prophage 18
NZ_CP012430	Enterococcus faecium strain ISMMS_VRE_1 chromosome, complete genome	3130373	2539804	2568792	3130373	integrase,transposase	Bacillus_phage(50.0%)	32	2546262:2546276	2567030:2567044
WP_002346925.1|2539804_2541025_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_002320809.1|2541096_2541255_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002297292.1|2541942_2542683_+	metal ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	33.2	5.7e-19
WP_002297293.1|2542774_2543962_-|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	28.7	4.6e-26
WP_002297294.1|2544283_2545126_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_073120143.1|2545125_2546073_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002297302.1|2546087_2546321_+	iron-dependent repressor	NA	NA	NA	NA	NA
2546262:2546276	attL	TTTCAATTAACTGAT	NA	NA	NA	NA
WP_071858995.1|2546651_2547236_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002297304.1|2547366_2548035_+	cobalt transporter	NA	NA	NA	NA	NA
WP_002297306.1|2548045_2549461_+	energy-coupling factor ABC transporter ATP-binding protein	NA	A0A1V0SGN0	Hokovirus	26.4	5.8e-20
WP_002297308.1|2549478_2550048_+	MptD family putative ECF transporter S component	NA	NA	NA	NA	NA
WP_002297309.1|2550157_2551912_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	24.8	1.3e-24
WP_002321752.1|2551871_2553638_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.1	3.5e-30
WP_002297316.1|2554160_2554430_+	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_002297318.1|2554444_2554624_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_002297319.1|2554655_2555033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002297320.1|2555053_2555203_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_002304819.1|2555226_2556210_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_002322279.1|2556239_2556362_+	putative metal homeostasis protein	NA	NA	NA	NA	NA
WP_069314692.1|2556379_2557903_+	zinc ABC transporter substrate-binding protein AdcA	NA	NA	NA	NA	NA
WP_002304820.1|2557926_2558166_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002297325.1|2558358_2558820_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.0	1.5e-12
WP_002317220.1|2559014_2559233_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002297326.1|2559350_2560967_+	NusG domain II-containing protein	NA	NA	NA	NA	NA
WP_077828743.1|2562823_2562979_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_002297332.1|2563170_2563365_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_002311665.1|2563274_2563607_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002304825.1|2564120_2564312_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002297333.1|2564405_2564792_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_002297334.1|2565485_2566691_+	YSIRK-targeted surface antigen transcriptional regulator	NA	NA	NA	NA	NA
WP_002332818.1|2566707_2567142_+	hypothetical protein	NA	NA	NA	NA	NA
2567030:2567044	attR	ATCAGTTAATTGAAA	NA	NA	NA	NA
WP_084196095.1|2567493_2568792_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 19
NZ_CP012430	Enterococcus faecium strain ISMMS_VRE_1 chromosome, complete genome	3130373	2584260	2596021	3130373		Streptococcus_phage(88.89%)	10	NA	NA
WP_002297345.1|2584260_2585172_-	conjugal transfer protein	NA	A0A1S5SF22	Streptococcus_phage	44.0	2.2e-65
WP_002297346.1|2585190_2586195_-	lysozyme family protein	NA	A0A1S5SEZ8	Streptococcus_phage	63.5	5.6e-118
WP_002297347.1|2586191_2588315_-	hypothetical protein	NA	A0A1S5SF30	Streptococcus_phage	59.7	1.2e-181
WP_002297348.1|2588319_2590767_-	ATP-binding protein	NA	A0A1S5SF64	Streptococcus_phage	76.0	0.0e+00
WP_002297349.1|2590753_2591143_-	conjugal transfer protein	NA	A0A1S5SEX7	Streptococcus_phage	68.3	3.9e-43
WP_002297350.1|2591202_2591706_-	antirestriction protein ArdA	NA	A0A1S5SF25	Streptococcus_phage	59.9	9.2e-53
WP_033658092.1|2591718_2591943_-	hypothetical protein	NA	A0A1S5SEY0	Streptococcus_phage	83.8	1.2e-23
WP_002286940.1|2592046_2593957_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	29.8	7.1e-37
WP_002317225.1|2594702_2594840_-	DUF3789 domain-containing protein	NA	NA	NA	NA	NA
WP_002297353.1|2594836_2596021_-	replication initiation factor domain-containing protein	NA	A0A1S5SEX3	Streptococcus_phage	61.6	2.9e-142
>prophage 20
NZ_CP012430	Enterococcus faecium strain ISMMS_VRE_1 chromosome, complete genome	3130373	2691976	2753015	3130373	tRNA,transposase,protease	Lysinibacillus_phage(14.29%)	41	NA	NA
WP_002296127.1|2691976_2693524_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_002340542.1|2693933_2694548_+	guanylate kinase	NA	A0A143DIC6	Abalone_herpesvirus	34.6	1.3e-24
WP_002287365.1|2694552_2694858_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_002287367.1|2695110_2697519_+	primosomal protein N'	NA	NA	NA	NA	NA
WP_002287369.1|2697533_2698025_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	43.2	7.9e-17
WP_002287374.1|2698954_2700313_+	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_002287376.1|2700325_2701066_+	Stp1/IreP family PP2C-type Ser/Thr phosphatase	NA	NA	NA	NA	NA
WP_002287377.1|2701062_2703132_+	Stk1 family PASTA domain-containing Ser/Thr kinase	NA	A0A1V0SDC3	Indivirus	30.3	3.5e-21
WP_002287379.1|2703296_2704196_+	ribosome small subunit-dependent GTPase A	NA	NA	NA	NA	NA
WP_002287380.1|2704208_2704859_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_002287382.1|2704859_2705498_+	thiamine diphosphokinase	NA	NA	NA	NA	NA
WP_002296044.1|2705652_2706507_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_002287385.1|2706510_2707020_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_002287386.1|2707274_2708849_+	C40 family peptidase	NA	B5LJD6	Mycobacterium_phage	50.5	2.3e-17
WP_002297218.1|2709010_2710306_-|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_069314695.1|2710432_2712238_-	M3 family oligoendopeptidase	NA	NA	NA	NA	NA
WP_002287389.1|2712360_2712867_+	VanZ family protein	NA	NA	NA	NA	NA
WP_002287391.1|2712945_2713668_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_002287397.1|2713745_2715146_-	peptidoglycan binding domain-containing protein	NA	NA	NA	NA	NA
WP_002287399.1|2715315_2716290_-	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_002287401.1|2716642_2717203_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_002287403.1|2717219_2720741_+	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_002287405.1|2720755_2722351_+	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_002287407.1|2722361_2722631_+	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_002287409.1|2722697_2723123_+	septum formation initiator family protein	NA	NA	NA	NA	NA
WP_002287412.1|2723168_2723639_+	RNA-binding protein S1	NA	NA	NA	NA	NA
WP_002287414.1|2723758_2725204_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	E3T4I1	Cafeteria_roenbergensis_virus	24.5	6.8e-08
WP_002287415.1|2725203_2725749_+	hypoxanthine phosphoribosyltransferase	NA	A0A1V0SEQ1	Hokovirus	25.3	4.1e-06
WP_002287418.1|2725838_2727950_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	C7U047	Ostreococcus_tauri_virus	50.3	9.1e-110
WP_002296053.1|2728166_2729054_+	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_002290055.1|2729054_2730059_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_002301217.1|2730169_2731666_+|tRNA	lysine--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	40.9	6.7e-91
WP_002326809.1|2731775_2733071_-|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	5.0e-10
WP_002289731.1|2741497_2742691_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	72.0	1.3e-150
WP_002295566.1|2742820_2744293_+	MFS transporter	NA	NA	NA	NA	NA
WP_002295567.1|2744375_2745164_+	esterase family protein	NA	NA	NA	NA	NA
WP_002285876.1|2745230_2745899_-	TetR/AcrR family transcriptional regulator C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_002285883.1|2746013_2747726_+	ABC transporter ATP-binding protein	NA	F2Y302	Organic_Lake_phycodnavirus	25.4	1.2e-14
WP_002301355.1|2747728_2749501_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.4	1.2e-54
WP_086953915.1|2749626_2750965_+|transposase	IS3-like element ISEnfa3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.7	2.6e-78
WP_010729461.1|2751836_2753015_-|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
>prophage 21
NZ_CP012430	Enterococcus faecium strain ISMMS_VRE_1 chromosome, complete genome	3130373	2900880	2950392	3130373	bacteriocin,tRNA,transposase	Bacillus_virus(20.0%)	52	NA	NA
WP_002296623.1|2900880_2902176_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	37.5	3.9e-55
WP_002289850.1|2902265_2902943_-	DsbA family protein	NA	NA	NA	NA	NA
WP_002289849.1|2903060_2903636_-	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_002289848.1|2903766_2904471_+	GTP pyrophosphokinase family protein	NA	NA	NA	NA	NA
WP_002289847.1|2904448_2905246_+	NAD kinase	NA	NA	NA	NA	NA
WP_002294562.1|2905247_2906147_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_002294561.1|2906164_2907526_+	magnesium transporter	NA	NA	NA	NA	NA
WP_002294560.1|2907587_2908229_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_002294559.1|2908337_2909204_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_002289592.1|2909424_2909928_+|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_002289593.1|2909976_2910636_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_002289594.1|2910655_2913244_+	ATP-dependent RecD-like DNA helicase	NA	A0A218KCE8	Bacillus_phage	29.2	8.6e-62
WP_002289596.1|2913345_2913573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002289597.1|2913682_2914312_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_002289599.1|2914308_2915388_-	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_002324227.1|2915504_2916437_+	ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	33.2	5.9e-21
WP_002294551.1|2916450_2917596_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002296167.1|2917582_2918755_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002294549.1|2918853_2919819_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_002294548.1|2920415_2920919_+	QueT transporter family protein	NA	E7DN70	Pneumococcus_phage	34.3	3.4e-07
WP_002294577.1|2920974_2921619_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_002294578.1|2921780_2921933_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_002294579.1|2921956_2922127_+	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_002294580.1|2922227_2922773_+	transcription termination/antitermination protein NusG	NA	NA	NA	NA	NA
WP_002289897.1|2922831_2923737_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_002294583.1|2923909_2924929_+	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_002294584.1|2925019_2925892_-	L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha	NA	NA	NA	NA	NA
WP_002294585.1|2925904_2926573_-	L-serine ammonia-lyase, iron-sulfur-dependent, subunit beta	NA	NA	NA	NA	NA
WP_002291638.1|2926915_2927338_+	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_002294587.1|2927441_2928131_+	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_002291634.1|2928540_2929044_+	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_002294588.1|2929096_2929465_+	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_002296327.1|2929570_2930260_+	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_002320938.1|2930341_2931391_+	MFS transporter	NA	NA	NA	NA	NA
WP_002295743.1|2931484_2932393_+|transposase	IS982-like element ISEfm1 family transposase	transposase	NA	NA	NA	NA
WP_002290558.1|2932782_2934315_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	28.0	3.3e-45
WP_002287787.1|2934548_2935250_+	glucosamine-6-phosphate deaminase	NA	NA	NA	NA	NA
WP_002287788.1|2935503_2936217_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	43.7	6.5e-20
WP_002287791.1|2936525_2937665_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_002287792.1|2937753_2938719_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A096XT60	Enterococcus_phage	70.4	3.4e-128
WP_002287793.1|2938768_2940928_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	63.2	3.8e-265
WP_002287795.1|2941086_2941311_-	glutaredoxin-like protein NrdH	NA	A0A0M7REK7	Lactobacillus_phage	42.7	1.7e-11
WP_002287797.1|2941711_2942185_+	ferrous iron transport protein A	NA	NA	NA	NA	NA
WP_002287799.1|2942181_2944314_+	ferrous iron transport protein B	NA	NA	NA	NA	NA
WP_002290587.1|2944315_2944450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002287801.1|2944543_2945188_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002287805.1|2945374_2946568_+	glycine betaine/L-proline ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.0	1.2e-29
WP_002287807.1|2946560_2948288_+	ABC transporter permease/substrate binding protein	NA	NA	NA	NA	NA
WP_002304799.1|2948681_2948879_+|bacteriocin	leucocin A/sakacin P family class II bacteriocin	bacteriocin	NA	NA	NA	NA
WP_002287810.1|2948880_2949192_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_002321654.1|2949295_2949442_+|bacteriocin	EntF family bacteriocin induction factor	bacteriocin	NA	NA	NA	NA
WP_000222572.1|2949438_2950392_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP012432	Enterococcus faecium strain ISMMS_VRE_1 plasmid ISMMS_VRE_p1, complete sequence	57543	20664	28335	57543	transposase	Temperate_phage(16.67%)	12	NA	NA
WP_002321302.1|20664_21138_+	single-stranded DNA-binding protein	NA	Q938M7	Temperate_phage	62.0	5.6e-44
WP_002321303.1|21503_21764_+	hypothetical protein	NA	A0A0S2MYI8	Enterococcus_phage	51.4	3.4e-11
WP_002296239.1|22208_22415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305766.1|22414_22666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305764.1|22681_23098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002348912.1|23079_23352_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305759.1|23518_23920_+|transposase	IS200/IS605 family transposase	transposase	A0A1P8BMC0	Lactococcus_phage	43.1	1.4e-24
WP_002305757.1|23931_25077_+|transposase	transposase	transposase	D9J0Y9	Brochothrix_phage	74.6	7.7e-164
WP_002287514.1|25314_25578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002321032.1|25571_25922_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_002318230.1|25945_26560_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	31.9	2.6e-17
WP_002348911.1|27009_28335_+	Y-family DNA polymerase	NA	M1Q231	Streptococcus_phage	43.6	1.2e-99
>prophage 1
NZ_CP012431	Enterococcus faecium strain ISMMS_VRE_1 plasmid ISMMS_VRE_p2, complete sequence	44226	20056	34172	44226	transposase	Streptococcus_phage(75.0%)	14	NA	NA
WP_001059542.1|20056_21025_-	D-lactate dehydrogenase VanH-A	NA	M1HUW8	Acanthocystis_turfacea_Chlorella_virus	33.1	3.5e-40
WP_000122610.1|21356_22649_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	38.9	3.2e-57
WP_002305818.1|22746_23901_-	VanA-type vancomycin resistance histidine kinase VanS	NA	W8CYF6	Bacillus_phage	23.3	1.5e-13
WP_001280781.1|23878_24574_-	VanA-type vancomycin resistance DNA-binding response regulator VanR	NA	W8CYM9	Bacillus_phage	37.7	4.9e-36
WP_001015311.1|25280_25961_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	1.5e-127
WP_002321977.1|25990_26533_-	HTH domain-containing protein	NA	A0A1B0RXM1	Streptococcus_phage	98.3	2.4e-91
WP_001096887.1|26808_27603_-	aminoglycoside O-phosphotransferase APH(3')-IIIa	NA	E4ZFP6	Streptococcus_phage	100.0	2.3e-154
WP_001255866.1|28233_29142_-	aminoglycoside nucleotidyltransferase ANT(6)-Ia	NA	E4ZFP8	Streptococcus_phage	100.0	2.8e-177
WP_000662263.1|29174_29909_-	class I SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	100.0	1.5e-141
WP_000228166.1|29889_30759_-	nucleotidyltransferase domain-containing protein	NA	A0A1X9I6C9	Streptococcus_phage	95.8	4.3e-159
WP_000567888.1|30861_31107_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_001038792.1|32400_33138_-	23S rRNA (adenine(2058)-N(6))-methyltransferase Erm(B)	NA	E4ZFQ0	Streptococcus_phage	99.2	7.0e-134
WP_001814874.1|33262_33346_-	23S rRNA methyltransferase attenuation leader peptide	NA	NA	NA	NA	NA
WP_002343844.1|33491_34172_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	98.7	6.5e-126
