The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP013398	Burkholderia seminalis strain FL-5-4-10-S1-D7 chromosome 1, complete sequence	3505262	750528	759528	3505262		Hokovirus(16.67%)	7	NA	NA
WP_021162213.1|750528_752481_+	molecular chaperone DnaK	NA	A0A1V0SH73	Hokovirus	49.9	4.1e-149
WP_034187169.1|752746_753883_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	38.8	4.5e-23
WP_059557317.1|753887_755753_+	aminodeoxychorismate synthase component I	NA	S4VNU7	Pandoravirus	38.8	2.6e-60
WP_034187171.1|755869_756685_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	33.3	6.7e-37
WP_034187172.1|756728_757415_-	deoxynucleoside kinase	NA	A0A0M3UL55	Enterococcus_phage	26.4	7.2e-08
WP_034187173.1|757411_757954_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_034187174.1|757989_759528_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	31.0	7.2e-24
>prophage 2
NZ_CP013398	Burkholderia seminalis strain FL-5-4-10-S1-D7 chromosome 1, complete sequence	3505262	994985	1005491	3505262	tRNA	Bacillus_virus(33.33%)	9	NA	NA
WP_034187345.1|994985_996104_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	35.3	4.0e-24
WP_006491172.1|996197_996821_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_049030588.1|996807_997587_-	DNA mismatch repair protein MutS	NA	A0A0P0IDT4	Acinetobacter_phage	32.0	5.9e-14
WP_034187347.1|997722_998685_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	42.9	1.6e-61
WP_034187348.1|999081_1001391_+	DNA translocase FtsK	NA	G1FGP1	Mycobacterium_phage	50.0	6.5e-85
WP_059557148.1|1001437_1002127_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_034187350.1|1002310_1003621_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.5	2.5e-81
WP_034187351.1|1003669_1003939_-	DUF2164 domain-containing protein	NA	NA	NA	NA	NA
WP_034187352.1|1004189_1005491_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	51.1	1.2e-93
>prophage 3
NZ_CP013398	Burkholderia seminalis strain FL-5-4-10-S1-D7 chromosome 1, complete sequence	3505262	1083323	1091645	3505262		Bacillus_phage(16.67%)	8	NA	NA
WP_034187429.1|1083323_1084724_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	38.3	1.0e-77
WP_051700958.1|1084731_1085682_+	D-glycero-beta-D-manno-heptose-7-phosphate kinase	NA	A0A2H4N7X4	Lake_Baikal_phage	26.8	3.8e-15
WP_034187430.1|1085745_1086738_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	31.5	3.7e-29
WP_034187431.1|1086812_1087166_+	competence protein ComE	NA	NA	NA	NA	NA
WP_034187432.1|1087389_1088292_+	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	40.2	1.7e-52
WP_080287788.1|1088371_1089721_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_034187434.1|1089764_1090688_+	histone deacetylase family protein	NA	A0A2K9KZC4	Tupanvirus	34.9	8.7e-41
WP_059557121.1|1090724_1091645_-	alpha/beta hydrolase	NA	Q6TUZ7	Yaba_monkey_tumor_virus	27.2	1.0e-17
>prophage 4
NZ_CP013398	Burkholderia seminalis strain FL-5-4-10-S1-D7 chromosome 1, complete sequence	3505262	1159400	1242028	3505262	portal,head,terminase,tail,plate,protease,integrase,capsid,holin	uncultured_Caudovirales_phage(28.95%)	89	1173956:1173975	1193742:1193761
WP_034186504.1|1159400_1160900_+|protease	DegQ family serine endoprotease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	29.3	1.9e-21
WP_034186505.1|1160907_1161144_+	glutaredoxin family protein	NA	NA	NA	NA	NA
WP_034186506.1|1161312_1163106_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	23.7	2.3e-21
WP_034186507.1|1163122_1164016_+	signal peptidase I	NA	NA	NA	NA	NA
WP_059560706.1|1164169_1165360_+	ribonuclease III	NA	G8DDA3	Micromonas_pusilla_virus	30.7	4.1e-19
WP_034186509.1|1165420_1166320_+	GTPase Era	NA	NA	NA	NA	NA
WP_034186510.1|1166306_1167143_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_034186511.1|1167139_1167916_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_034186512.1|1167949_1168384_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_059560703.1|1168400_1169429_+	beta-N-acetylhexosaminidase	NA	NA	NA	NA	NA
WP_059560702.1|1169591_1170977_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_034186515.1|1171245_1171803_-	elongation factor P	NA	NA	NA	NA	NA
WP_059560699.1|1171929_1173123_-	elongation factor P maturation arginine rhamnosyltransferase EarP	NA	NA	NA	NA	NA
WP_034186517.1|1173199_1175245_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
1173956:1173975	attL	GGCGGCGACAGCGACGTCGA	NA	NA	NA	NA
WP_034186518.1|1175336_1175924_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_069245556.1|1176749_1177949_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1L7DQ84	Ralstonia_phage	33.3	5.1e-17
WP_156810487.1|1177970_1178858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069245558.1|1178908_1179250_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_069245559.1|1179246_1179507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156810488.1|1179523_1179985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069245561.1|1179981_1180353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069245562.1|1180454_1182062_-	pyridoxal phosphate biosynthetic protein PdxJ	NA	NA	NA	NA	NA
WP_069245732.1|1182061_1182424_-	beta-hexosaminidase	NA	NA	NA	NA	NA
WP_069245563.1|1182474_1182693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156810489.1|1182822_1183287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069245565.1|1183231_1183741_-	helix-turn-helix transcriptional regulator	NA	G9L6A6	Escherichia_phage	41.3	6.1e-12
WP_059456070.1|1183857_1184082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034188740.1|1184138_1184711_+	hypothetical protein	NA	C7BGG0	Burkholderia_phage	46.8	1.1e-28
WP_069245733.1|1184697_1185081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069245566.1|1185341_1187849_+	virulence protein E	NA	A0A2D1GN57	Marinobacter_phage	40.2	2.2e-94
WP_069245567.1|1188071_1188845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059554247.1|1189092_1189287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069245568.1|1189783_1191895_+|terminase	phage terminase large subunit family protein	terminase	A0A2D1GMT1	Marinobacter_phage	53.8	4.9e-180
WP_006497114.1|1191908_1192115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069245569.1|1192111_1193605_+|portal	phage portal protein	portal	A0A2H4JFL5	uncultured_Caudovirales_phage	50.9	2.0e-135
WP_069245570.1|1193601_1194669_+|protease	Clp protease ClpP	protease	A0A2H4JDI2	uncultured_Caudovirales_phage	37.5	3.4e-49
1193742:1193761	attR	GGCGGCGACAGCGACGTCGA	NA	NA	NA	NA
WP_069245571.1|1194699_1195044_+|head	head decoration protein	head	NA	NA	NA	NA
WP_069245572.1|1195117_1196113_+|capsid	major capsid protein	capsid	A0A2H4J890	uncultured_Caudovirales_phage	60.6	6.4e-114
WP_069245573.1|1196114_1196402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069245574.1|1196404_1196935_+|tail	phage tail protein	tail	A0A2H4JBV1	uncultured_Caudovirales_phage	30.1	1.2e-10
WP_069245575.1|1196924_1197449_+	hypothetical protein	NA	Q75QM3	Wolbachia_phage	41.2	4.2e-24
WP_069245576.1|1197452_1198133_+|plate	phage baseplate assembly protein V	plate	E5FFH5	Burkholderia_phage	32.6	5.3e-19
WP_069245577.1|1198241_1199057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069245578.1|1199122_1199323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069245579.1|1199322_1199658_+|plate	phage baseplate protein	plate	A0A2H4JA09	uncultured_Caudovirales_phage	48.1	3.9e-23
WP_069245580.1|1199654_1200551_+|plate	baseplate J protein	plate	A0A2H4JFK9	uncultured_Caudovirales_phage	42.0	1.3e-46
WP_069245734.1|1200540_1201119_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	42.1	2.0e-27
WP_069245581.1|1201106_1203095_+|tail	tail fiber protein	tail	E5E3V2	Burkholderia_phage	54.9	3.0e-107
WP_069245582.1|1203110_1203863_+|tail	phage tail protein	tail	E5E3Q6	Burkholderia_phage	57.4	9.2e-57
WP_069245583.1|1203946_1205116_+|tail	phage tail sheath family protein	tail	A0A2H4J869	uncultured_Caudovirales_phage	72.1	1.9e-157
WP_069245584.1|1205126_1205630_+|tail	phage major tail tube protein	tail	Q7M2A5	Pseudomonas_phage	52.5	1.5e-42
WP_069245585.1|1205726_1206029_+|tail	phage tail assembly protein	tail	A0A193GYZ8	Enterobacter_phage	37.7	1.0e-06
WP_069245586.1|1206109_1208560_+|tail	phage tail tape measure protein	tail	A0A2H4JG00	uncultured_Caudovirales_phage	34.6	1.6e-57
WP_069245587.1|1208570_1209449_+|tail	phage tail protein	tail	A0A2H4J875	uncultured_Caudovirales_phage	37.5	8.9e-35
WP_059463521.1|1209423_1209630_+|tail	phage tail protein	tail	A0A2H4J9Z9	uncultured_Caudovirales_phage	59.7	5.3e-15
WP_069245588.1|1209639_1210689_+	late control protein	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	47.9	4.7e-83
WP_069245589.1|1210764_1211049_+|holin	holin	holin	C7BGD7	Burkholderia_phage	91.5	2.1e-38
WP_069245590.1|1211051_1211546_+	glycoside hydrolase family 104 protein	NA	Q6J1Q5	Burkholderia_virus	85.4	2.9e-75
WP_069245591.1|1211542_1212037_+	DUF2514 family protein	NA	C7BGD9	Burkholderia_phage	62.0	2.1e-41
WP_069245592.1|1212207_1212996_+	DNA adenine methylase	NA	Q8W6S4	Burkholderia_virus	90.5	4.2e-145
WP_069245593.1|1213035_1213746_-	LysR family transcriptional regulator	NA	A4PE26	Ralstonia_virus	40.6	3.7e-39
WP_083262737.1|1213758_1214370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069245594.1|1214717_1215221_-	DUF4123 domain-containing protein	NA	A4PE24	Ralstonia_virus	41.7	3.3e-18
WP_069245595.1|1215224_1215638_-	PAAR domain-containing protein	NA	Q8W6S2	Burkholderia_virus	52.9	1.0e-17
WP_107313950.1|1215728_1216316_-	hypothetical protein	NA	Q8W6R9	Burkholderia_virus	45.4	1.4e-36
WP_069245597.1|1216437_1217142_+	hypothetical protein	NA	A0A1S5NTJ1	Burkholderia_phage	76.0	1.0e-105
WP_156810490.1|1217319_1218474_+	hypothetical protein	NA	Q858T2	Yersinia_virus	27.0	2.9e-25
WP_156810491.1|1218457_1219408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083262738.1|1219400_1220756_+	DNA (cytosine-5-)-methyltransferase	NA	M4QPY5	Micromonas_pusilla_virus	40.6	2.3e-34
WP_034186519.1|1221080_1221629_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_059560696.1|1221676_1222300_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_034186521.1|1222448_1222685_+	ParD-like family protein	NA	NA	NA	NA	NA
WP_034186522.1|1222684_1223491_+	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_034186523.1|1223587_1224091_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_059560694.1|1224170_1225088_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_059560691.1|1225199_1226072_+	pirin family protein	NA	NA	NA	NA	NA
WP_034186526.1|1226216_1226702_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_034186527.1|1226712_1227582_-	cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
WP_034186528.1|1227592_1228039_-	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_059560688.1|1228047_1228683_-	SCO family protein	NA	NA	NA	NA	NA
WP_034186530.1|1228965_1229718_+	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_034186531.1|1229714_1231103_+	alpha,alpha-trehalose-phosphate synthase (UDP-forming)	NA	NA	NA	NA	NA
WP_034186532.1|1231180_1233013_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.7	1.9e-39
WP_034186533.1|1233578_1234643_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_034186534.1|1234879_1235689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059560686.1|1235745_1237098_-	glucarate dehydratase	NA	NA	NA	NA	NA
WP_059560683.1|1237459_1238209_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_034186537.1|1238346_1239495_-	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_059560680.1|1239883_1242028_-|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
>prophage 1
NZ_CP013400	Burkholderia seminalis strain FL-5-4-10-S1-D7 chromosome 2, complete sequence	3050136	827689	879577	3050136	plate,holin,capsid,portal,tRNA,head,tail,terminase	Burkholderia_phage(86.67%)	60	NA	NA
WP_069245881.1|827689_830482_-	hypothetical protein	NA	A0A1S5NPU9	Burkholderia_phage	94.8	0.0e+00
WP_069245882.1|830484_830739_-	hypothetical protein	NA	A0A1S5NPT7	Burkholderia_phage	97.6	1.3e-34
WP_069245883.1|830735_831098_-	hypothetical protein	NA	E5E3T4	Burkholderia_phage	80.8	5.8e-49
WP_156810503.1|831101_831449_-	hypothetical protein	NA	A0A1S5NV61	Burkholderia_phage	59.6	1.8e-39
WP_069245885.1|831453_831648_-	hypothetical protein	NA	E5E3T5	Burkholderia_phage	89.1	2.7e-21
WP_069246043.1|831691_831880_-	hypothetical protein	NA	E5E3T6	Burkholderia_phage	73.4	6.5e-20
WP_017923635.1|831891_832086_-	hypothetical protein	NA	A0A1S5NR87	Burkholderia_phage	75.0	2.0e-19
WP_006757081.1|832174_832423_-	ogr/Delta-like zinc finger family protein	NA	A0A1S5NNI9	Burkholderia_phage	97.6	2.6e-40
WP_017923636.1|832450_832639_-	hypothetical protein	NA	A4PE59	Ralstonia_virus	64.9	1.2e-10
WP_012327650.1|832667_832859_-	hypothetical protein	NA	E5E3U0	Burkholderia_phage	67.3	1.0e-12
WP_069246044.1|832875_833061_-	hypothetical protein	NA	A4JWR7	Burkholderia_virus	54.0	2.0e-05
WP_017923638.1|833178_833670_+	helix-turn-helix transcriptional regulator	NA	E5E3U2	Burkholderia_phage	42.9	3.9e-24
WP_017923639.1|833660_834041_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_069245886.1|834506_835658_-	phage late control D family protein	NA	A0A1S5NV58	Burkholderia_phage	97.1	1.6e-193
WP_027809278.1|835654_836083_-|tail	phage tail protein	tail	A0A1S5NTH4	Burkholderia_phage	99.3	3.6e-74
WP_069245887.1|836096_839348_-	hypothetical protein	NA	A0A1S5NRM8	Burkholderia_phage	91.5	0.0e+00
WP_017922482.1|839344_839464_-|tail	GpE family phage tail protein	tail	E5E3Q0	Burkholderia_phage	78.9	1.0e-10
WP_069245888.1|839463_839775_-|tail	phage tail assembly protein	tail	E5E3Q1	Burkholderia_phage	84.5	9.4e-40
WP_017922484.1|839808_840318_-|tail	phage major tail tube protein	tail	E5E3Q2	Burkholderia_phage	93.5	1.8e-88
WP_069245889.1|840347_841520_-|tail	phage tail sheath protein	tail	A0A1S5NNH8	Burkholderia_phage	98.7	4.7e-225
WP_069245890.1|841631_842381_-	site-specific DNA-methyltransferase	NA	A0A1S5NPU0	Burkholderia_phage	96.0	3.9e-140
WP_082160890.1|842358_842541_-	Com family DNA-binding transcriptional regulator	NA	A0A1S5NPS9	Burkholderia_phage	96.7	8.2e-28
WP_069245891.1|842690_843032_-	hypothetical protein	NA	A0A1S5NQ35	Burkholderia_phage	83.2	2.2e-42
WP_083262754.1|843067_843478_-	hypothetical protein	NA	A0A1S5NV54	Burkholderia_phage	34.6	8.1e-07
WP_069245894.1|846830_847382_-|tail	phage tail protein I	tail	A0A1S5NRL9	Burkholderia_phage	96.7	6.4e-100
WP_069245895.1|847374_848280_-|plate	baseplate assembly protein	plate	A0A1S5NR72	Burkholderia_phage	97.0	4.1e-160
WP_069245896.1|848276_848642_-	hypothetical protein	NA	A0A1S5NNH3	Burkholderia_phage	90.9	1.1e-55
WP_069245897.1|848638_849346_-|plate	phage baseplate assembly protein V	plate	A0A1S5NNH1	Burkholderia_phage	82.4	1.3e-92
WP_069245898.1|849469_849934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069245899.1|850020_850470_-	phage virion morphogenesis protein	NA	A0A1S5NPT5	Burkholderia_phage	92.6	3.4e-67
WP_069245900.1|850469_850880_-|tail	phage tail protein	tail	A0A1S5NPS3	Burkholderia_phage	97.1	1.4e-70
WP_069245901.1|850876_851368_-	hypothetical protein	NA	A0A1S5NQ26	Burkholderia_phage	93.9	2.7e-73
WP_069245902.1|851364_852165_-	DUF3380 domain-containing protein	NA	A0A1S5NV50	Burkholderia_phage	95.9	1.3e-138
WP_027809292.1|852157_852478_-|holin	phage holin family protein	holin	A0A1S5NTF8	Burkholderia_phage	98.1	2.7e-50
WP_012327676.1|852477_852852_-	membrane protein	NA	A0A1S5NRL1	Burkholderia_phage	100.0	7.8e-57
WP_012327677.1|852854_853067_-|tail	tail protein	tail	A0A1S5NR68	Burkholderia_phage	95.7	7.6e-33
WP_069245903.1|853066_853549_-|head	head completion/stabilization protein	head	A0A1S5NNA6	Burkholderia_phage	92.5	1.9e-79
WP_069245904.1|853653_854340_-|terminase	terminase endonuclease subunit	terminase	A0A1S5NNA5	Burkholderia_phage	96.1	9.1e-120
WP_017922499.1|854336_855356_-|capsid	phage major capsid protein, P2 family	capsid	A0A1S5NPT2	Burkholderia_phage	90.6	6.6e-175
WP_069245905.1|855392_856217_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S5NPS0	Burkholderia_phage	89.4	1.4e-130
WP_069245906.1|856361_858113_+	oxidoreductase	NA	E5E3S6	Burkholderia_phage	88.9	0.0e+00
WP_069245907.1|858112_859159_+|portal	phage portal protein	portal	A0A1S5NV43	Burkholderia_phage	96.6	4.8e-197
WP_069245908.1|859186_859903_-	hypothetical protein	NA	A0A1S5NTJ1	Burkholderia_phage	89.3	6.2e-127
WP_156810504.1|860277_860436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069245910.1|860853_861885_+	ParA family protein	NA	H2BD62	Pseudomonas_phage	40.9	1.6e-64
WP_156810505.1|861884_862487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059558415.1|862975_863539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069245912.1|863688_864681_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_034185731.1|864817_865117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034185732.1|865507_866266_-	TIGR00730 family Rossman fold protein	NA	A0A1D8KUT5	Synechococcus_phage	38.4	6.7e-23
WP_034185733.1|866267_869021_+	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	32.4	2.6e-72
WP_049036581.1|869299_870634_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_034185735.1|871029_871905_+	carboxymethylenebutenolidase	NA	NA	NA	NA	NA
WP_059558411.1|871959_872829_-	sulfurtransferase	NA	NA	NA	NA	NA
WP_034185737.1|872946_874053_-	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_034185738.1|874323_874617_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_034185739.1|874613_875498_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_034185740.1|875579_877484_+	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_011355803.1|877638_878448_+	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_034185741.1|878536_879577_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	52.9	1.7e-93
>prophage 1
NZ_CP013399	Burkholderia seminalis strain FL-5-4-10-S1-D7 chromosome 3, complete sequence	1093546	28962	35227	1093546		Escherichia_phage(57.14%)	7	NA	NA
WP_034192083.1|28962_29967_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	45.4	7.4e-78
WP_059560906.1|29963_30848_-	dTDP-4-dehydrorhamnose reductase	NA	A0A1D7XFA3	Escherichia_phage	34.8	1.0e-30
WP_049029918.1|30844_31417_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	53.4	4.1e-49
WP_059560909.1|31413_32310_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	K7QKA7	Escherichia_phage	58.1	2.9e-97
WP_059560912.1|32352_33732_-	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	29.5	3.0e-29
WP_059560915.1|33728_34448_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	29.2	3.7e-15
WP_049033652.1|34444_35227_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	28.6	8.8e-10
>prophage 2
NZ_CP013399	Burkholderia seminalis strain FL-5-4-10-S1-D7 chromosome 3, complete sequence	1093546	108979	116530	1093546	capsid,portal	Burkholderia_phage(83.33%)	8	NA	NA
WP_059561022.1|108979_109525_+	hypothetical protein	NA	R4JDM9	Burkholderia_phage	72.2	4.2e-67
WP_059561025.1|109581_109932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156810497.1|110064_110322_+	hypothetical protein	NA	R4JGF4	Burkholderia_phage	82.4	1.5e-38
WP_156444818.1|110446_111094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059561029.1|111163_112231_-	phage late control D family protein	NA	K4PAY4	Burkholderia_phage	72.6	3.5e-142
WP_082744761.1|112227_112671_-	hypothetical protein	NA	A4JWS2	Burkholderia_virus	54.5	7.4e-06
WP_082744756.1|112640_113573_-|capsid	GPO family capsid scaffolding protein	capsid	E5FFI7	Burkholderia_phage	55.0	2.4e-70
WP_059561035.1|115492_116530_+|portal	phage portal protein	portal	E5FFI9	Burkholderia_phage	65.0	6.8e-135
