The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP013673	Bifidobacterium longum strain 35624, complete genome	2264056	53044	127820	2264056	integrase,protease,tRNA	uncultured_Mediterranean_phage(18.18%)	59	124468:124527	127853:127944
WP_007054545.1|53044_53890_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_059280526.1|54558_55029_-	cell division protein CrgA	NA	NA	NA	NA	NA
WP_058102064.1|55118_55910_+	DUF881 domain-containing protein	NA	NA	NA	NA	NA
WP_012472056.1|55906_57145_+	class E sortase	NA	NA	NA	NA	NA
WP_058102065.1|57195_57840_+	anthranilate synthase	NA	A0A0P0IKJ1	Acinetobacter_phage	38.4	1.1e-31
WP_008783610.1|58063_60136_-	Stk1 family PASTA domain-containing Ser/Thr kinase	NA	L7RGQ5	Acanthamoeba_polyphaga_moumouvirus	33.8	6.8e-17
WP_007055935.1|60132_61083_-	serine/threonine protein kinase	NA	T2AWK4	Cannes_8_virus	30.7	7.4e-19
WP_007051711.1|61079_62546_-	penicillin-binding protein	NA	NA	NA	NA	NA
WP_058102066.1|62542_64204_-	cell division protein FtsW	NA	NA	NA	NA	NA
WP_069293970.1|64200_65895_-	phosphoprotein phosphatase	NA	NA	NA	NA	NA
WP_007055932.1|65899_66430_-	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_007051707.1|66459_67161_-	DUF3662 domain-containing protein	NA	NA	NA	NA	NA
WP_007051706.1|67345_69790_-	prolyl oligopeptidase family serine peptidase	NA	NA	NA	NA	NA
WP_023657990.1|69908_71000_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_080504133.1|71079_72231_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_058102068.1|72230_72950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007055918.1|72946_73351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155520183.1|73332_73500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012472055.1|73462_73657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007056809.1|73872_74727_+	toxic anion resistance protein	NA	A0A1S6UAV6	Serratia_phage	28.1	3.0e-19
WP_007055906.1|75107_75611_+	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_058102069.1|75937_76894_+	drug/metabolite DMT transporter permease	NA	NA	NA	NA	NA
WP_011068559.1|77061_77514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077384255.1|78364_79135_+	prolyl oligopeptidase family serine peptidase	NA	NA	NA	NA	NA
WP_058102070.1|79131_81705_+	DUF2156 domain-containing protein	NA	NA	NA	NA	NA
WP_077384246.1|81859_82108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007051692.1|82231_83215_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_100209035.1|83502_86697_-	DEAD/DEAH box helicase	NA	U3PFS7	Lactobacillus_phage	27.9	2.0e-20
WP_007055916.1|86781_87195_-	(deoxy)nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_007051681.1|88257_88590_+	putative heavy metal-binding protein	NA	NA	NA	NA	NA
WP_058102071.1|88677_89142_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_012472051.1|89222_90080_-	hemolysin III family protein	NA	NA	NA	NA	NA
WP_007054515.1|90183_90420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007051677.1|90479_90845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058102072.1|91325_92639_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	32.7	6.3e-53
WP_058102073.1|93055_95068_+|protease	trypsin-like serine protease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.0	1.2e-18
WP_032741283.1|95479_97639_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	25.8	2.7e-45
WP_050491744.1|97815_98865_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_013410463.1|98870_99131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015512529.1|99132_100164_-	twin-arginine translocase subunit TatC	NA	NA	NA	NA	NA
WP_013410461.1|100211_100502_-	twin-arginine translocase TatA/TatE family subunit	NA	NA	NA	NA	NA
WP_013410459.1|101181_103584_+	glycosyhydrolase	NA	NA	NA	NA	NA
WP_015512528.1|103673_106154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100967826.1|106543_107707_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_007057726.1|107910_109362_+	glutamate synthase	NA	NA	NA	NA	NA
WP_007055925.1|109514_110453_+|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_058102074.1|110663_111731_-	class II fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_007051668.1|111946_113233_+	adenylosuccinate synthase	NA	A0A285PX35	Cedratvirus	35.0	5.8e-67
WP_007054506.1|113256_114840_+	ClC family H(+)/Cl(-) exchange transporter	NA	NA	NA	NA	NA
WP_015713216.1|114867_116097_+	CrcB family protein	NA	NA	NA	NA	NA
WP_080669909.1|115397_116492_+	CrcB family protein	NA	NA	NA	NA	NA
WP_010081389.1|116766_117852_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_081040142.1|118051_119845_+	potassium transporter Kup	NA	A7J6G4	Paramecium_bursaria_Chlorella_virus	33.4	3.6e-43
WP_007051661.1|120261_121809_+	alpha-L-arabinofuranosidase	NA	NA	NA	NA	NA
WP_058062454.1|121980_123015_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_010081385.1|123100_124108_-	hypothetical protein	NA	NA	NA	NA	NA
124468:124527	attL	GATTAAGCCGGGTTTGTTGTTAAGCCGGGGAACGGTTCGGGGTCTTGGTGGCTGGCCGTG	NA	NA	NA	NA
WP_007053137.1|124603_125806_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_069293971.1|125802_126768_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_007054866.1|126764_127820_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0U4IH55	Gordonia_phage	26.7	1.0e-05
127853:127944	attR	CACGGCCAGCCACCAAGACCCCGAACCGTTCCCCGGCTTAACAACAAACCCGGCTTAATCGGAATGGATGATTGGATGTTCCCCGTCCCTGA	NA	NA	NA	NA
>prophage 2
NZ_CP013673	Bifidobacterium longum strain 35624, complete genome	2264056	734032	800477	2264056	transposase,integrase,tRNA	Mycobacterium_phage(15.38%)	55	794842:794901	798227:798322
WP_058101910.1|734032_734632_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_058101909.1|734621_738206_+	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_081040168.1|738345_739293_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_007051126.1|739443_740742_+	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	56.2	1.4e-132
WP_075662294.1|740808_741426_+	septum formation initiator family protein	NA	NA	NA	NA	NA
WP_058101906.1|741422_741989_+	DUF501 domain-containing protein	NA	NA	NA	NA	NA
WP_007051123.1|742051_743053_+	Ppx/GppA family phosphatase	NA	NA	NA	NA	NA
WP_008783747.1|743442_744714_+|transposase	IS30-like element ISBlo4 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.9	3.5e-40
WP_011068251.1|744845_747065_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_007051894.1|747206_747614_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_007055115.1|747712_748192_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_007051896.1|748246_749158_-	hemolysin III	NA	NA	NA	NA	NA
WP_081040154.1|749360_750089_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_011068248.1|750206_751739_+	PAS domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_003835265.1|751811_752090_-	WhiB family transcriptional regulator	NA	A0A2P1N2X5	Mycobacterium_phage	45.1	1.3e-11
WP_081040153.1|752203_753955_-	cell division protein FtsK	NA	A0A142F150	Bacillus_phage	31.8	2.0e-14
WP_021975633.1|754199_755633_-	LCP family protein	NA	NA	NA	NA	NA
WP_007051901.1|755883_756183_+	WhiB family transcriptional regulator	NA	A0A2P1CGA4	Mycobacterium_phage	68.1	4.1e-24
WP_058101824.1|756226_759322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007053571.1|759318_760860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007051904.1|760962_761424_-	metallopeptidase family protein	NA	NA	NA	NA	NA
WP_058101823.1|761479_762286_+	HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_080746348.1|762400_763018_+	ComF family protein	NA	NA	NA	NA	NA
WP_007051907.1|762933_763320_-	S24 family peptidase	NA	F1C5A6	Cronobacter_phage	40.8	2.1e-09
WP_007051908.1|763387_764464_-	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	27.5	7.6e-12
WP_007051909.1|764460_765183_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.2	1.7e-28
WP_008782797.1|765218_767471_-	1,4-alpha-glucan branching protein GlgB	NA	NA	NA	NA	NA
WP_007053566.1|767648_768242_+	CarD family transcriptional regulator	NA	NA	NA	NA	NA
WP_007053565.1|768350_768875_+	2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase	NA	NA	NA	NA	NA
WP_007051913.1|768926_769760_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_074709717.1|769826_770813_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.7	1.1e-17
WP_023658186.1|770889_772086_-	Solute-binding protein of ABC transporter system for metals	NA	NA	NA	NA	NA
WP_007053562.1|772189_773065_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	NA	NA	NA	NA
WP_007051917.1|773184_774660_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_007055464.1|774833_775451_+	dephospho-CoA kinase	NA	NA	NA	NA	NA
WP_007051919.1|775462_777574_+	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_007051920.1|777742_778729_+	TerC family protein	NA	A0A291LBC5	Escherichia_phage	34.4	1.6e-37
WP_007055467.1|778896_780339_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_011068238.1|780486_781248_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_007052013.1|781431_782217_+	response regulator	NA	NA	NA	NA	NA
WP_058101822.1|782262_785130_+	DNA polymerase I	NA	A0A0C5K9B9	Enterococcus_phage	28.9	3.3e-38
WP_074709723.1|785290_786220_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_012578040.1|786265_786940_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_011068234.1|786993_789135_+	glycogen debranching protein GlgX	NA	NA	NA	NA	NA
WP_058101821.1|789185_789416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058101820.1|789419_790070_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_058101819.1|790239_790794_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_155759152.1|791411_791648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058062546.1|791880_792942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058101817.1|793225_793783_+	hypothetical protein	NA	NA	NA	NA	NA
794842:794901	attL	GATTAAGCCGGGTTTGTTGTTAAGCCGGGGAACGGTTCGGGGTCTTGGTGGCTGGCCGTG	NA	NA	NA	NA
WP_007054866.1|794933_795989_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0U4IH55	Gordonia_phage	26.7	1.0e-05
WP_007053138.1|795985_796951_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_058102001.1|796947_798150_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_116868981.1|798280_799297_-|transposase	IS3 family transposase	transposase	A0A1B3AZE5	Gordonia_phage	30.8	2.3e-10
798227:798322	attR	CACGGCCAGCCACCAAGACCCCGAACCGTTCCCCGGCTTAACAACAAACCCGGCTTAATCCGAGTGGATGATCGGCGTCTCGCCGGGCCTGGGCGT	NA	NA	NA	NA
WP_014485511.1|799631_800477_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP013673	Bifidobacterium longum strain 35624, complete genome	2264056	2227736	2237595	2264056		Mycobacterium_phage(33.33%)	10	NA	NA
WP_007051809.1|2227736_2228864_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	33.8	2.9e-22
WP_080670006.1|2229222_2230404_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_007054635.1|2230482_2231475_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	77.6	4.7e-141
WP_058102048.1|2231700_2233896_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	47.4	1.6e-186
WP_007051804.1|2234011_2234419_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	R4JF54	Bacillus_phage	30.8	1.0e-09
WP_007054638.1|2234466_2234781_-	glutaredoxin family protein	NA	V5R9U9	Mycobacterium_phage	41.8	6.0e-10
WP_011068608.1|2234881_2235124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007056537.1|2235320_2235944_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_015713953.1|2235954_2236635_-	DUF3990 domain-containing protein	NA	NA	NA	NA	NA
WP_058102049.1|2236827_2237595_+	voltage-gated potassium channel	NA	A0A2I7SA68	Vibrio_phage	27.2	4.9e-05
