The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP013409	Burkholderia thailandensis strain 2002721121 chromosome 1, complete sequence	3827782	408904	436191	3827782	plate,protease,transposase,integrase	Liberibacter_phage(25.0%)	22	401451:401467	436483:436499
401451:401467	attL	TCGGCGTCGTCGCGCTC	NA	NA	NA	NA
WP_019255998.1|408904_409423_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	52.5	1.1e-21
WP_025404679.1|409693_410911_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	43.0	3.9e-89
WP_082264239.1|411526_414403_-	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	35.6	6.6e-71
WP_025404681.1|414515_414842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004522498.1|414851_415199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025404682.1|415191_415404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025404683.1|415396_415699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025404684.1|416228_416531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043300520.1|416527_416737_-	AlpA family phage regulatory protein	NA	E5E3Y1	Burkholderia_phage	52.5	5.7e-09
WP_082264240.1|416860_417394_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_146034401.1|417843_419928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025404687.1|420204_420813_+	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	42.1	3.7e-24
WP_025404688.1|421394_422891_+	SAM-dependent DNA methyltransferase	NA	A0A220A2U4	Liberibacter_phage	56.7	3.8e-147
WP_025404689.1|422887_424399_+	SAM-dependent DNA methyltransferase	NA	A0A220A2U5	Liberibacter_phage	57.2	1.9e-138
WP_025404690.1|424391_425600_+	hypothetical protein	NA	A0A240FAT6	Liberibacter_phage	56.0	1.0e-44
WP_025404721.1|428603_429026_-	plasmid pRiA4b ORF-3 family protein	NA	A0A2H4PDG5	Mycobacterium_phage	37.8	4.1e-14
WP_085952127.1|429109_430346_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	95.1	5.8e-157
WP_025404692.1|430564_432127_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	52.1	3.5e-143
WP_025404693.1|432156_432504_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	71.0	1.2e-40
WP_082264242.1|432503_432866_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_009888580.1|434062_434848_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_009906858.1|434844_436191_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
436483:436499	attR	GAGCGCGACGACGCCGA	NA	NA	NA	NA
>prophage 2
NZ_CP013409	Burkholderia thailandensis strain 2002721121 chromosome 1, complete sequence	3827782	773650	782880	3827782		Hokovirus(16.67%)	7	NA	NA
WP_009904051.1|773650_775603_+	molecular chaperone DnaK	NA	A0A1V0SH73	Hokovirus	50.3	6.6e-147
WP_009889258.1|775866_776997_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	38.0	1.8e-24
WP_025404755.1|777028_779038_+	bifunctional anthranilate synthase component I family protein/class IV aminotransferase	NA	S4VT78	Pandoravirus	34.7	8.2e-52
WP_009904054.1|779212_780028_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	32.9	3.3e-36
WP_009889263.1|780092_780776_-	deoxynucleoside kinase	NA	A0A249XZR7	Enterococcus_phage	26.0	3.3e-05
WP_009889265.1|780772_781300_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_009904055.1|781335_782880_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	31.2	2.5e-24
>prophage 3
NZ_CP013409	Burkholderia thailandensis strain 2002721121 chromosome 1, complete sequence	3827782	1144894	1153576	3827782		Bacillus_phage(16.67%)	8	NA	NA
WP_009904402.1|1144894_1146295_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	38.7	1.4e-79
WP_009889854.1|1146263_1147250_+	D-glycero-beta-D-manno-heptose-7-phosphate kinase	NA	A0A2H4N7X4	Lake_Baikal_phage	27.9	6.7e-15
WP_009904403.1|1147307_1148300_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	30.9	9.1e-28
WP_009889858.1|1148371_1148689_+	competence protein ComE	NA	NA	NA	NA	NA
WP_009904404.1|1149023_1149926_+	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	39.9	4.3e-53
WP_080554803.1|1150020_1151391_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_009889864.1|1151440_1152364_+	histone deacetylase family protein	NA	A0A2K9KZC4	Tupanvirus	36.2	3.2e-43
WP_025404856.1|1152733_1153576_-	alpha/beta hydrolase	NA	A7XCB7	Tanapox_virus	26.8	6.5e-19
>prophage 4
NZ_CP013409	Burkholderia thailandensis strain 2002721121 chromosome 1, complete sequence	3827782	2321250	2388109	3827782	coat,plate,transposase,tRNA	uncultured_Caudovirales_phage(28.57%)	48	NA	NA
WP_025405105.1|2321250_2323875_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.2	7.1e-80
WP_025405106.1|2324318_2325539_+	CoA transferase	NA	NA	NA	NA	NA
WP_025405107.1|2325632_2326439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009891706.1|2327458_2329168_+|tRNA	glutamine--tRNA ligase/YqeY domain fusion protein	tRNA	A0A222YZ70	Escherichia_phage	56.9	2.8e-186
WP_025405108.1|2329453_2329930_-	NUDIX hydrolase	NA	A0A2I6PFL2	Proteus_phage	41.3	1.5e-20
WP_009891709.1|2329948_2330335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080555112.1|2330621_2332670_-	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_009905872.1|2332646_2332826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009905874.1|2332822_2333683_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_082264322.1|2333728_2334889_-	cytochrome-c peroxidase	NA	NA	NA	NA	NA
WP_009905877.1|2335377_2336961_+	acid phosphatase	NA	NA	NA	NA	NA
WP_009905879.1|2337185_2338379_+	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_009905880.1|2338396_2339239_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_009891722.1|2339955_2340588_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_025405110.1|2340588_2342661_-	response regulator	NA	Q8QKV7	Ectocarpus_siliculosus_virus	27.8	2.6e-29
WP_009905886.1|2343071_2344037_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_009905896.1|2346507_2347347_-	molecular chaperone	NA	NA	NA	NA	NA
WP_038708375.1|2347364_2347889_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_009905900.1|2347971_2348532_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_019255106.1|2348584_2349130_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_009891734.1|2349938_2350832_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_038708373.1|2351247_2352537_+	MFS transporter	NA	NA	NA	NA	NA
WP_025405114.1|2352581_2353508_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_009891738.1|2353799_2354036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009891740.1|2353993_2354275_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_080511535.1|2354474_2354777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106936444.1|2355255_2356342_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.2	3.4e-44
WP_082264272.1|2356533_2357253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155275018.1|2358583_2359303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025405116.1|2359313_2362337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009905923.1|2362339_2363356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025405117.1|2363359_2366182_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	24.7	1.5e-30
WP_009905925.1|2366194_2366500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009905926.1|2366517_2366850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038708366.1|2367874_2368366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009906870.1|2369124_2369619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025405119.1|2369596_2372932_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_011402458.1|2374292_2374892_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_069255276.1|2374888_2375446_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_019256183.1|2375573_2377979_-	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_009906968.1|2377975_2378575_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_082264274.1|2379062_2379662_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_025405121.1|2379658_2380216_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_009905935.1|2380352_2381186_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_025405122.1|2381188_2383987_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	24.1	2.6e-27
WP_009891791.1|2384512_2384779_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_025405123.1|2384802_2386230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009905942.1|2386258_2388109_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 5
NZ_CP013409	Burkholderia thailandensis strain 2002721121 chromosome 1, complete sequence	3827782	2767318	2816905	3827782	protease,portal,capsid,plate,head,integrase,transposase,tail,terminase	uncultured_Caudovirales_phage(31.25%)	61	2758916:2758950	2803035:2803069
2758916:2758950	attL	CCATCCCGCTCAAACTATCCGCTCCCCGTAGTTCA	NA	NA	NA	NA
WP_025405210.1|2767318_2768107_-	DNA adenine methylase	NA	Q8W6S4	Burkholderia_virus	95.4	7.4e-150
WP_043300542.1|2768249_2768795_-	lysozyme	NA	Q8W6S5	Burkholderia_virus	92.3	1.1e-80
WP_025405212.1|2768794_2769292_-	lysozyme	NA	A4JX20	Burkholderia_virus	77.6	2.5e-66
WP_004533694.1|2769284_2769479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025405213.1|2769554_2770607_-	phage late control D protein	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	44.2	1.0e-77
WP_025405214.1|2770616_2770823_-|tail	phage tail protein	tail	A0A2H4J9Z9	uncultured_Caudovirales_phage	58.2	2.6e-14
WP_025405215.1|2770797_2771679_-|tail	phage tail protein	tail	A0A2H4J875	uncultured_Caudovirales_phage	37.4	3.9e-30
WP_025405216.1|2771687_2774096_-|tail	phage tail tape measure protein	tail	A0A2H4JG00	uncultured_Caudovirales_phage	33.8	1.5e-68
WP_025405217.1|2774183_2774486_-|tail	phage tail assembly protein	tail	V5YST8	Pseudomonas_phage	35.9	4.3e-05
WP_025405218.1|2774555_2775059_-|tail	phage major tail tube protein	tail	Q7M2A5	Pseudomonas_phage	49.4	4.7e-41
WP_025405219.1|2775069_2776239_-|tail	phage tail sheath family protein	tail	A0A2H4J869	uncultured_Caudovirales_phage	73.5	4.3e-162
WP_025405220.1|2776305_2776758_-|tail	tail assembly chaperone	tail	A4JWL9	Burkholderia_virus	79.3	1.8e-44
WP_025405221.1|2776773_2778237_-	hypothetical protein	NA	A4JWL8	Burkholderia_virus	78.4	2.2e-216
WP_025405222.1|2778224_2778800_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	43.5	1.2e-32
WP_025405223.1|2778792_2779686_-|plate	baseplate J protein	plate	A0A1J0I2M3	Salmonella_phage	39.8	4.2e-48
WP_025405224.1|2779682_2780027_-	hypothetical protein	NA	A0A2H4JA09	uncultured_Caudovirales_phage	49.1	1.0e-23
WP_025405225.1|2780023_2780230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025405226.1|2780293_2780974_-|plate	phage baseplate assembly protein V	plate	A0A1B2LRU5	Wolbachia_phage	34.4	1.5e-18
WP_025405227.1|2780976_2781510_-	hypothetical protein	NA	Q9JML9	Wolbachia_phage	38.0	7.5e-21
WP_025405228.1|2781499_2782030_-|tail	phage tail protein	tail	A0A2H4JBV1	uncultured_Caudovirales_phage	28.5	2.0e-10
WP_025405229.1|2782031_2782322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082264282.1|2782325_2783351_-|capsid	major capsid protein	capsid	A0A2H4J890	uncultured_Caudovirales_phage	58.8	2.2e-109
WP_025405231.1|2783385_2783730_-|head	head decoration protein	head	NA	NA	NA	NA
WP_025405232.1|2783757_2784825_-|protease	Clp protease ClpP	protease	A0A2H4JDI2	uncultured_Caudovirales_phage	37.7	2.8e-51
WP_025405233.1|2784821_2786315_-|portal	phage portal protein	portal	A0A2H4JFL5	uncultured_Caudovirales_phage	51.4	1.5e-135
WP_004533700.1|2786311_2786518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025405234.1|2786528_2788517_-|terminase	phage terminase large subunit family protein	terminase	A0A2D1GMT1	Marinobacter_phage	53.3	6.0e-180
WP_025405235.1|2788479_2789049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025405236.1|2789142_2789331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025405237.1|2789550_2790324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009964499.1|2790541_2793034_-	virulence protein E	NA	A0A2D1GN57	Marinobacter_phage	41.8	8.5e-99
WP_009964497.1|2793155_2793626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099975963.1|2793999_2794458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009964493.1|2794459_2794915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025405238.1|2794922_2795255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009927752.1|2795268_2795796_-	hypothetical protein	NA	C7BGG0	Burkholderia_phage	46.5	9.7e-29
WP_076853252.1|2795884_2796112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009909040.1|2796260_2796746_+	helix-turn-helix transcriptional regulator	NA	A0A193GYL7	Enterobacter_phage	41.2	4.4e-12
WP_123850154.1|2796693_2797149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004550209.1|2797277_2797496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004534202.1|2797547_2797883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004534172.1|2797879_2798485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009964485.1|2798481_2798931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009964483.1|2798930_2800247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025405240.1|2800360_2800690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043300578.1|2800698_2801487_+	hypothetical protein	NA	Q6J1P0	Burkholderia_virus	57.3	5.0e-21
WP_025405241.1|2801474_2801705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025405242.1|2801738_2802839_-|integrase	site-specific integrase	integrase	A0A2D1GMX8	Marinobacter_phage	31.0	1.5e-44
WP_085952127.1|2804008_2805245_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	95.1	5.8e-157
2803035:2803069	attR	CCATCCCGCTCAAACTATCCGCTCCCCGTAGTTCA	NA	NA	NA	NA
WP_082264283.1|2806001_2806835_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_082264284.1|2807523_2810391_-	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	35.2	6.6e-71
WP_009907004.1|2810520_2810862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025405247.1|2810858_2811116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106936421.1|2811088_2811466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025405248.1|2811655_2812135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004525824.1|2812134_2812305_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_009906999.1|2812535_2813048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082264242.1|2813148_2813511_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_025404693.1|2813510_2813858_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	71.0	1.2e-40
WP_025404692.1|2813887_2815450_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	52.1	3.5e-143
WP_085952127.1|2815667_2816905_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	95.1	5.8e-157
>prophage 6
NZ_CP013409	Burkholderia thailandensis strain 2002721121 chromosome 1, complete sequence	3827782	2995336	3006217	3827782	protease	Agrobacterium_phage(16.67%)	9	NA	NA
WP_025405293.1|2995336_2997637_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	41.9	3.6e-168
WP_009892611.1|2997633_2997948_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	44.6	2.6e-13
WP_004196460.1|2998478_2998682_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	81.8	6.8e-23
WP_025405294.1|2998793_3000389_-	multicopper oxidase family protein	NA	NA	NA	NA	NA
WP_009903329.1|3000553_3001813_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	63.0	6.8e-12
WP_009892615.1|3002077_3002656_+	pseudouridine synthase	NA	NA	NA	NA	NA
WP_080555088.1|3002916_3003132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019256450.1|3003327_3003837_+	DUF192 domain-containing protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	42.2	5.0e-14
WP_009903323.1|3004102_3006217_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.0	2.3e-57
>prophage 7
NZ_CP013409	Burkholderia thailandensis strain 2002721121 chromosome 1, complete sequence	3827782	3317449	3357310	3827782	transposase,integrase	Burkholderia_virus(33.33%)	29	3302277:3302294	3364511:3364528
3302277:3302294	attL	TCGTGCAGTTCCCAGCGC	NA	NA	NA	NA
WP_085952127.1|3317449_3318686_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	95.1	5.8e-157
WP_004522844.1|3318813_3319131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009902810.1|3319303_3319555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009902806.1|3319744_3321325_-	hydrolase	NA	NA	NA	NA	NA
WP_009902805.1|3321637_3322366_+	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_025405356.1|3322928_3323366_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_082264293.1|3323982_3325545_+	Fic family protein	NA	Q9AZ49	Lactococcus_phage	30.6	6.9e-06
WP_082264294.1|3325910_3326645_-	hydrolase TatD	NA	NA	NA	NA	NA
WP_025405358.1|3326641_3327928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025405359.1|3327924_3328752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025405360.1|3328751_3330632_-	NTPase KAP	NA	NA	NA	NA	NA
WP_146034448.1|3331075_3333721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025404721.1|3334061_3334484_-	plasmid pRiA4b ORF-3 family protein	NA	A0A2H4PDG5	Mycobacterium_phage	37.8	4.1e-14
WP_085952127.1|3334567_3335804_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	95.1	5.8e-157
WP_025404692.1|3336022_3337585_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	52.1	3.5e-143
WP_025404693.1|3337614_3337962_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	71.0	1.2e-40
WP_082264242.1|3337961_3338324_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_025405362.1|3338380_3339160_+	FRG domain-containing protein	NA	NA	NA	NA	NA
WP_082264295.1|3339442_3340138_-	DUF2290 domain-containing protein	NA	NA	NA	NA	NA
WP_043300549.1|3340130_3342248_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_146034438.1|3342406_3344323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025405366.1|3344500_3346414_-	ATP-dependent helicase	NA	NA	NA	NA	NA
WP_025405367.1|3346410_3348756_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_025405368.1|3349259_3349493_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_025405369.1|3350657_3351308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025405370.1|3352088_3352523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025405371.1|3352519_3354526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025405372.1|3354525_3356070_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_025405373.1|3356044_3357310_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
3364511:3364528	attR	TCGTGCAGTTCCCAGCGC	NA	NA	NA	NA
>prophage 1
NZ_CP013410	Burkholderia thailandensis strain 2002721121 chromosome 2, complete sequence	2940149	100151	158326	2940149	holin,transposase,plate	Leptospira_phage(25.0%)	44	NA	NA
WP_025405966.1|100151_102347_+|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
WP_106936403.1|102427_103515_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.2	2.0e-44
WP_019255409.1|103834_104254_-	YjbQ family protein	NA	NA	NA	NA	NA
WP_004523720.1|104273_104600_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_019255408.1|105072_105765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009894695.1|106572_106929_-	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_019255406.1|107048_107255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019255405.1|107404_108547_-	porin	NA	NA	NA	NA	NA
WP_082264336.1|109218_110142_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_009898267.1|110759_111062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155275044.1|111708_111942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019255401.1|112055_113255_-	transcriptional regulator CynR	NA	NA	NA	NA	NA
WP_019255400.1|113254_114679_-	TolC family protein	NA	NA	NA	NA	NA
WP_009898285.1|114672_115572_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_009894707.1|115573_115798_-	DUF1656 domain-containing protein	NA	NA	NA	NA	NA
WP_038708432.1|115794_117861_-	FUSC family protein	NA	NA	NA	NA	NA
WP_025405971.1|118870_120412_-	membrane protein	NA	NA	NA	NA	NA
WP_155275045.1|120759_121116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025405972.1|121960_123562_+	hypothetical protein	NA	K4F7R4	Cronobacter_phage	46.1	5.8e-08
WP_080554843.1|123637_125125_-	PhoPQ-regulated protein	NA	NA	NA	NA	NA
WP_025987413.1|125339_125933_-	membrane protein	NA	NA	NA	NA	NA
WP_009898306.1|126518_127073_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_025405975.1|127139_127880_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_082264386.1|128102_130736_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_025987411.1|130728_131301_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_082264387.1|131364_132021_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_025405979.1|132023_133700_+	OmpA family protein	NA	NA	NA	NA	NA
WP_009898320.1|134043_134583_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_009898321.1|134616_136116_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_009894730.1|136316_136799_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_019255186.1|136926_137469_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_025405980.1|137474_138824_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_009898325.1|138820_140122_+	type VI secretion system protein TssL	NA	NA	NA	NA	NA
WP_025405981.1|140136_144045_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_019255184.1|144235_144805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082264338.1|144872_147614_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.0	1.9e-35
WP_004523693.1|147688_147958_+	PAAR motif protein	NA	NA	NA	NA	NA
WP_025405983.1|147970_151423_+	RHS repeat protein	NA	NA	NA	NA	NA
WP_043300729.1|151315_152674_-	hypothetical protein	NA	A0A292GJ55	Xanthomonas_phage	49.7	2.6e-110
WP_009894750.1|152706_153735_-	fimbrial protein	NA	NA	NA	NA	NA
WP_009898344.1|153790_154861_-	type VI secretion protein ImpA	NA	NA	NA	NA	NA
WP_009898345.1|154879_155929_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_025405985.1|155925_157806_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_009894757.1|157807_158326_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 2
NZ_CP013410	Burkholderia thailandensis strain 2002721121 chromosome 2, complete sequence	2940149	723637	762923	2940149	integrase,tRNA,transposase,tail,plate	Burkholderia_virus(45.95%)	47	735706:735725	765288:765307
WP_025405402.1|723637_724678_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	54.0	1.7e-93
WP_025405403.1|724808_726032_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_009895742.1|726111_726324_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_019254422.1|726490_726937_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	48.6	3.3e-22
WP_009899227.1|727033_728911_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	36.2	4.9e-67
WP_009895748.1|728957_729296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009899229.1|729354_731397_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	32.0	4.2e-35
WP_019256111.1|731765_731951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019256110.1|732044_732335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_135351310.1|732315_732714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009899233.1|733638_733995_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	76.8	1.1e-44
WP_009899234.1|734085_734700_-	DUF3164 family protein	NA	A4JWM8	Burkholderia_virus	83.4	2.2e-93
WP_009899237.1|734796_735129_-	hypothetical protein	NA	Q6QIE2	Burkholderia_phage	58.2	2.5e-22
WP_025405404.1|735160_736414_-	AAA family ATPase	NA	Q6QIE1	Burkholderia_phage	69.1	5.5e-155
735706:735725	attL	CGAGCGGCGCGACGGCCGCG	NA	NA	NA	NA
WP_009899242.1|736410_738207_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q6QIE0	Burkholderia_phage	80.2	4.3e-278
WP_025405405.1|738221_739187_-	hypothetical protein	NA	A4JWN3	Burkholderia_virus	70.3	1.4e-102
WP_009899245.1|739200_739512_-	helix-turn-helix domain-containing protein	NA	A4JWN4	Burkholderia_virus	80.0	1.7e-33
WP_025405406.1|739508_740024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009906820.1|740033_740276_-	DNA-binding protein	NA	Q6QID3	Burkholderia_phage	90.0	7.3e-32
WP_050789956.1|740406_740826_+	helix-turn-helix transcriptional regulator	NA	A4JWR8	Burkholderia_virus	51.4	6.7e-25
WP_025405407.1|740891_741767_+	hypothetical protein	NA	A4JWN9	Burkholderia_virus	28.9	7.0e-24
WP_009906937.1|742260_742608_+	membrane protein	NA	Q6QIC8	Burkholderia_phage	79.1	1.2e-43
WP_025405408.1|742610_743219_+	transglycosylase SLT domain-containing protein	NA	Q6QIC7	Burkholderia_phage	79.8	3.9e-90
WP_155275021.1|743383_743818_+	hypothetical protein	NA	A4JWP5	Burkholderia_virus	69.3	4.4e-43
WP_009906940.1|743814_744153_+	hypothetical protein	NA	A4JWP6	Burkholderia_virus	82.7	4.0e-44
WP_009906941.1|744149_744482_+	hypothetical protein	NA	Q6QIC3	Burkholderia_phage	77.8	1.9e-46
WP_025405411.1|744814_745129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009906942.1|745299_745764_+	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	60.1	3.9e-42
WP_009906943.1|745760_746006_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	62.5	1.7e-20
WP_009906944.1|746009_747443_+|tail	tail protein	tail	A4JWK5	Burkholderia_virus	87.2	4.7e-243
WP_025405412.1|747444_747969_+|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	90.8	1.0e-86
WP_009906946.1|748281_748611_+|tail	phage tail assembly protein	tail	Q6QIA8	Burkholderia_phage	65.7	1.8e-25
WP_009906947.1|748582_748741_+	hypothetical protein	NA	Q6QIA7	Burkholderia_phage	80.8	2.5e-17
WP_082264390.1|749356_751450_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	50.2	2.6e-157
WP_009906887.1|751451_752354_+|tail	phage tail protein	tail	Q6QIA4	Burkholderia_phage	72.1	3.5e-71
WP_009906886.1|752353_752560_+	membrane protein	NA	A4JWL2	Burkholderia_virus	78.3	1.5e-25
WP_025405415.1|752547_753753_+	hypothetical protein	NA	A4JWL3	Burkholderia_virus	70.6	2.5e-136
WP_009906884.1|753749_754352_+|plate	phage baseplate assembly protein V	plate	A4JWL4	Burkholderia_virus	69.0	4.3e-65
WP_146034418.1|754365_754662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025405417.1|754824_755907_+	hypothetical protein	NA	A4JWL8	Burkholderia_virus	46.2	1.2e-70
WP_009907016.1|755903_756347_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_009907015.1|756641_756995_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	82.9	4.2e-52
WP_009907014.1|756991_758143_+|plate	baseplate protein	plate	A4JWL6	Burkholderia_virus	79.9	2.3e-168
WP_009907013.1|758135_758717_+|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	86.5	1.5e-91
WP_025405418.1|758716_760684_+|tail	tail fiber protein	tail	Q45YG3	Burkholderia_virus	59.0	3.0e-131
WP_009907011.1|760699_761401_+|tail	tail assembly chaperone	tail	E5E3Q6	Burkholderia_phage	59.7	1.1e-59
WP_043300628.1|761705_762923_-	acyltransferase	NA	A0A2H4IZR3	uncultured_Caudovirales_phage	26.5	5.5e-27
765288:765307	attR	CGAGCGGCGCGACGGCCGCG	NA	NA	NA	NA
>prophage 3
NZ_CP013410	Burkholderia thailandensis strain 2002721121 chromosome 2, complete sequence	2940149	1549729	1621301	2940149	portal,protease,tail,plate,capsid,head,terminase,holin,lysis	Burkholderia_virus(57.41%)	80	NA	NA
WP_025405625.1|1549729_1551718_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	E5EQU5	Bathycoccus_sp._RCC1105_virus	45.1	1.4e-104
WP_009900206.1|1551824_1552430_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_025405626.1|1552668_1554159_-	arginine-ornithine antiporter	NA	NA	NA	NA	NA
WP_025405627.1|1555160_1555652_+	NUDIX hydrolase	NA	A0A0E3JJF3	Streptomyces_phage	42.9	2.8e-14
WP_009896955.1|1555648_1556104_+	nucleoside 2-deoxyribosyltransferase	NA	NA	NA	NA	NA
WP_009900214.1|1556105_1557095_+	thymidylate synthase	NA	NA	NA	NA	NA
WP_009900215.1|1557110_1557851_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_025405628.1|1558094_1558895_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_025405629.1|1558972_1560403_+	thiamine pyridinylase	NA	NA	NA	NA	NA
WP_025405630.1|1560483_1561293_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_025405631.1|1562168_1562648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025405632.1|1562706_1565220_+	cation-translocating P-type ATPase	NA	M1I547	Acanthocystis_turfacea_Chlorella_virus	29.4	4.3e-58
WP_009900226.1|1565271_1565895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025405633.1|1566067_1568482_-	HAD-IC family P-type ATPase	NA	NA	NA	NA	NA
WP_009900232.1|1568722_1570093_-	DUF3326 domain-containing protein	NA	NA	NA	NA	NA
WP_009896978.1|1570244_1570664_+	archease	NA	NA	NA	NA	NA
WP_009900233.1|1570677_1572111_+	RtcB family protein	NA	A2RQD0	Archaeal_BJ1_virus	45.2	6.0e-105
WP_009900234.1|1572168_1572429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009896988.1|1572559_1573264_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082264356.1|1573260_1573695_+	GYD domain-containing protein	NA	NA	NA	NA	NA
WP_009900237.1|1573801_1574935_+	CapA family protein	NA	S4VS02	Pandoravirus	55.6	9.5e-114
WP_009900238.1|1575050_1577846_-	hsp70 family protein	NA	A0A2H4UU19	Bodo_saltans_virus	25.8	3.8e-07
WP_009900239.1|1577849_1579697_-	Hsp70 family protein	NA	NA	NA	NA	NA
WP_019255750.1|1579693_1580269_-	DUF2760 domain-containing protein	NA	NA	NA	NA	NA
WP_025405634.1|1580596_1581361_-	2-keto-4-pentenoate hydratase	NA	NA	NA	NA	NA
WP_154660029.1|1581350_1581743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009900243.1|1581947_1582463_+	ProP effector	NA	NA	NA	NA	NA
WP_009897004.1|1582476_1582806_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_025405635.1|1583766_1584867_-	phage late control D family protein	NA	K4PAY4	Burkholderia_phage	96.2	2.8e-195
WP_025405636.1|1584866_1585292_-|tail	phage tail protein	tail	A4JWS2	Burkholderia_virus	97.9	3.7e-71
WP_082264357.1|1585309_1588144_-	hypothetical protein	NA	Q45YG8	Burkholderia_virus	70.6	0.0e+00
WP_011204755.1|1588140_1588254_-|tail	GpE family phage tail protein	tail	A4JWX5	Burkholderia_virus	100.0	1.9e-14
WP_025405638.1|1588262_1588607_-|tail	phage tail assembly protein	tail	K4NXA3	Burkholderia_phage	95.6	2.4e-52
WP_025405639.1|1588664_1589174_-|tail	phage major tail tube protein	tail	K4NZR9	Burkholderia_phage	97.6	9.2e-93
WP_025405640.1|1589189_1590362_-|tail	phage tail sheath protein	tail	A4JWS7	Burkholderia_virus	98.7	1.1e-221
WP_025405641.1|1590418_1591060_-|tail	tail assembly chaperone	tail	A4JWS8	Burkholderia_virus	87.4	1.5e-108
WP_082264358.1|1591076_1593449_-|tail	phage tail protein	tail	Q45YG3	Burkholderia_virus	91.1	0.0e+00
WP_025405643.1|1593450_1594005_-|tail	phage tail protein I	tail	A4JWT0	Burkholderia_virus	96.2	7.4e-96
WP_025405644.1|1593997_1594903_-|plate	baseplate assembly protein	plate	K4NZR5	Burkholderia_phage	95.3	2.3e-155
WP_025405645.1|1594899_1595262_-|plate	baseplate assembly protein	plate	A4JWY3	Burkholderia_virus	94.0	8.3e-56
WP_025405646.1|1595258_1595939_-|plate	phage baseplate assembly protein V	plate	A4JWT3	Burkholderia_virus	96.5	4.5e-119
WP_025405647.1|1596112_1596889_+	site-specific DNA-methyltransferase	NA	K4NZW3	Burkholderia_phage	96.5	1.6e-144
WP_043300659.1|1597054_1597585_-	hypothetical protein	NA	K4NX96	Burkholderia_phage	98.2	1.3e-92
WP_043300663.1|1597711_1598179_-	phage virion morphogenesis protein	NA	K4NZQ8	Burkholderia_phage	94.2	6.7e-74
WP_004531054.1|1598175_1598592_-|tail	phage tail protein	tail	A4JWT7	Burkholderia_virus	100.0	3.3e-72
WP_102827107.1|1598584_1598728_-	peptidase	NA	K4PAX1	Burkholderia_phage	93.6	3.9e-17
WP_025405648.1|1598696_1599137_-|lysis	LysB family phage lysis regulatory protein	lysis	K4NXJ2	Burkholderia_phage	91.8	7.7e-64
WP_025405649.1|1599133_1599946_-	DUF3380 domain-containing protein	NA	A4JWZ0	Burkholderia_virus	98.9	3.8e-149
WP_004524440.1|1599942_1600215_-|holin	phage holin family protein	holin	K4NX91	Burkholderia_phage	100.0	8.8e-42
WP_025405650.1|1600216_1600561_-	membrane protein	NA	K4NZQ3	Burkholderia_phage	99.1	5.0e-50
WP_010112635.1|1600575_1600782_-|tail	tail protein	tail	K4PAW7	Burkholderia_phage	98.5	1.5e-30
WP_025405651.1|1600778_1601030_-	hypothetical protein	NA	K4NXI9	Burkholderia_phage	80.7	1.4e-30
WP_025405652.1|1601029_1601509_-|head	head completion/stabilization protein	head	A4JWU5	Burkholderia_virus	96.9	6.0e-78
WP_025405653.1|1601608_1602298_-|terminase	terminase endonuclease subunit	terminase	K4NX86	Burkholderia_phage	96.9	2.9e-113
WP_025405654.1|1602294_1603305_-|capsid	phage major capsid protein, P2 family	capsid	A4JWP9	Burkholderia_virus	91.1	2.3e-172
WP_025405655.1|1603338_1604148_-|capsid	GPO family capsid scaffolding protein	capsid	K4PAW2	Burkholderia_phage	95.5	1.4e-140
WP_025405656.1|1604291_1606061_+|terminase	terminase ATPase subunit family protein	terminase	A4JWQ1	Burkholderia_virus	97.8	0.0e+00
WP_025405657.1|1606057_1607113_+|portal	phage portal protein	portal	A4JWQ2	Burkholderia_virus	96.6	2.1e-200
WP_082264359.1|1607665_1608787_-	DUF3396 domain-containing protein	NA	A4JWV3	Burkholderia_virus	86.9	1.3e-192
WP_025405659.1|1608795_1609533_-	VRR-NUC domain-containing protein	NA	A4JWV4	Burkholderia_virus	94.3	4.1e-126
WP_025405660.1|1609529_1610063_-	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	93.2	9.0e-91
WP_082264402.1|1610168_1610336_-	ribbon-helix-helix protein, CopG family	NA	A4JWV6	Burkholderia_virus	88.7	4.3e-15
WP_082264360.1|1610518_1611178_-	AAA family ATPase	NA	A4JWV7	Burkholderia_virus	97.2	2.6e-111
WP_025405663.1|1611264_1611471_-	ogr/Delta-like zinc finger family protein	NA	A4JWV8	Burkholderia_virus	97.1	2.8e-32
WP_025405664.1|1611467_1611734_-	ogr/Delta-like zinc finger family protein	NA	A4JWV9	Burkholderia_virus	91.8	3.6e-40
WP_025405665.1|1611749_1613543_-	replication endonuclease	NA	A4JWW0	Burkholderia_virus	88.1	0.0e+00
WP_082264403.1|1613542_1615150_-	DNA cytosine methyltransferase	NA	Q6V7R9	Burkholderia_virus	38.5	1.1e-67
WP_082264361.1|1614966_1616004_-	phosphoadenosine phosphosulfate reductase family protein	NA	Q8W6P3	Burkholderia_virus	75.2	8.3e-141
WP_043300783.1|1616076_1616214_-	hypothetical protein	NA	A4JWW4	Burkholderia_virus	86.7	2.2e-17
WP_043300668.1|1616222_1616438_-	hypothetical protein	NA	A4JWW5	Burkholderia_virus	90.1	6.9e-26
WP_025405667.1|1616441_1616663_-	hypothetical protein	NA	A4JWW6	Burkholderia_virus	91.8	2.4e-34
WP_051491693.1|1616659_1616845_-	hypothetical protein	NA	A4JWW7	Burkholderia_virus	75.4	4.0e-14
WP_146034402.1|1616874_1617375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043300670.1|1617371_1618241_-	DUF550 domain-containing protein	NA	R4JG80	Burkholderia_phage	70.0	2.4e-101
WP_043300672.1|1618228_1618381_-	hypothetical protein	NA	R4JMC2	Burkholderia_phage	76.0	2.5e-14
WP_025405669.1|1618617_1618947_+	helix-turn-helix domain-containing protein	NA	A4JWW9	Burkholderia_virus	70.5	1.0e-36
WP_009897098.1|1619089_1619575_-	YbaK/EbsC family protein	NA	NA	NA	NA	NA
WP_009900245.1|1619805_1619964_-	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_009897101.1|1620220_1620709_+	membrane protein	NA	NA	NA	NA	NA
WP_009907678.1|1621160_1621301_+	hypothetical protein	NA	Q8W6Q2	Burkholderia_virus	58.7	9.8e-05
>prophage 4
NZ_CP013410	Burkholderia thailandensis strain 2002721121 chromosome 2, complete sequence	2940149	1644921	1694048	2940149	transposase,protease,tRNA	Stx2-converting_phage(18.18%)	37	NA	NA
WP_009900273.1|1644921_1645794_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_080554986.1|1645826_1646555_-	MarC family protein	NA	NA	NA	NA	NA
WP_019255908.1|1646601_1647927_-	phenylacetate--CoA ligase	NA	NA	NA	NA	NA
WP_009900276.1|1648195_1649284_+	ionic transporter y4hA	NA	NA	NA	NA	NA
WP_009897150.1|1649398_1650367_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_025405679.1|1650712_1651891_+	HPP family protein	NA	NA	NA	NA	NA
WP_009897153.1|1652033_1652447_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_019255910.1|1652480_1654352_+	chloride channel protein	NA	NA	NA	NA	NA
WP_025405680.1|1654802_1656305_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_019256532.1|1656465_1657350_+	FkbM family methyltransferase	NA	Q58M88	Prochlorococcus_phage	26.8	6.7e-06
WP_019256531.1|1657491_1658010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009906909.1|1659263_1660496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009906910.1|1660528_1661326_-	outer membrane lipoprotein-sorting protein	NA	NA	NA	NA	NA
WP_080558214.1|1662640_1663525_+	citrate/2-methylcitrate synthase	NA	NA	NA	NA	NA
WP_009906916.1|1663661_1664438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009906917.1|1664447_1665011_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_025405683.1|1666544_1667141_-	plasmid pRiA4b ORF-3 family protein	NA	A0A2H4PDG5	Mycobacterium_phage	39.7	1.1e-28
WP_069255288.1|1667180_1668743_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	52.1	3.5e-143
WP_025404693.1|1668772_1669120_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	71.0	1.2e-40
WP_082264242.1|1669119_1669482_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_085952127.1|1669821_1671059_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	95.1	5.8e-157
WP_135351059.1|1671389_1671611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080554994.1|1671659_1672928_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	43.3	1.3e-39
WP_080554993.1|1673050_1673764_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_019255942.1|1673798_1675625_-	FAD/NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_080554992.1|1675621_1678300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019255940.1|1678321_1679104_-	radical SAM protein	NA	NA	NA	NA	NA
WP_019255939.1|1679149_1679941_-	TIM barrel protein	NA	NA	NA	NA	NA
WP_100085574.1|1679906_1681121_-	sedoheptulose 7-phosphate cyclase	NA	A9YVT7	Ostreococcus_tauri_virus	27.9	6.5e-20
WP_082264362.1|1681177_1682386_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2P1ELT3	Moumouvirus	31.7	9.0e-30
WP_019255936.1|1682672_1684508_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_025405685.1|1684546_1685752_-	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	24.2	3.9e-17
WP_019255934.1|1685860_1687300_-	amidase	NA	NA	NA	NA	NA
WP_135351058.1|1687292_1690445_-	amino acid adenylation domain-containing protein	NA	A0A2K9L3I8	Tupanvirus	29.5	2.3e-64
WP_019255931.1|1690580_1691192_-	acyl-homoserine-lactone synthase	NA	NA	NA	NA	NA
WP_025405687.1|1691651_1692365_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_102827097.1|1692904_1694048_+|transposase	IS3 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	63.3	1.0e-99
>prophage 5
NZ_CP013410	Burkholderia thailandensis strain 2002721121 chromosome 2, complete sequence	2940149	2283725	2350407	2940149	holin,plate	Aeromonas_phage(25.0%)	48	NA	NA
WP_009900960.1|2283725_2284676_-|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
WP_009900964.1|2284943_2285888_+	GlxA family transcriptional regulator	NA	NA	NA	NA	NA
WP_009900966.1|2286361_2288065_+	peptidase	NA	NA	NA	NA	NA
WP_019254803.1|2288183_2289410_+	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_009907969.1|2289468_2290611_-	porin	NA	NA	NA	NA	NA
WP_045143333.1|2290838_2291837_-|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
WP_009900970.1|2291872_2293426_-|holin	choline-sulfatase	holin	NA	NA	NA	NA
WP_080554767.1|2293561_2294461_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_025405820.1|2294604_2295480_+	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
WP_009898039.1|2295566_2297222_-	APC family permease	NA	NA	NA	NA	NA
WP_009900973.1|2297401_2298265_-	glycine betaine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_019254807.1|2298374_2299514_-	hybrid-cluster NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_009898044.1|2299534_2300776_-	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_009900977.1|2300827_2301613_-	drug:proton antiporter	NA	NA	NA	NA	NA
WP_009900978.1|2301609_2302791_-	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
WP_009900979.1|2302795_2304721_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_025405821.1|2304723_2306787_-	NADH:flavin oxidoreductase	NA	NA	NA	NA	NA
WP_009898053.1|2306847_2307381_-	4-vinyl reductase	NA	NA	NA	NA	NA
WP_009900981.1|2307528_2308500_-	membrane dipeptidase	NA	NA	NA	NA	NA
WP_009898057.1|2308571_2309846_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	53.4	6.9e-105
WP_080511307.1|2309857_2310097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009898058.1|2310254_2311280_+	GlxA family transcriptional regulator	NA	NA	NA	NA	NA
WP_019254810.1|2311472_2312672_-	formaldehyde dehydrogenase, glutathione-independent	NA	A0A2K9L7I1	Tupanvirus	26.8	1.4e-11
WP_009900983.1|2313017_2314034_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_080554769.1|2314220_2315792_+	glycoside hydrolase 68 family protein	NA	NA	NA	NA	NA
WP_025405823.1|2315910_2317584_+	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	31.0	1.3e-55
WP_025405551.1|2319497_2321060_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_009906874.1|2321112_2322078_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_009896564.1|2322210_2323782_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_025405549.1|2323778_2325056_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_009896560.1|2325335_2326235_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_102815683.1|2326514_2326631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011401418.1|2326807_2327179_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025405824.1|2327399_2327831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009893756.1|2327853_2328213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025405825.1|2328271_2331772_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_011401420.1|2331768_2333553_-	OmpA family protein	NA	NA	NA	NA	NA
WP_009893759.1|2333578_2334940_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_009900994.1|2334936_2335530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009893761.1|2335535_2335925_-	DUF4150 domain-containing protein	NA	NA	NA	NA	NA
WP_009893763.1|2335964_2336681_-	DUF3540 domain-containing protein	NA	NA	NA	NA	NA
WP_009900995.1|2336683_2337754_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_009900996.1|2337753_2339970_-	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_069255291.1|2339973_2342262_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_025405827.1|2342430_2344722_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_009901009.1|2344712_2347556_-	type VI secretion system ATPase TssH	NA	A0A2I7REQ1	Vibrio_phage	27.0	1.2e-61
WP_009901010.1|2347558_2348548_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_009901011.1|2348544_2350407_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
