The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP013393	Burkholderia vietnamiensis strain FL-2-3-30-S1-D0 chromosome 1, complete sequence	3257130	381409	410660	3257130	transposase,protease,plate	Pseudomonas_phage(25.0%)	24	NA	NA
WP_014722317.1|381409_381916_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	52.0	7.1e-21
WP_069222623.1|382166_383009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069221862.1|383163_383412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069221863.1|383408_383804_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_021164205.1|383853_384651_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	36.1	4.9e-32
WP_059719456.1|386325_387450_+	5-methylcytosine-specific restriction endonuclease system specificity protein McrC	NA	NA	NA	NA	NA
WP_014722334.1|387906_388707_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_069221865.1|389021_392204_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	29.2	6.4e-59
WP_080484188.1|396444_397713_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	43.9	3.5e-40
WP_140995563.1|398209_398602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081336065.1|398611_399103_+	RHS repeat-associated core domain-containing protein	NA	NA	NA	NA	NA
WP_081336066.1|399166_399340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155769755.1|399336_399573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059702034.1|400225_400543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011883100.1|400635_401418_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_011883101.1|401414_402761_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_011883102.1|402863_403475_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_059548943.1|403849_404485_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_045578566.1|404539_405055_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_011883105.1|405070_406561_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_011883106.1|406631_407135_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_011883107.1|407197_407683_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_059548941.1|407760_409596_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_011883109.1|409559_410660_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 2
NZ_CP013393	Burkholderia vietnamiensis strain FL-2-3-30-S1-D0 chromosome 1, complete sequence	3257130	700179	709293	3257130		Hokovirus(16.67%)	7	NA	NA
WP_011883357.1|700179_702132_+	molecular chaperone DnaK	NA	A0A1V0SH73	Hokovirus	50.1	7.0e-149
WP_011883359.1|702388_703525_+	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	27.2	2.2e-22
WP_069221927.1|703529_705494_+	bifunctional anthranilate synthase component I family protein/class IV aminotransferase	NA	S4VT78	Pandoravirus	36.0	3.8e-54
WP_014722488.1|705611_706427_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	32.5	3.7e-35
WP_014722489.1|706474_707161_-	deoxynucleoside kinase	NA	A0A0M3UL55	Enterococcus_phage	29.5	3.6e-07
WP_011883368.1|707157_707700_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_059702757.1|707733_709293_-	polynucleotide adenylyltransferase PcnB	NA	A0A1B0V011	Roseobacter_phage	27.6	1.7e-17
>prophage 3
NZ_CP013393	Burkholderia vietnamiensis strain FL-2-3-30-S1-D0 chromosome 1, complete sequence	3257130	976070	984508	3257130		Bacillus_phage(16.67%)	8	NA	NA
WP_011883830.1|976070_977471_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	37.9	2.5e-76
WP_155623574.1|977478_978429_+	D-glycero-beta-D-manno-heptose-7-phosphate kinase	NA	A0A2H4N7X4	Lake_Baikal_phage	28.5	1.2e-16
WP_011883833.1|978492_979485_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	30.9	5.9e-27
WP_069221998.1|979558_979909_+	competence protein ComE	NA	NA	NA	NA	NA
WP_059455975.1|980112_981015_+	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	39.5	6.3e-52
WP_059459106.1|981096_982320_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_059550919.1|982490_983414_+	histone deacetylase family protein	NA	A0A2K9KZC4	Tupanvirus	35.2	1.0e-41
WP_155769761.1|983536_984508_-	alpha/beta fold hydrolase	NA	A7XCB7	Tanapox_virus	28.1	5.6e-22
>prophage 4
NZ_CP013393	Burkholderia vietnamiensis strain FL-2-3-30-S1-D0 chromosome 1, complete sequence	3257130	1268346	1302902	3257130	plate,head,tail,integrase,transposase	Ralstonia_phage(20.59%)	46	1260304:1260320	1310907:1310923
1260304:1260320	attL	GTCGTCGCGCCGCCGCC	NA	NA	NA	NA
WP_069222090.1|1268346_1269141_-	DNA adenine methylase	NA	Q5ZQW7	Pseudomonas_phage	66.3	1.3e-104
WP_069222091.1|1269278_1269716_-	hypothetical protein	NA	A0A1L7N100	Ralstonia_phage	43.5	3.2e-25
WP_034193255.1|1269720_1270299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069222092.1|1270301_1271822_-	hypothetical protein	NA	A0A291LA09	Bordetella_phage	37.6	7.2e-16
WP_069222093.1|1271824_1272394_-	DUF2313 domain-containing protein	NA	F6MIL7	Haemophilus_phage	38.6	7.3e-30
WP_069222094.1|1272390_1273458_-|plate	baseplate J/gp47 family protein	plate	A0A0M3LQN4	Mannheimia_phage	42.5	1.1e-63
WP_034193258.1|1273457_1273808_-	phage GP46 family protein	NA	A0A2H4JDR8	uncultured_Caudovirales_phage	68.1	2.7e-35
WP_034193259.1|1273870_1274488_-|plate	phage baseplate assembly protein	plate	A0A0M3LPA3	Mannheimia_phage	42.3	2.4e-34
WP_034193260.1|1274471_1275611_-|tail	tail protein	tail	A0A2H4J9E6	uncultured_Caudovirales_phage	42.0	1.7e-78
WP_155769766.1|1275594_1277079_-	multidrug DMT transporter permease	NA	A0A2H4JGT4	uncultured_Caudovirales_phage	26.8	3.8e-38
WP_081336088.1|1277014_1279504_-|tail	phage tail tape measure protein	tail	A0A0M3LPB6	Mannheimia_phage	30.7	1.5e-50
WP_034193262.1|1279656_1280031_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_034193263.1|1280027_1280402_-	hypothetical protein	NA	A0A0M3LRV6	Mannheimia_phage	52.5	4.5e-28
WP_034193264.1|1280420_1281851_-|tail	tail sheath protein	tail	B7SDP8	Haemophilus_phage	45.2	1.2e-92
WP_034193265.1|1281867_1282101_-	hypothetical protein	NA	A0A0M3LQM9	Mannheimia_phage	55.6	1.9e-05
WP_034193333.1|1282097_1282814_-	DUF1834 family protein	NA	NA	NA	NA	NA
WP_034193266.1|1282825_1283251_-	DUF1320 domain-containing protein	NA	A0A1X9SGZ3	Bradyrhizobium_phage	37.2	1.9e-14
WP_034193267.1|1283254_1283659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034193268.1|1283779_1284697_-|head	head protein	head	A0A2H4J778	uncultured_Caudovirales_phage	66.9	4.1e-115
WP_034193269.1|1284712_1285117_-	hypothetical protein	NA	A0A2H4IZH5	uncultured_Caudovirales_phage	58.1	3.2e-32
WP_034193270.1|1285116_1286226_-	hypothetical protein	NA	A0A0M5N0Q6	Ralstonia_phage	44.5	3.8e-67
WP_034193271.1|1286568_1286922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034193272.1|1286954_1287530_-	hypothetical protein	NA	L7P7T2	Pseudomonas_phage	33.3	1.3e-07
WP_034193273.1|1287633_1288947_-|head	head morphogenesis protein	head	Q6QIB9	Burkholderia_phage	46.9	2.0e-59
WP_034193274.1|1288933_1290550_-	DUF935 domain-containing protein	NA	A0A0M5MS00	Ralstonia_phage	51.7	6.4e-148
WP_069222097.1|1290563_1291187_-	hypothetical protein	NA	A0A2D1GNP7	Pseudomonas_phage	62.0	3.5e-70
WP_034193278.1|1291390_1291678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034193279.1|1291661_1291901_-	conjugal transfer protein TraR	NA	A0A0M4UVB2	Ralstonia_phage	60.0	9.8e-13
WP_034193280.1|1291903_1292512_-	hypothetical protein	NA	Q6QIC6	Burkholderia_phage	40.5	1.0e-18
WP_034193281.1|1292501_1292738_-	hypothetical protein	NA	A0A0M4UKB4	Ralstonia_phage	55.1	7.2e-08
WP_034193282.1|1292724_1293249_-	glycoside hydrolase family 104 protein	NA	Q6J1Q5	Burkholderia_virus	51.2	7.9e-39
WP_034193283.1|1293422_1293857_-	hypothetical protein	NA	A0A0M3LRS6	Mannheimia_phage	31.0	3.7e-10
WP_051974414.1|1293853_1294270_-	regulatory protein GemA	NA	A0A0M5MRZ7	Ralstonia_phage	45.3	3.6e-26
WP_034193285.1|1294336_1294795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034193286.1|1294804_1295422_-	DUF3164 family protein	NA	Q5ZR10	Pseudomonas_phage	55.6	1.2e-62
WP_069222099.1|1295414_1296038_-	hypothetical protein	NA	B5TA84	Burkholderia_phage	45.1	5.7e-28
WP_034193287.1|1296037_1296652_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034193288.1|1296711_1297020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_131929052.1|1297016_1297319_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_034193290.1|1297332_1297959_-	helix-turn-helix domain-containing protein	NA	A0A0M3VI82	Ralstonia_phage	50.0	1.4e-18
WP_131929046.1|1297951_1298182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034193292.1|1298192_1298936_-	ATP-binding protein	NA	L7P7S2	Pseudomonas_phage	68.5	7.9e-85
WP_051974416.1|1298954_1301069_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A076FSV9	Pseudomonas_phage	50.9	1.1e-187
WP_034193293.1|1301134_1301617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072465388.1|1301678_1301996_-	transcriptional regulator	NA	A0A2P9JZG5	Alteromonadaceae_phage	41.2	5.8e-13
WP_034193294.1|1302158_1302902_+	helix-turn-helix transcriptional regulator	NA	A5X9F5	Aeromonas_virus	36.8	4.0e-28
1310907:1310923	attR	GTCGTCGCGCCGCCGCC	NA	NA	NA	NA
>prophage 1
NZ_CP013394	Burkholderia vietnamiensis strain FL-2-3-30-S1-D0 chromosome 2, complete sequence	2428798	1491339	1517471	2428798	plate,transposase	uncultured_virus(100.0%)	20	NA	NA
WP_069223173.1|1491339_1492356_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_069223174.1|1492418_1494233_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_069223175.1|1494249_1497813_-	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_069223176.1|1497814_1498975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069223177.1|1499009_1499219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081336121.1|1499399_1500494_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_155769839.1|1500563_1501181_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069223178.1|1501213_1503367_-	flagellar hook-length control protein FliK	NA	NA	NA	NA	NA
WP_069223179.1|1503379_1505926_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_155769840.1|1506116_1507538_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_069223180.1|1507594_1508941_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_069223181.1|1508937_1509600_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_069223182.1|1509612_1510044_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_059703735.1|1510280_1511468_-	porin	NA	NA	NA	NA	NA
WP_155769841.1|1511625_1512075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069223183.1|1512227_1513610_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_069223184.1|1513636_1514404_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_069223185.1|1514400_1515135_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_069223186.1|1515140_1515944_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_081336199.1|1516202_1517471_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	43.9	1.0e-39
>prophage 2
NZ_CP013394	Burkholderia vietnamiensis strain FL-2-3-30-S1-D0 chromosome 2, complete sequence	2428798	1579929	1693880	2428798	plate,transposase,terminase,portal,head,capsid,integrase,protease,holin,tail	Burkholderia_phage(38.1%)	109	1624738:1624757	1680709:1680728
WP_059464014.1|1579929_1581381_+|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
WP_069223208.1|1582335_1583334_-	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_069223209.1|1583459_1584593_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_069223210.1|1584689_1585250_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_069223211.1|1585259_1586126_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_059720111.1|1586249_1587230_+	sulfonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_046425365.1|1587423_1588386_-	agmatinase	NA	NA	NA	NA	NA
WP_069223212.1|1588733_1589405_+	lysoplasmalogenase	NA	NA	NA	NA	NA
WP_069223213.1|1589653_1591246_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_069223214.1|1591267_1592206_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_059454528.1|1592202_1593108_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_059460214.1|1593112_1593976_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_059703890.1|1594151_1595045_+	urea transporter	NA	NA	NA	NA	NA
WP_059703891.1|1595350_1600192_+	NAD-glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_059461394.1|1600213_1601071_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_069223215.1|1601407_1602241_-	arylamine N-acetyltransferase	NA	NA	NA	NA	NA
WP_059498268.1|1602341_1603034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069223216.1|1603323_1604805_-	amidase	NA	NA	NA	NA	NA
WP_059560483.1|1605189_1605648_-	pseudoazurin	NA	NA	NA	NA	NA
WP_069223217.1|1605705_1607931_-	catalase/peroxidase HPI	NA	NA	NA	NA	NA
WP_059703897.1|1608744_1609179_+	universal stress protein	NA	NA	NA	NA	NA
WP_059454538.1|1609813_1610062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069223218.1|1610578_1611865_+	divalent metal cation transporter	NA	NA	NA	NA	NA
WP_069223219.1|1611959_1613195_+	DUF2252 domain-containing protein	NA	NA	NA	NA	NA
WP_059454539.1|1613348_1613750_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_069223220.1|1613845_1614868_-	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	NA	NA	NA	NA
WP_069223221.1|1614881_1616549_-	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_059577491.1|1616734_1616962_-	DUF3079 domain-containing protein	NA	NA	NA	NA	NA
WP_043292475.1|1618818_1619025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069223222.1|1619356_1619956_-	alpha-ketoglutarate-dependent dioxygenase AlkB	NA	A0A2K9L4C1	Tupanvirus	33.7	1.1e-20
WP_059498201.1|1620215_1621364_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_069223223.1|1621367_1621568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069223543.1|1621905_1622613_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	38.8	3.8e-12
WP_059454546.1|1622688_1623408_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_059454547.1|1623481_1623925_+	DUF4902 domain-containing protein	NA	NA	NA	NA	NA
WP_059577423.1|1624134_1624743_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
1624738:1624757	attL	GCCTGAGCCGGAACGCGCGT	NA	NA	NA	NA
WP_069223224.1|1624823_1625570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069223225.1|1625790_1626660_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_081336172.1|1626659_1627007_-	VgrG protein	NA	NA	NA	NA	NA
WP_081336206.1|1627238_1628291_-	acyltransferase	NA	NA	NA	NA	NA
WP_069223226.1|1629069_1629972_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_155626228.1|1630163_1635065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069223228.1|1635143_1635626_-	DUF2514 family protein	NA	C7BGD9	Burkholderia_phage	58.1	2.3e-37
WP_069223229.1|1635622_1636117_-	glycoside hydrolase family 104 protein	NA	Q6J1Q5	Burkholderia_virus	83.5	1.1e-74
WP_059461369.1|1636119_1636404_-|holin	holin	holin	C7BGD7	Burkholderia_phage	92.6	5.0e-40
WP_069223230.1|1636507_1636942_-	hypothetical protein	NA	A0A0A1I628	Burkholderia_phage	33.8	3.0e-12
WP_069223231.1|1636951_1637977_-	hypothetical protein	NA	R4JJY3	Burkholderia_phage	49.1	1.3e-32
WP_069223232.1|1637979_1638579_-	DUF2313 domain-containing protein	NA	B5TK76	Pseudomonas_phage	50.5	1.4e-52
WP_069223233.1|1638569_1639616_-|plate	baseplate J/gp47 family protein	plate	B5TK75	Pseudomonas_phage	49.0	3.5e-86
WP_069223234.1|1639587_1640016_-	hypothetical protein	NA	B5TK74	Pseudomonas_phage	48.5	6.9e-25
WP_069223235.1|1640012_1640591_-|plate	phage baseplate assembly protein	plate	B5TK73	Pseudomonas_phage	50.7	6.0e-32
WP_081336173.1|1640587_1641703_-|plate	baseplate protein	plate	B5TK72	Pseudomonas_phage	55.0	4.8e-102
WP_069223236.1|1641703_1642942_-	hypothetical protein	NA	B5TK71	Pseudomonas_phage	39.8	3.6e-82
WP_069223237.1|1642949_1644887_-|tail	phage tail tape measure protein	tail	U5P420	Shigella_phage	53.1	3.2e-117
WP_059463077.1|1645020_1645317_-|tail	phage tail assembly protein	tail	B5TK69	Pseudomonas_phage	51.0	4.6e-20
WP_059474076.1|1645307_1645655_-|tail	phage tail protein	tail	B5TK68	Pseudomonas_phage	52.2	2.9e-29
WP_069223238.1|1645724_1647221_-|tail	phage tail protein	tail	B5TK67	Pseudomonas_phage	55.0	1.7e-150
WP_069223547.1|1647217_1647436_-	DUF2635 domain-containing protein	NA	Q8HAC6	Salmonella_phage	59.5	6.9e-05
WP_069223239.1|1647444_1648035_-	hypothetical protein	NA	B5TK65	Pseudomonas_phage	43.9	1.8e-36
WP_069223240.1|1648042_1648504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069223548.1|1648493_1648829_-|head	phage head closure protein	head	Q8HAC9	Salmonella_phage	46.7	2.2e-18
WP_069223241.1|1648828_1649323_-|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_069223242.1|1649319_1649589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081336174.1|1649656_1650943_-|capsid	phage major capsid protein	capsid	A4JX01	Burkholderia_virus	44.6	2.5e-94
WP_069223243.1|1651008_1651944_-	S49 family peptidase	NA	F8QZT1	Wolbachia_phage	43.0	6.3e-47
WP_081055117.1|1651940_1653191_-|portal	phage portal protein	portal	A4JWZ9	Burkholderia_virus	38.6	1.6e-66
WP_059474086.1|1653194_1654862_-|terminase	terminase large subunit	terminase	A0A0U4B0C7	Pseudomonas_phage	44.6	7.3e-131
WP_059474087.1|1654858_1655380_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B0RXI5	Streptococcus_phage	29.9	3.2e-16
WP_081336175.1|1655447_1655861_-	HNH endonuclease	NA	C7BGG5	Burkholderia_phage	59.0	1.6e-34
WP_069223245.1|1655998_1656397_-	hypothetical protein	NA	C7BGG3	Burkholderia_phage	94.7	1.3e-65
WP_069223551.1|1656407_1657448_-	helix-turn-helix domain-containing protein	NA	C7BGG2	Burkholderia_phage	83.2	5.2e-159
WP_069223246.1|1657492_1658860_-	replicative DNA helicase	NA	C7BGG1	Burkholderia_phage	98.9	1.1e-249
WP_069223247.1|1658887_1659394_-	hypothetical protein	NA	C7BGG0	Burkholderia_phage	97.6	5.4e-85
WP_069223248.1|1659483_1659684_+	hypothetical protein	NA	C7BGF9	Burkholderia_phage	98.5	4.5e-35
WP_081336176.1|1659864_1660104_-	Cro/Cl family transcriptional regulator	NA	C7BGF8	Burkholderia_phage	98.7	2.1e-39
WP_081336177.1|1660189_1660591_+	hypothetical protein	NA	C7BGF7	Burkholderia_phage	98.5	3.0e-70
WP_069223249.1|1661402_1661609_+	hypothetical protein	NA	C7BGF3	Burkholderia_phage	97.1	3.2e-28
WP_081336178.1|1661730_1662555_+	hypothetical protein	NA	C7BGF1	Burkholderia_phage	97.4	8.0e-147
WP_081055114.1|1662579_1662855_+	AlpA family phage regulatory protein	NA	C7BGF0	Burkholderia_phage	92.2	5.2e-42
WP_155769844.1|1662926_1664102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155769845.1|1664403_1665642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069223252.1|1666174_1667449_-|integrase	site-specific integrase	integrase	C7BGE7	Burkholderia_phage	98.1	2.4e-246
WP_011882540.1|1667670_1668321_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	47.6	5.5e-42
WP_059548059.1|1668497_1668959_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_059604953.1|1669110_1669440_-	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_011882544.1|1669949_1670348_+	elongation factor GreAB	NA	NA	NA	NA	NA
WP_011882545.1|1670546_1671635_-	porin	NA	NA	NA	NA	NA
WP_081336179.1|1672248_1672632_+	BcpO-related WXXGXW repeat protein	NA	NA	NA	NA	NA
WP_155769846.1|1672876_1673086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069223254.1|1673082_1674834_-	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_059604963.1|1675193_1676072_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014725322.1|1676102_1677449_-	nitrate/sulfonate/bicarbonate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	39.0	8.2e-32
WP_069223255.1|1677460_1679215_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_059577563.1|1679851_1680991_+	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
1680709:1680728	attR	GCCTGAGCCGGAACGCGCGT	NA	NA	NA	NA
WP_059456122.1|1681049_1681754_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_069223256.1|1681873_1682773_+	transcriptional regulator GcvA	NA	NA	NA	NA	NA
WP_011882554.1|1682920_1683229_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_069223257.1|1683298_1684360_+	alkene reductase	NA	NA	NA	NA	NA
WP_069223258.1|1684372_1684900_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011882557.1|1684986_1685598_+	LysE family translocator	NA	NA	NA	NA	NA
WP_069223259.1|1685867_1686233_-	transcriptional regulator	NA	A0A222YXG1	Escherichia_phage	56.8	2.9e-32
WP_059456116.1|1686237_1686540_-	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	49.5	1.2e-18
WP_069223260.1|1686647_1687604_+	dienelactone hydrolase	NA	NA	NA	NA	NA
WP_155769847.1|1687600_1688515_-	phosphatidylinositol-specific phospholipase C domain-containing protein	NA	NA	NA	NA	NA
WP_069223553.1|1688521_1689544_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_069223261.1|1689553_1690414_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_081336180.1|1690410_1691319_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_069223262.1|1691315_1692554_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_069223263.1|1693001_1693880_-|protease	metalloprotease	protease	A0A1I9SA48	Rhodococcus_phage	38.3	7.2e-37
