The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP013404	Burkholderia lata strain FL-7-5-30-S1-D0 chromosome 1, complete sequence	3756401	212357	287619	3756401	plate,tail,holin,integrase	Burkholderia_phage(67.74%)	74	205053:205073	284134:284154
205053:205073	attL	CGGTGTAGCCGGTGCGCGCGA	NA	NA	NA	NA
WP_069246816.1|212357_213479_-|integrase	site-specific integrase	integrase	A0A1S5NNJ1	Burkholderia_phage	80.1	3.6e-166
WP_083265820.1|213805_214177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069246818.1|214173_216966_-	hypothetical protein	NA	E5E3N5	Burkholderia_phage	91.0	0.0e+00
WP_069246819.1|216973_217240_-	hypothetical protein	NA	A4JWQ9	Burkholderia_virus	64.7	4.4e-14
WP_048251455.1|217429_217678_-	ogr/Delta-like zinc finger family protein	NA	K4PAZ0	Burkholderia_phage	90.2	1.7e-36
WP_069246820.1|217858_218074_-	hypothetical protein	NA	E5E3U1	Burkholderia_phage	81.2	5.7e-20
WP_144020617.1|218164_218656_+	helix-turn-helix domain-containing protein	NA	E5E3U2	Burkholderia_phage	60.1	2.4e-45
WP_069246821.1|218968_219265_+	hypothetical protein	NA	E5E3U3	Burkholderia_phage	48.4	3.9e-11
WP_069246822.1|219424_220495_-	phage late control D family protein	NA	K4PAY4	Burkholderia_phage	72.5	1.8e-135
WP_069246823.1|220491_220923_-|tail	phage tail protein	tail	K4NXK5	Burkholderia_phage	64.9	2.1e-42
WP_069246824.1|220947_223509_-	hypothetical protein	NA	A4JWS3	Burkholderia_virus	45.1	4.7e-145
WP_006484104.1|223524_223638_-|tail	GpE family phage tail protein	tail	A0A089FGX3	Burkholderia_phage	85.7	1.1e-09
WP_069246825.1|223646_224027_-|tail	phage tail assembly protein	tail	K4NXA3	Burkholderia_phage	67.9	1.8e-29
WP_080486860.1|224101_224605_-|tail	phage major tail tube protein	tail	E5E3U9	Burkholderia_phage	74.3	2.2e-70
WP_069246826.1|224639_225812_-|tail	phage tail sheath protein	tail	A4JWS7	Burkholderia_virus	81.7	3.9e-187
WP_069246827.1|225872_226571_-|tail	tail assembly chaperone	tail	E5E3V1	Burkholderia_phage	80.2	8.8e-86
WP_069246828.1|226588_229153_-|tail	phage tail protein	tail	E5E3V2	Burkholderia_phage	67.5	1.0e-293
WP_069246829.1|229159_229702_-|tail	phage tail protein I	tail	E5FFH2	Burkholderia_phage	72.6	1.1e-70
WP_069246830.1|229694_230609_-|plate	baseplate assembly protein	plate	E5FFH3	Burkholderia_phage	72.6	3.5e-119
WP_069246831.1|230605_230968_-|plate	baseplate assembly protein	plate	K4PAX6	Burkholderia_phage	70.0	1.2e-41
WP_069246832.1|230964_231651_-|plate	phage baseplate assembly protein V	plate	K4NXJ5	Burkholderia_phage	68.7	3.4e-82
WP_069246833.1|232232_232682_-|tail	phage tail protein	tail	E5E3V9	Burkholderia_phage	54.2	6.8e-31
WP_083265821.1|232674_232845_-	peptidase	NA	K4PAX1	Burkholderia_phage	67.4	3.6e-09
WP_083265822.1|232798_233239_-	protein lysB	NA	NA	NA	NA	NA
WP_069246835.1|233235_234081_-	DUF3380 domain-containing protein	NA	A4JWZ0	Burkholderia_virus	66.2	3.8e-91
WP_069246836.1|234084_234351_-|holin	phage holin family protein	holin	E5E3W3	Burkholderia_phage	59.8	6.4e-21
WP_069246837.1|234352_234697_-	hypothetical protein	NA	A4JWU2	Burkholderia_virus	79.6	2.6e-38
WP_069246838.1|234713_234920_-|tail	phage tail protein	tail	E5E3W5	Burkholderia_phage	69.1	2.7e-19
WP_069246839.1|235620_237168_+	TIGR04222 domain-containing membrane protein	NA	NA	NA	NA	NA
WP_069246840.1|237238_240604_-	glycosyltransferase	NA	A0A1V0SLJ0	Klosneuvirus	23.8	4.9e-09
WP_069246841.1|240606_241764_-	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	41.3	1.1e-19
WP_069246842.1|241820_242468_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_089444747.1|242478_243201_-	WbqC family protein	NA	NA	NA	NA	NA
WP_069246844.1|243197_244583_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_069246845.1|244579_245365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143750862.1|245509_245773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069246846.1|245771_247559_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_069246847.1|247800_249999_+	glycosyltransferase family 41 protein	NA	NA	NA	NA	NA
WP_069246848.1|249995_252482_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_069246849.1|252722_253019_-	flagellar protein FliT	NA	NA	NA	NA	NA
WP_069246850.1|253052_254471_-	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_069246851.1|254664_255483_-	flagellin	NA	NA	NA	NA	NA
WP_006401410.1|256028_256241_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_069246852.1|256362_256965_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_069246853.1|257107_257989_+	ATPase	NA	NA	NA	NA	NA
WP_069246854.1|258125_258950_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_069246855.1|259068_259812_-	aquaporin Z	NA	NA	NA	NA	NA
WP_021162849.1|260112_260409_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_069246856.1|260514_261579_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_027788649.1|262226_262547_+	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_011350591.1|262639_263194_+	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_069246857.1|263374_264235_+	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_069246858.1|264248_265274_+	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_011350594.1|265298_265676_+	response regulator	NA	NA	NA	NA	NA
WP_069246859.1|265709_267962_+	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_043185043.1|268013_268529_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_069246860.1|268566_270534_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	58.7	1.3e-09
WP_069246861.1|270537_271521_+	chemotaxis protein CheR	NA	NA	NA	NA	NA
WP_069246862.1|271517_272243_+	chemoreceptor glutamine deamidase CheD	NA	NA	NA	NA	NA
WP_069246863.1|272239_273331_+	chemotaxis response regulator protein-glutamate methylesterase	NA	NA	NA	NA	NA
WP_039346818.1|273398_273794_+	chemotaxis protein CheY	NA	Q56AR1	Bacillus_thuringiensis_phage	31.9	2.1e-07
WP_069246864.1|273795_274527_+	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_069246865.1|274787_275291_+	DUF2844 domain-containing protein	NA	NA	NA	NA	NA
WP_069246866.1|275307_276546_+	DUF3443 family protein	NA	NA	NA	NA	NA
WP_069246867.1|276713_277211_+	VOC family protein	NA	NA	NA	NA	NA
WP_156814476.1|277292_278030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069246869.1|278087_278468_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_069246870.1|278811_280011_+	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_069246871.1|280007_282110_+	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_069246872.1|282106_283861_+	flagellar biosynthesis protein FlhF	NA	NA	NA	NA	NA
WP_069246873.1|283853_284672_+	flagellar biosynthesis protein FlhG	NA	NA	NA	NA	NA
284134:284154	attR	TCGCGCGCACCGGCTACACCG	NA	NA	NA	NA
WP_006484033.1|284694_285429_+	RNA polymerase sigma factor FliA	NA	NA	NA	NA	NA
WP_069246874.1|285684_287103_+	adenosylhomocysteinase	NA	S4VPF6	Pandoravirus	30.1	1.7e-43
WP_006477367.1|287265_287619_+|holin	phage holin family protein	holin	NA	NA	NA	NA
>prophage 2
NZ_CP013404	Burkholderia lata strain FL-7-5-30-S1-D0 chromosome 1, complete sequence	3756401	469648	517398	3756401	protease,tail,plate	uncultured_Caudovirales_phage(50.0%)	38	NA	NA
WP_069246975.1|469648_470176_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	45.9	4.8e-20
WP_156814533.1|470393_470903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069246977.1|470973_471708_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_083265938.1|471709_472966_-	histidine kinase	NA	NA	NA	NA	NA
WP_069246979.1|473210_473753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011350748.1|474098_474302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069246980.1|474361_475162_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_069249205.1|475483_478663_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	28.9	2.1e-57
WP_069246981.1|483283_483787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156814479.1|484586_485012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069246982.1|485461_485779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069246983.1|485885_486317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069246984.1|486409_486991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089444847.1|487093_487354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069246986.1|487424_487829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069249206.1|487860_488220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156814480.1|488249_488792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069246987.1|489005_489788_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_069246988.1|489784_491131_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_069246989.1|491234_491846_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_069246990.1|492221_492860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027783377.1|492906_493422_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_011350759.1|493437_494928_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_006477093.1|494998_495502_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_006477092.1|495564_496050_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_069246991.1|496127_497963_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_069246992.1|497926_499027_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_069246993.1|499070_501740_+	type VI secretion system ATPase TssH	NA	A0A223W0B1	Agrobacterium_phage	31.8	2.2e-89
WP_069246994.1|501782_502904_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_069246995.1|502972_505651_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	27.6	1.9e-48
WP_069249207.1|505859_507137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069246996.1|507133_507919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069246997.1|508369_509122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156814534.1|509260_510211_-	OmpA family protein	NA	NA	NA	NA	NA
WP_069246999.1|510227_511217_-	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_069247000.1|511213_515158_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_069247001.1|515459_516305_-	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_069247002.1|516426_517398_+|tail	phage tail protein	tail	NA	NA	NA	NA
>prophage 3
NZ_CP013404	Burkholderia lata strain FL-7-5-30-S1-D0 chromosome 1, complete sequence	3756401	814464	823546	3756401		Hokovirus(16.67%)	7	NA	NA
WP_069247195.1|814464_816417_+	molecular chaperone DnaK	NA	A0A1V0SH73	Hokovirus	50.5	1.1e-146
WP_069247196.1|816685_817822_+	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	26.8	5.9e-23
WP_069247197.1|817835_819764_+	bifunctional anthranilate synthase component I family protein/class IV aminotransferase	NA	S4VT78	Pandoravirus	36.6	4.0e-56
WP_069247198.1|819885_820701_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	32.5	2.6e-36
WP_069247199.1|820746_821433_-	deoxynucleoside kinase	NA	A0A0M3UL55	Enterococcus_phage	27.3	1.2e-07
WP_069247200.1|821429_821972_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_069247201.1|822007_823546_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	31.0	1.0e-22
>prophage 4
NZ_CP013404	Burkholderia lata strain FL-7-5-30-S1-D0 chromosome 1, complete sequence	3756401	1058300	1068939	3756401	transposase,tRNA	Bacillus_virus(33.33%)	9	NA	NA
WP_156814484.1|1058300_1059522_+|transposase	IS3 family transposase	transposase	B6DZX3	Stx2-converting_phage	29.1	3.0e-17
WP_027788121.1|1059587_1060211_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_069247374.1|1060197_1060977_-	DNA mismatch repair protein MutS	NA	A0A0P0IDT4	Acinetobacter_phage	31.9	2.2e-13
WP_069247375.1|1061113_1062076_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	42.9	5.5e-62
WP_069247376.1|1062506_1064816_+	DNA translocase FtsK	NA	G1FGP1	Mycobacterium_phage	50.3	3.8e-85
WP_069247377.1|1064862_1065552_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_069247378.1|1065750_1067061_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.2	4.2e-81
WP_047850576.1|1067107_1067374_-	DUF2164 domain-containing protein	NA	NA	NA	NA	NA
WP_069247379.1|1067637_1068939_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	46.4	2.7e-96
>prophage 5
NZ_CP013404	Burkholderia lata strain FL-7-5-30-S1-D0 chromosome 1, complete sequence	3756401	1151154	1159437	3756401		Bacillus_phage(16.67%)	8	NA	NA
WP_069247434.1|1151154_1152555_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	38.1	1.8e-77
WP_069247435.1|1152562_1153513_+	D-glycero-beta-D-manno-heptose-7-phosphate kinase	NA	A0A2H4N7X4	Lake_Baikal_phage	27.4	3.4e-16
WP_069247436.1|1153576_1154569_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	31.5	1.2e-27
WP_069247437.1|1154643_1154985_+	competence protein ComE	NA	NA	NA	NA	NA
WP_069247438.1|1155196_1156099_+	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	40.2	2.2e-52
WP_083265851.1|1156177_1157521_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_069247440.1|1157564_1158488_+	histone deacetylase family protein	NA	A0A2K9KZC4	Tupanvirus	34.9	6.7e-41
WP_069247441.1|1158516_1159437_-	alpha/beta hydrolase	NA	Q6TUZ7	Yaba_monkey_tumor_virus	27.2	6.7e-17
>prophage 6
NZ_CP013404	Burkholderia lata strain FL-7-5-30-S1-D0 chromosome 1, complete sequence	3756401	2232860	2305253	3756401	tail,holin,integrase,protease,transposase,plate	uncultured_Caudovirales_phage(23.08%)	68	2230182:2230199	2294554:2294571
2230182:2230199	attL	CGTGACGTCGAGCGATGC	NA	NA	NA	NA
WP_069248161.1|2232860_2233820_-	alpha/beta hydrolase	NA	A0A167RJ59	Powai_lake_megavirus	33.8	1.4e-30
WP_046545900.1|2233992_2234472_-	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_027787175.1|2234468_2234783_-	Dabb family protein	NA	NA	NA	NA	NA
WP_069248162.1|2234961_2236194_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	39.7	8.0e-74
WP_069248163.1|2236296_2237775_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	35.4	5.3e-16
WP_069248164.1|2237954_2238611_-	hypothetical protein	NA	Q8W6R8	Burkholderia_virus	59.9	8.2e-78
WP_069248165.1|2238830_2240381_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	52.8	2.0e-143
WP_069248166.1|2240432_2240780_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	65.7	5.4e-36
WP_083265947.1|2240776_2241199_-	IS66 family insertion sequence hypothetical protein	NA	A0A1B0YZU7	Pseudomonas_phage	43.3	1.9e-06
WP_083265948.1|2241856_2242180_-	hypothetical protein	NA	A4PE26	Ralstonia_virus	46.9	6.8e-17
WP_083265887.1|2242585_2243197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083265888.1|2243084_2243555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069248170.1|2243544_2244042_-	DUF4123 domain-containing protein	NA	A4PE24	Ralstonia_virus	36.0	1.2e-15
WP_083265889.1|2244048_2244684_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_069248172.1|2244652_2245438_-	DNA adenine methylase	NA	Q8W6S4	Burkholderia_virus	82.8	2.8e-133
WP_069248173.1|2245605_2246100_-	DUF2514 family protein	NA	C7BGD9	Burkholderia_phage	60.8	6.7e-40
WP_069248174.1|2246096_2246591_-	glycoside hydrolase family 104 protein	NA	Q6J1Q5	Burkholderia_virus	84.8	4.9e-75
WP_069248175.1|2246593_2246878_-|holin	holin	holin	C7BGD7	Burkholderia_phage	94.7	1.7e-40
WP_069248176.1|2246953_2248003_-	late control protein	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	46.6	4.0e-82
WP_069248177.1|2248012_2248219_-|tail	phage tail protein	tail	A0A2H4J9Z9	uncultured_Caudovirales_phage	58.2	9.0e-15
WP_069248178.1|2248193_2249072_-|tail	phage tail protein	tail	A0A2H4J875	uncultured_Caudovirales_phage	37.9	3.4e-34
WP_069248179.1|2249082_2251521_-|tail	phage tail protein	tail	A0A2H4JG00	uncultured_Caudovirales_phage	33.3	4.8e-54
WP_069248180.1|2251601_2251904_-|tail	phage tail assembly protein	tail	A0A1B2LRV6	Wolbachia_phage	39.0	3.0e-06
WP_069248181.1|2252001_2252505_-|tail	phage major tail tube protein	tail	Q7M2A5	Pseudomonas_phage	55.6	1.6e-44
WP_069248182.1|2252514_2253684_-|tail	phage tail sheath family protein	tail	A0A2H4J869	uncultured_Caudovirales_phage	71.6	1.0e-155
WP_069248183.1|2253759_2254539_-|tail	phage tail protein	tail	E5E3Q6	Burkholderia_phage	57.4	9.5e-57
WP_069248184.1|2254554_2256552_-|tail	tail fiber protein	tail	E5E3V2	Burkholderia_phage	52.2	1.5e-109
WP_069248185.1|2256539_2257118_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	44.1	1.6e-29
WP_069248186.1|2257107_2258004_-|plate	baseplate J protein	plate	A0A2H4JFK9	uncultured_Caudovirales_phage	45.5	6.4e-49
WP_069248187.1|2258000_2258336_-|plate	phage baseplate protein	plate	A0A2H4JA09	uncultured_Caudovirales_phage	48.1	8.6e-23
WP_069248188.1|2258335_2258536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156814500.1|2258602_2259331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069248189.1|2259427_2260108_-|plate	phage baseplate assembly protein V	plate	E5FFH5	Burkholderia_phage	33.7	6.9e-19
WP_069248190.1|2260111_2260636_-	hypothetical protein	NA	A0A1B2LRU9	Wolbachia_phage	44.4	5.0e-25
WP_069248191.1|2260625_2261156_-|tail	phage tail protein	tail	A0A2H4JBV1	uncultured_Caudovirales_phage	32.5	6.8e-14
WP_069248192.1|2261158_2261446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069248193.1|2262602_2262944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083265890.1|2262958_2263162_+	AlpA family phage regulatory protein	NA	A0A2H4J8C8	uncultured_Caudovirales_phage	38.9	2.9e-05
WP_069248194.1|2263225_2265298_-	Na/Pi cotransporter family protein	NA	NA	NA	NA	NA
WP_069248195.1|2265970_2266498_-	2'-5' RNA ligase family protein	NA	NA	NA	NA	NA
WP_083265949.1|2266577_2267153_-	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_069248196.1|2267274_2267676_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_083265950.1|2267763_2268063_+	hydrogenase maturation factor	NA	NA	NA	NA	NA
WP_156814501.1|2269478_2269745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083265891.1|2269850_2270318_+	avidin	NA	NA	NA	NA	NA
WP_069248198.1|2270837_2271761_+	recombination-associated protein RdgC	NA	A0A218M310	Acidovorax_phage	41.0	4.3e-56
WP_069248199.1|2272039_2272570_-	isochorismatase family protein	NA	NA	NA	NA	NA
WP_069248200.1|2273394_2275539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069248201.1|2275702_2277103_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	31.9	2.4e-18
WP_069248202.1|2277364_2278543_-	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_069248203.1|2278875_2279508_-	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L2K0	Tupanvirus	37.1	1.4e-21
WP_069248204.1|2279548_2281633_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_069248205.1|2281834_2283478_-	fatty-acid--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	22.8	5.5e-22
WP_069248206.1|2283624_2285193_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	31.3	5.2e-54
WP_046545914.1|2285237_2285669_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_069248207.1|2285794_2286325_+	septation protein A	NA	NA	NA	NA	NA
WP_021163397.1|2286326_2286635_+	BolA family transcriptional regulator	NA	NA	NA	NA	NA
WP_069248208.1|2286653_2287436_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_069249317.1|2287611_2288157_-	N-acetyltransferase	NA	A9YX37	Burkholderia_phage	72.5	1.8e-06
WP_069248209.1|2288162_2292227_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	91.6	9.9e-222
WP_069248210.1|2292557_2293859_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_069248211.1|2293911_2295456_+	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
2294554:2294571	attR	GCATCGCTCGACGTCACG	NA	NA	NA	NA
WP_069248212.1|2295567_2297190_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_069248213.1|2297257_2297971_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.9	1.0e-33
WP_069248214.1|2297969_2298644_+	arylesterase	NA	NA	NA	NA	NA
WP_069248215.1|2298714_2300649_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_011352361.1|2301360_2303784_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	53.2	6.3e-224
WP_006489345.1|2303981_2305253_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	58.3	6.0e-133
>prophage 1
NZ_CP013406	Burkholderia lata strain FL-7-5-30-S1-D0 chromosome 2, complete sequence	3386917	2543023	2587488	3386917	head,terminase,integrase,tail,capsid,portal	Ralstonia_phage(28.57%)	46	2528081:2528097	2575652:2575668
2528081:2528097	attL	AGGTTCACCGCGCCGGT	NA	NA	NA	NA
WP_069252202.1|2543023_2544475_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_069252203.1|2544553_2545096_+	lysozyme	NA	A0A0A1I5L5	Burkholderia_phage	48.9	2.1e-26
WP_069252204.1|2545167_2545875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069252205.1|2545889_2546549_-	hypothetical protein	NA	Q8W6R8	Burkholderia_virus	60.4	1.0e-80
WP_069252207.1|2547015_2547876_-	hypothetical protein	NA	Q3HQV2	Burkholderia_phage	67.0	2.8e-102
WP_069252208.1|2547942_2550252_-	DNA-dependent RNA polymerase	NA	A0A223VZI2	Agrobacterium_phage	31.0	1.4e-68
WP_069252209.1|2550997_2551189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069252210.1|2551185_2551488_-	hypothetical protein	NA	D2EBS7	Pseudomonas_phage	68.9	9.5e-29
WP_069252212.1|2551909_2552701_-	RNase H superfamily protein	NA	A0A2P0VPF6	Ralstonia_phage	65.0	8.7e-98
WP_069252213.1|2552697_2553087_-	hypothetical protein	NA	A0A1L7DQG2	Ralstonia_phage	57.1	2.6e-23
WP_069253013.1|2553058_2553835_-	phosphodiesterase	NA	A0A1L7DQH5	Ralstonia_phage	50.8	4.5e-67
WP_069252214.1|2553990_2554821_-	hypothetical protein	NA	A0A068Q6Y4	Ralstonia_phage	54.1	4.0e-69
WP_069253014.1|2554840_2557180_-	DNA polymerase A family protein	NA	A0A068Q7T8	Ralstonia_phage	66.7	7.0e-305
WP_069253015.1|2557226_2557781_-	metal-dependent phosphohydrolase	NA	A0A2D1GNL9	Pseudomonas_phage	50.6	6.4e-39
WP_069252215.1|2557851_2558808_-	ATP-dependent DNA ligase	NA	A0A068Q5W4	Ralstonia_phage	47.5	5.6e-67
WP_069252216.1|2558910_2559219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069252217.1|2559352_2560648_-	AAA family ATPase	NA	A0A068Q6G7	Ralstonia_phage	60.2	4.6e-149
WP_069252218.1|2560808_2561327_-	DNA primase	NA	F1ADP9	Caulobacter_phage	46.0	8.9e-35
WP_156814665.1|2561638_2561929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069252220.1|2561841_2562129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069252221.1|2562145_2562397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069252222.1|2562396_2562789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156814696.1|2563087_2563294_-	hypothetical protein	NA	B5BTU9	Ralstonia_phage	72.1	1.2e-19
WP_069252223.1|2563524_2564136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069252224.1|2564253_2564481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069252225.1|2564477_2564711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083266154.1|2565388_2566558_+	helix-turn-helix transcriptional regulator	NA	A0A0A7DJB4	Pseudomonas_phage	33.3	9.7e-21
WP_156814666.1|2566611_2567238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156814667.1|2568753_2569161_+	TerS protein	NA	A0A0F7L441	uncultured_marine_virus	54.1	2.0e-29
WP_069252227.1|2569157_2570747_+|terminase	terminase large subunit	terminase	Q9MCV7	Escherichia_phage	65.1	1.4e-184
WP_069252228.1|2570766_2571360_+	peptidase U35	NA	A0A0R6PGI7	Moraxella_phage	46.4	1.4e-31
WP_060328821.1|2571369_2572704_+|capsid	phage major capsid protein	capsid	S4TNE3	Salmonella_phage	40.8	3.7e-77
WP_155633547.1|2572763_2572934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059693942.1|2572930_2574268_+|portal	phage portal protein	portal	A0A0R6PHI5	Moraxella_phage	44.1	2.3e-82
WP_059693941.1|2574260_2574551_+|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_059694317.1|2574556_2574922_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	32.0	6.1e-06
WP_059693940.1|2574914_2575271_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_059693939.1|2575270_2575708_+|tail	phage tail protein	tail	NA	NA	NA	NA
2575652:2575668	attR	ACCGGCGCGGTGAACCT	NA	NA	NA	NA
WP_069252229.1|2575856_2576192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069252230.1|2576522_2576966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069252231.1|2576962_2579785_+|tail	phage tail tape measure protein	tail	A0A2H4J7J3	uncultured_Caudovirales_phage	23.0	8.1e-21
WP_069253017.1|2579781_2580126_+|tail	phage tail protein	tail	Q8W6T5	Burkholderia_virus	46.4	5.5e-17
WP_083266155.1|2581621_2582302_+|tail	phage minor tail protein L	tail	A4JX13	Burkholderia_virus	51.3	5.8e-58
WP_083266215.1|2582301_2583030_+|tail	phage tail protein	tail	Q8W6T2	Burkholderia_virus	59.2	1.2e-82
WP_156814697.1|2583049_2583610_+|tail	tail assembly protein	tail	Q6JIL3	Burkholderia_virus	55.4	1.4e-49
WP_069252234.1|2583606_2587488_+	DUF1983 domain-containing protein	NA	C7BGD4	Burkholderia_phage	63.7	3.9e-300
