The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP013420	Burkholderia ubonensis strain MSMB0783 chromosome 1, complete sequence	3268347	859102	951395	3268347	tRNA,head,terminase,tail,protease,portal,capsid,holin	Burkholderia_virus(28.57%)	101	NA	NA
WP_069239392.1|859102_861034_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_010092449.1|861388_862693_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	28.6	3.7e-45
WP_010092450.1|862926_864606_-	SpoVR family protein	NA	NA	NA	NA	NA
WP_010092451.1|864602_865871_-	YeaH/YhbH family protein	NA	A0A219UQP6	Bacillus_phage	37.2	2.4e-09
WP_010092452.1|865995_867918_-	PrkA family serine protein kinase	NA	NA	NA	NA	NA
WP_069239393.1|868446_870240_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	32.3	3.4e-09
WP_060238819.1|870433_871375_-	ribokinase	NA	NA	NA	NA	NA
WP_060238823.1|871371_872403_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	31.5	1.8e-34
WP_060238826.1|872470_873490_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_060238828.1|873486_875091_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.3	1.1e-11
WP_010092460.1|875235_876186_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_060238830.1|876537_877464_-	CysB family HTH-type transcriptional regulator	NA	NA	NA	NA	NA
WP_060238832.1|877539_878595_-	sulfate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.1	1.1e-28
WP_060238836.1|878608_879556_-	sulfate ABC transporter permease subunit CysW	NA	NA	NA	NA	NA
WP_042583970.1|879552_880458_-	sulfate ABC transporter permease subunit CysT	NA	NA	NA	NA	NA
WP_010092465.1|880548_881586_-	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010092466.1|881870_882518_+	transcriptional repressor LexA	NA	A0A2H4JG58	uncultured_Caudovirales_phage	50.0	3.6e-09
WP_010092467.1|882544_882880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069238768.1|882909_883617_+	DUF2939 domain-containing protein	NA	NA	NA	NA	NA
WP_069238769.1|883728_884226_-	universal stress protein	NA	NA	NA	NA	NA
WP_060238840.1|884579_885494_+	nodulation factor ABC transporter ATP-binding protein NodI	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	28.0	7.1e-27
WP_060238843.1|885500_886334_+	nodulation protein NodJ	NA	NA	NA	NA	NA
WP_088580180.1|886382_886868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060238848.1|886957_888016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069238770.1|888012_889152_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_060237313.1|889655_890708_-	NADP(H)-dependent aldo-keto reductase	NA	NA	NA	NA	NA
WP_069238772.1|890943_891567_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	35.0	1.0e-16
WP_046427098.1|891727_891943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011884713.1|892171_893143_+	sensor domain-containing diguanylate cyclase	NA	NA	NA	NA	NA
WP_069238773.1|893244_893718_-	VOC family protein	NA	A0A2K9L1J4	Tupanvirus	37.4	1.8e-18
WP_011884709.1|893988_894297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014722976.1|894417_895161_+	DUF695 domain-containing protein	NA	NA	NA	NA	NA
WP_011884706.1|895773_896238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034193189.1|896317_897757_-	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_080484218.1|898215_899133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080484219.1|899906_900731_+	TIR domain-containing protein	NA	K7PLZ9	Enterobacterial_phage	58.4	2.1e-62
WP_069238774.1|900762_901449_-	hypothetical protein	NA	Q8W6R8	Burkholderia_virus	74.3	4.7e-100
WP_059461727.1|901527_901782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069238775.1|901878_902697_-	hypothetical protein	NA	Q3HQV2	Burkholderia_phage	42.8	8.0e-46
WP_069238776.1|902829_903318_-	DUF2514 family protein	NA	Q3HQV1	Burkholderia_phage	75.9	7.8e-57
WP_069238777.1|903317_903815_-	lysozyme	NA	Q3HQU9	Burkholderia_phage	83.6	2.2e-75
WP_034193187.1|903807_904020_-|holin	holin	holin	Q3HQU8	Burkholderia_phage	65.7	2.0e-17
WP_080484221.1|904061_904778_-	hypothetical protein	NA	C7BGD6	Burkholderia_phage	65.5	7.9e-90
WP_069238778.1|905088_908481_-|tail	phage tail protein	tail	A4JX16	Burkholderia_virus	64.3	0.0e+00
WP_069238779.1|908482_909058_-|tail	tail assembly protein	tail	Q6JIL3	Burkholderia_virus	68.7	7.2e-70
WP_059694696.1|909061_909805_-	C40 family peptidase	NA	A4JX14	Burkholderia_virus	72.1	3.3e-107
WP_059694698.1|909851_910532_-|tail	phage minor tail protein L	tail	Q6JIL5	Burkholderia_virus	73.6	1.6e-95
WP_080484223.1|910528_912019_-|tail	tail fiber domain-containing protein	tail	NA	NA	NA	NA
WP_069238781.1|912015_912357_-|tail	phage tail protein	tail	C7BGC9	Burkholderia_phage	57.3	5.7e-30
WP_155121855.1|912357_915201_-|tail	phage tail tape measure protein	tail	Q6JIL8	Burkholderia_virus	34.6	3.9e-55
WP_080484224.1|915193_915634_-	hypothetical protein	NA	A0A1W6JP15	Morganella_phage	32.2	6.4e-10
WP_155121856.1|915626_915806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034193080.1|915919_916342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034193184.1|916381_917020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051974404.1|917065_917467_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_051974403.1|917459_917792_-|head	phage head closure protein	head	NA	NA	NA	NA
WP_069238783.1|917788_918463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034193077.1|918466_918745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059461710.1|918808_920065_-|capsid	phage major capsid protein	capsid	C7BGH0	Burkholderia_phage	53.4	4.0e-105
WP_069238784.1|920159_920906_-|protease	Clp protease ClpP	protease	C7BGG9	Burkholderia_phage	55.3	1.2e-48
WP_059568126.1|920899_922258_-|portal	phage portal protein	portal	Q6JIM9	Burkholderia_virus	36.3	1.7e-53
WP_059723478.1|922254_923910_-|terminase	terminase large subunit	terminase	A0A0P0ZEI4	Stx2-converting_phage	71.6	1.5e-232
WP_069238785.1|923913_924396_-|terminase	terminase small subunit	terminase	Q3HQS6	Burkholderia_phage	61.0	4.4e-36
WP_080484318.1|924509_924770_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_069238787.1|924851_925199_-	hypothetical protein	NA	A2I2Y8	Vibrio_virus	63.2	5.8e-30
WP_059461704.1|925305_925884_-	hypothetical protein	NA	Q3HR05	Burkholderia_phage	35.4	3.1e-20
WP_034193070.1|925938_926184_-	hypothetical protein	NA	Q3HR04	Burkholderia_phage	46.9	8.5e-12
WP_131929091.1|926180_926495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069239395.1|926479_926917_-	DUF1364 family protein	NA	Q6JIF7	Burkholderia_virus	81.6	5.0e-63
WP_059461701.1|926949_927204_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069238788.1|927200_927557_-	DUF4406 domain-containing protein	NA	H2BD42	Pseudomonas_phage	53.8	4.7e-27
WP_059495995.1|927553_927901_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155121907.1|927900_928260_-	DUF1064 domain-containing protein	NA	A4JX56	Burkholderia_virus	57.7	7.3e-28
WP_069239396.1|928460_929453_-	helix-turn-helix domain-containing protein	NA	Q8W6P0	Burkholderia_virus	67.1	4.4e-107
WP_069238791.1|929464_930286_-	hypothetical protein	NA	Q6JIG3	Burkholderia_virus	56.2	2.7e-70
WP_155121857.1|930296_930473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069238792.1|930469_931165_-	hypothetical protein	NA	A0A1V1FD44	Vibrio_phage	43.6	3.8e-41
WP_034193061.1|931165_931612_-	hypothetical protein	NA	Q3HQZ3	Burkholderia_phage	77.7	5.1e-63
WP_155121858.1|931743_931911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069246224.1|931912_932143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_131929090.1|932369_932639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081335133.1|933084_933900_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_069239398.1|934172_934676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069238795.1|934998_935265_+	acyl carrier protein	NA	A0A1P8VVJ5	Erythrobacter_phage	37.9	2.2e-05
WP_069238798.1|938612_939143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155121859.1|939163_939403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059723449.1|939438_940146_+	hypothetical protein	NA	A0A0U1SZL2	Pseudomonas_phage	44.3	7.1e-35
WP_155121860.1|940058_940391_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_069238800.1|940387_941509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080484227.1|941787_942807_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_069238801.1|942895_943150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010091415.1|943193_943391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006400187.1|943530_943746_-	transporter	NA	NA	NA	NA	NA
WP_069238802.1|943801_944758_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	37.0	3.0e-28
WP_060001454.1|944754_945564_-	aliphatic sulfonate ABC transporter permease SsuC	NA	NA	NA	NA	NA
WP_069239399.1|947081_947510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069238803.1|947629_948772_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_010092483.1|948801_949140_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_060237339.1|949143_949641_-	heme-degrading domain-containing protein	NA	NA	NA	NA	NA
WP_010092485.1|950075_950621_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_010092486.1|950630_951395_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
>prophage 2
NZ_CP013420	Burkholderia ubonensis strain MSMB0783 chromosome 1, complete sequence	3268347	1775491	1784515	3268347		unidentified_phage(16.67%)	7	NA	NA
WP_060236159.1|1775491_1777012_+	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	33.3	2.5e-24
WP_060236161.1|1777045_1777591_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_060236163.1|1777587_1778274_+	deoxynucleoside kinase	NA	A0A0M3UL55	Enterococcus_phage	23.7	8.8e-06
WP_042583171.1|1778315_1779131_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	30.5	2.8e-35
WP_069239021.1|1779275_1781171_-	aminodeoxychorismate synthase component I	NA	S4VT78	Pandoravirus	36.6	3.2e-58
WP_010091447.1|1781175_1782309_-	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	38.2	1.1e-24
WP_069239022.1|1782565_1784515_-	molecular chaperone DnaK	NA	A0A1V0SH73	Hokovirus	50.5	1.1e-146
>prophage 3
NZ_CP013420	Burkholderia ubonensis strain MSMB0783 chromosome 1, complete sequence	3268347	2026294	2086857	3268347	transposase,plate,tRNA	Acinetobacter_phage(28.57%)	47	NA	NA
WP_060232647.1|2026294_2027593_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_059477809.1|2027674_2028757_+	peptide chain release factor 1	NA	A0A0S4KWG0	Pseudomonas_phage	44.8	8.7e-08
WP_060232650.1|2028767_2029610_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_010092833.1|2029687_2029999_+	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_060232652.1|2030012_2030609_+	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_060232655.1|2030742_2031534_+	dioxygenase	NA	NA	NA	NA	NA
WP_060232658.1|2031643_2033242_-	APC family permease	NA	NA	NA	NA	NA
WP_006400508.1|2033664_2033868_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	71.6	1.4e-20
WP_060232661.1|2033941_2035192_-	Hsp70 family protein	NA	NA	NA	NA	NA
WP_042583007.1|2035472_2036078_-	nitroreductase family protein	NA	NA	NA	NA	NA
WP_010092839.1|2036224_2037508_-	MFS transporter	NA	NA	NA	NA	NA
WP_059931714.1|2037728_2038349_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_060232664.1|2038434_2039016_+	DUF1415 domain-containing protein	NA	NA	NA	NA	NA
WP_059555435.1|2039064_2039943_-	methyltransferase	NA	NA	NA	NA	NA
WP_060232667.1|2040035_2041169_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_069239066.1|2041267_2041762_-	Water stress and hypersensitive response domain-containing protein	NA	NA	NA	NA	NA
WP_069239067.1|2042405_2044571_+	peptidase M1	NA	A0A0P0IY26	Acinetobacter_phage	25.7	8.6e-47
WP_029226619.1|2044687_2045704_-	transporter	NA	NA	NA	NA	NA
WP_060232672.1|2045902_2046874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060232674.1|2046997_2047843_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_069239068.1|2048145_2052060_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_010092853.1|2052056_2053049_+	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_088508897.1|2053098_2054001_+	OmpA family protein	NA	NA	NA	NA	NA
WP_045578564.1|2054142_2054718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069239069.1|2054917_2056039_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_069239070.1|2056094_2058770_-	type VI secretion system ATPase TssH	NA	A0A223W0B1	Agrobacterium_phage	31.7	6.5e-89
WP_069239071.1|2058808_2059909_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_010096523.1|2059872_2061708_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_010096524.1|2061773_2062259_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_010096526.1|2062321_2062825_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_010096528.1|2062893_2064384_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_060232690.1|2064399_2064915_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_069239072.1|2064967_2065600_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_010099666.1|2065976_2066588_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_010099665.1|2066690_2068037_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_069239073.1|2068033_2068813_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_069239074.1|2068905_2069223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059606722.1|2069956_2071192_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_011883097.1|2072544_2072874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059460809.1|2073414_2073840_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_080484274.1|2073836_2078456_-	sugar-binding protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	43.5	7.4e-40
WP_069239076.1|2078506_2081686_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	27.0	2.4e-61
WP_124259952.1|2081684_2081975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045566772.1|2082000_2082801_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_155121888.1|2083138_2083825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069239078.1|2084660_2085011_-	methylmalonyl-CoA epimerase	NA	NA	NA	NA	NA
WP_155121863.1|2085682_2086857_-|transposase	IS3-like element ISBvi4 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	48.9	6.9e-75
>prophage 4
NZ_CP013420	Burkholderia ubonensis strain MSMB0783 chromosome 1, complete sequence	3268347	2863522	2907213	3268347	transposase,integrase,protease,tRNA	Acinetobacter_phage(15.38%)	36	2883821:2883837	2920925:2920941
WP_010090652.1|2863522_2864125_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_060235991.1|2864235_2864841_-	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_059888343.1|2865002_2865965_-	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	34.6	5.3e-41
WP_060235993.1|2866138_2867020_-	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_060235995.1|2867051_2867669_-	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_069239270.1|2869587_2870421_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	NA	NA	NA	NA
WP_060235999.1|2870446_2871553_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_069239271.1|2871580_2872222_-|protease	ATP-dependent protease	protease	NA	NA	NA	NA
WP_010090663.1|2872248_2873157_-	RNase adapter RapZ	NA	A0A1P8D5W0	Corynebacterium_phage	32.5	5.2e-06
WP_010090664.1|2873241_2874210_-	HPr kinase/phosphorylase	NA	NA	NA	NA	NA
WP_029226338.1|2874346_2874859_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_010090666.1|2875053_2875422_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_060236000.1|2875580_2877086_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_010090668.1|2877251_2878028_-	LPS export ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	30.1	1.3e-18
WP_060236002.1|2878024_2878690_-	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_010090670.1|2878710_2879325_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_042586336.1|2879328_2879865_-	HAD family hydrolase	NA	E3T535	Cafeteria_roenbergensis_virus	28.7	1.2e-10
WP_010090672.1|2879864_2880848_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	37.5	5.8e-43
WP_060236055.1|2880974_2882981_+	potassium transporter	NA	NA	NA	NA	NA
WP_010090674.1|2883057_2883624_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	41.1	1.5e-27
WP_060236004.1|2883650_2884265_+	LysE family translocator	NA	NA	NA	NA	NA
2883821:2883837	attL	CGGCGTCGCGGCGGTGC	NA	NA	NA	NA
WP_069239272.1|2884270_2885128_+	DUF4743 domain-containing protein	NA	NA	NA	NA	NA
WP_060236007.1|2885203_2886088_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	33.9	2.8e-12
WP_155121911.1|2886189_2887224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060236015.1|2887522_2890408_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	54.4	1.8e-302
WP_033354983.1|2890604_2891792_+	MFS transporter	NA	NA	NA	NA	NA
WP_069239274.1|2891894_2892446_+	single-stranded DNA-binding protein	NA	C5IHK5	Burkholderia_virus	70.5	4.7e-50
WP_069239275.1|2892702_2893902_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_080484308.1|2893898_2895521_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_069239276.1|2895843_2897517_+|integrase	integrase	integrase	NA	NA	NA	NA
WP_155121863.1|2897713_2898888_-|transposase	IS3-like element ISBvi4 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	48.9	6.9e-75
WP_069239277.1|2899273_2899564_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_069239278.1|2900854_2901160_+	helix-turn-helix transcriptional regulator	NA	E5E3S9	Burkholderia_phage	46.9	6.4e-17
WP_080484309.1|2901140_2902127_+	RNA-directed DNA polymerase	NA	E5E3S8	Burkholderia_phage	37.2	5.4e-41
WP_069239279.1|2902271_2903342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155121863.1|2906038_2907213_-|transposase	IS3-like element ISBvi4 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	48.9	6.9e-75
2920925:2920941	attR	CGGCGTCGCGGCGGTGC	NA	NA	NA	NA
>prophage 1
NZ_CP013421	Burkholderia ubonensis strain MSMB0783 chromosome 3, complete sequence	1229847	29605	67632	1229847	transposase	Synechococcus_phage(25.0%)	35	NA	NA
WP_081333277.1|29605_29926_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_011880403.1|30213_31377_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_069239456.1|31778_33536_-	SulP family inorganic anion transporter	NA	NA	NA	NA	NA
WP_069239457.1|33737_33959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155121916.1|34099_35140_-	TIGR00730 family Rossman fold protein	NA	F4YCQ1	Synechococcus_phage	37.6	2.0e-09
WP_069239459.1|35162_35498_-	cytochrome C	NA	NA	NA	NA	NA
WP_069239460.1|35517_36519_-	nitroreductase	NA	NA	NA	NA	NA
WP_069239461.1|36695_37685_+	zinc-dependent alcohol dehydrogenase family protein	NA	A0A0G2YAX3	Acanthamoeba_polyphaga_mimivirus	30.9	1.7e-18
WP_069239462.1|37810_38584_-	fumarate/nitrate reduction transcriptional regulator Fnr	NA	NA	NA	NA	NA
WP_060236567.1|38966_39614_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_069239463.1|40226_40697_+	universal stress protein	NA	NA	NA	NA	NA
WP_069239464.1|40757_41591_-	universal stress protein	NA	NA	NA	NA	NA
WP_069239465.1|41587_42091_-	universal stress protein	NA	NA	NA	NA	NA
WP_069239466.1|42160_43360_-	acetate/propionate family kinase	NA	NA	NA	NA	NA
WP_069239467.1|43368_44208_-	universal stress protein	NA	NA	NA	NA	NA
WP_011880389.1|44396_44927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069239468.1|44916_45663_+	beta-ketoacyl-ACP reductase	NA	NA	NA	NA	NA
WP_080484337.1|45796_47611_+	poly-beta-hydroxybutyrate polymerase	NA	NA	NA	NA	NA
WP_069239469.1|47630_48671_+	zinc-dependent alcohol dehydrogenase family protein	NA	E3SJ82	Synechococcus_phage	26.7	2.4e-15
WP_059464014.1|48908_50360_-|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
WP_059474834.1|50528_50714_+	barstar family protein	NA	NA	NA	NA	NA
WP_069239470.1|50765_52304_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	35.2	6.3e-44
WP_155121917.1|52302_52638_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080484338.1|52647_54480_+	LysM peptidoglycan-binding domain-containing protein	NA	Q6A204	Oenococcus_phage	36.5	2.4e-05
WP_155121918.1|54492_55098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080484339.1|55163_55421_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_155121919.1|55689_55884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043292613.1|56660_57095_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011879997.1|57204_57822_+	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_069239473.1|58407_59319_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_080484340.1|59342_60008_+	DsbA family protein	NA	NA	NA	NA	NA
WP_069239475.1|62091_63906_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	35.1	1.8e-21
WP_046429363.1|64057_64465_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_069239476.1|64923_66144_+|transposase	ISL3 family transposase	transposase	A9YX10	Burkholderia_phage	93.6	9.5e-229
WP_069239477.1|66639_67632_+|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	86.0	1.4e-158
>prophage 2
NZ_CP013421	Burkholderia ubonensis strain MSMB0783 chromosome 3, complete sequence	1229847	243641	282698	1229847	transposase,integrase	Bacillus_phage(16.67%)	27	250700:250759	277836:278327
WP_069239509.1|243641_245339_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_126221107.1|245435_245840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_126221193.1|245966_247400_-	TolC family protein	NA	NA	NA	NA	NA
WP_059475418.1|247431_248850_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_080484351.1|248861_250757_-	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	27.8	1.3e-38
250700:250759	attL	TGAGGCCGGTCGGAAAAAATGGAAGCCAACGTTTCGTAAAATCGAGAAACGGAGGCATGG	NA	NA	NA	NA
WP_155121863.1|250759_251933_+|transposase	IS3-like element ISBvi4 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	48.9	6.9e-75
WP_080484352.1|252753_253428_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_155121926.1|253684_254665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069239513.1|254664_256752_+	hybrid sensor histidine kinase/response regulator	NA	A0A1V0SGX0	Hokovirus	34.1	1.6e-42
WP_069239515.1|258053_258605_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_069239516.1|258673_259393_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_080484353.1|259566_262002_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_080484354.1|262537_263215_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_080484355.1|264021_264726_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_069239518.1|265045_266158_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_045579196.1|267797_268541_-	carbonic anhydrase	NA	NA	NA	NA	NA
WP_069239519.1|269143_270223_-	linear amide C-N hydrolase	NA	A0A2K9L5Y5	Tupanvirus	28.9	2.2e-19
WP_045579193.1|270613_270922_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_045579192.1|270918_271161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045579191.1|271747_273214_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_155121927.1|273335_273509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144410671.1|273514_273712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045579190.1|274010_275648_+	Na+/H+ antiporter	NA	NA	NA	NA	NA
WP_069239520.1|275877_277569_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2K9VH72	Gordonia_phage	30.9	6.3e-05
WP_155121928.1|278366_279454_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	35.2	3.2e-42
277836:278327	attR	TGAGGCCGGTCGGAAAAAATGGAAGCCAACGTTTCGTAAAATCGAGAAACGGAGGCATGGATGAATCGAATTCCAAGAGCGGTCTATACGAAGGAGCTTCGCGACGAAGCGGTCAAGTTGGCGTTGGCCGAAGGTGTGGGGGTATCGGAAGCTTCCCGGCGCTTGTCGATCCCAATCAAGACGCTGGCAAACTGGGTGCGCGCGGCGAAGGCCGGTAAGCTGAAAGATGTCGGCCGGCACCAGAGGCCACTGACGGAAATGGAGGCCGAGCTGGCGCAGGTCAAGCGCGAACTGGCCGAGGTCAAAATGGAGCGCGATCTGCTAAAAAAGTTCGCGACGTACTTCGCGAAGGAGTCGCGGTGAAGTACGGCGTGATCGAACAAATGCGACAGGACTATCCCGTGCCGCCGATGTGCCGCGTGCTGGGTGTATCGGTGAGCGGCTACTATGCGTGGCGCAAGCGCGGGCCGTCCGAAAGAACGCAGCAGGAGC	NA	NA	NA	NA
WP_155121929.1|280325_280718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069239522.1|281561_282698_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP013421	Burkholderia ubonensis strain MSMB0783 chromosome 3, complete sequence	1229847	288081	348775	1229847	transposase,integrase	Burkholderia_phage(16.67%)	44	343975:343992	361525:361542
WP_069239522.1|288081_289218_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_043291788.1|289907_290900_+|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	86.0	1.1e-158
WP_080484358.1|290874_291321_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_069239526.1|291756_292800_-	DUF1016 domain-containing protein	NA	Q9JMP5	Wolbachia_phage	51.9	2.5e-105
WP_069239527.1|294001_298387_-	hemagglutinin	NA	NA	NA	NA	NA
WP_043291788.1|299345_300338_+|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	86.0	1.1e-158
WP_045579729.1|301008_301458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059460903.1|301566_302907_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_045579731.1|303273_303969_-	aquaporin Z	NA	NA	NA	NA	NA
WP_045579732.1|304064_304577_-	OmpA family protein	NA	NA	NA	NA	NA
WP_144410687.1|304573_304843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045579734.1|304861_305443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059460901.1|305469_305799_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_144410688.1|305890_306085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059669414.1|306081_306837_-	class I SAM-dependent methyltransferase	NA	A0A1V0S9B9	Catovirus	39.5	1.2e-35
WP_045579969.1|306833_307274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155121930.1|307317_307554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106919390.1|307674_309543_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_059669413.1|309587_309899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045579737.1|309936_310284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069239529.1|310297_311149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045579738.1|311153_312296_-	DUF2827 domain-containing protein	NA	NA	NA	NA	NA
WP_059460898.1|312292_312919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059460897.1|312915_314037_-	DUF2827 domain-containing protein	NA	NA	NA	NA	NA
WP_045579740.1|314033_315167_-	DUF2827 domain-containing protein	NA	NA	NA	NA	NA
WP_045579741.1|315355_316051_-	OmpA family protein	NA	G3M9Z1	Bacillus_virus	33.7	5.6e-08
WP_155121931.1|316141_325645_-	hemagglutinin	NA	NA	NA	NA	NA
WP_155121932.1|325747_326221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052691595.1|326265_326973_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_045579745.1|327475_328099_+	recombinase family protein	NA	A0JC18	Ralstonia_phage	41.4	1.4e-34
WP_155121933.1|328142_329516_+	galactosyl transferase GMA12/MNN10 domain protein	NA	NA	NA	NA	NA
WP_059461598.1|329488_330901_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	27.0	8.4e-19
WP_106919380.1|331637_331874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080484362.1|332158_333001_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	56.3	2.4e-37
WP_155121863.1|334861_336036_-|transposase	IS3-like element ISBvi4 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	48.9	6.9e-75
WP_069239534.1|337229_338186_-	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_060235538.1|338169_338991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059461595.1|340235_341408_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_059460485.1|341488_343027_-|transposase	IS3-like element ISBmu11 family transposase	transposase	A0A1B1P773	Bacillus_phage	35.2	2.8e-44
WP_155121948.1|343124_344322_+|transposase	IS3 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	65.5	7.2e-104
343975:343992	attL	GGCCGCCGTCGAACAGCG	NA	NA	NA	NA
WP_155121934.1|345358_345544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155121935.1|345600_346470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155121936.1|346601_347969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059461600.1|348148_348775_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1S5SFL0	Streptococcus_phage	28.4	9.2e-10
361525:361542	attR	CGCTGTTCGACGGCGGCC	NA	NA	NA	NA
