The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP013370	Burkholderia ubonensis strain RF23-BP41 chromosome 1, complete sequence	3724327	189527	219504	3724327	integrase,holin,plate,tail	Burkholderia_phage(75.0%)	36	181573:181592	194142:194161
181573:181592	attL	CGAGCGCGCGCAGCGCGGCG	NA	NA	NA	NA
WP_059609420.1|189527_190604_-|integrase	site-specific integrase	integrase	A0A1S5NNJ1	Burkholderia_phage	84.9	1.6e-171
WP_080402169.1|190471_190879_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_080402168.1|190921_191281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059655352.1|191277_194070_-	hypothetical protein	NA	E5E3N5	Burkholderia_phage	92.0	0.0e+00
WP_059609418.1|194073_194337_-	hypothetical protein	NA	E5E3N6	Burkholderia_phage	65.1	8.5e-18
194142:194161	attR	CGAGCGCGCGCAGCGCGGCG	NA	NA	NA	NA
WP_010095912.1|194541_194790_-	ogr/Delta-like zinc finger family protein	NA	K4PAZ0	Burkholderia_phage	91.5	5.9e-37
WP_059609417.1|194914_195130_-	hypothetical protein	NA	E5E3U1	Burkholderia_phage	81.4	1.1e-20
WP_155122821.1|195256_195712_+	helix-turn-helix transcriptional regulator	NA	E5E3U2	Burkholderia_phage	64.2	2.9e-45
WP_059609416.1|196082_196379_+	hypothetical protein	NA	E5E3U3	Burkholderia_phage	50.5	1.2e-12
WP_059655350.1|196506_197586_-	phage late control D family protein	NA	K4PAY4	Burkholderia_phage	72.4	1.0e-133
WP_059609414.1|197582_198038_-|tail	phage tail protein	tail	K4NXK5	Burkholderia_phage	64.3	2.1e-40
WP_059655348.1|198067_200620_-	hypothetical protein	NA	A4JWS3	Burkholderia_virus	47.0	4.0e-152
WP_010095898.1|200635_200749_-|tail	GpE family phage tail protein	tail	A0A089FGX3	Burkholderia_phage	81.1	1.8e-09
WP_059655346.1|200757_201141_-|tail	phage tail assembly protein	tail	K4NXA3	Burkholderia_phage	68.0	7.8e-28
WP_080402167.1|201210_201714_-|tail	phage major tail tube protein	tail	E5E3U9	Burkholderia_phage	74.3	1.1e-69
WP_059609411.1|201748_202921_-|tail	phage tail sheath protein	tail	A4JWS7	Burkholderia_virus	82.5	2.3e-187
WP_059655344.1|203004_203841_-|tail	phage tail protein	tail	E5E3Q6	Burkholderia_phage	61.3	4.0e-93
WP_059655342.1|203855_206147_-	hypothetical protein	NA	E5E3V2	Burkholderia_phage	61.6	5.3e-265
WP_059655340.1|206153_206696_-|tail	phage tail protein I	tail	E5FFH2	Burkholderia_phage	70.4	1.1e-70
WP_059655338.1|206688_207603_-|plate	baseplate assembly protein	plate	E5FFH3	Burkholderia_phage	74.9	2.4e-123
WP_059609406.1|207599_207962_-|plate	baseplate assembly protein	plate	K4PAX6	Burkholderia_phage	66.7	5.4e-39
WP_059655336.1|207958_208642_-|plate	phage baseplate assembly protein V	plate	K4NXJ5	Burkholderia_phage	70.0	7.5e-82
WP_059655334.1|209206_209650_-|tail	phage tail protein	tail	A4JWL9	Burkholderia_virus	30.9	1.4e-07
WP_059655332.1|209659_210721_-	hypothetical protein	NA	A4JWL8	Burkholderia_virus	50.0	3.0e-53
WP_059655330.1|210717_211284_-|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	57.7	2.2e-39
WP_059655328.1|211276_212188_-|plate	baseplate assembly protein	plate	E5FFH3	Burkholderia_phage	50.8	6.3e-76
WP_059609400.1|212184_212640_-|tail	phage tail protein	tail	E5E3V9	Burkholderia_phage	56.5	8.1e-32
WP_059614777.1|212632_212803_-	hypothetical protein	NA	K4PAX1	Burkholderia_phage	61.5	8.5e-11
WP_059609399.1|212756_213197_-	protein lysB	NA	K4NXJ2	Burkholderia_phage	44.4	1.2e-16
WP_059655326.1|213193_214039_-	DUF3380 domain-containing protein	NA	A4JWZ0	Burkholderia_virus	68.8	7.8e-97
WP_059614783.1|214042_214309_-|holin	phage holin family protein	holin	E5E3W3	Burkholderia_phage	66.3	5.6e-25
WP_059609396.1|214310_214655_-	hypothetical protein	NA	A4JWU2	Burkholderia_virus	79.6	6.7e-39
WP_010095858.1|214670_214877_-|tail	tail protein	tail	E5E3W5	Burkholderia_phage	70.6	4.2e-20
WP_059655554.1|215298_215769_-	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_059655552.1|215960_217535_+	TIGR04222 domain-containing membrane protein	NA	NA	NA	NA	NA
WP_059655324.1|217833_219504_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	31.7	4.5e-19
>prophage 2
NZ_CP013370	Burkholderia ubonensis strain RF23-BP41 chromosome 1, complete sequence	3724327	458009	490257	3724327	transposase,plate,protease	uncultured_Caudovirales_phage(40.0%)	25	NA	NA
WP_059614042.1|458009_458519_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	46.3	3.6e-20
WP_080402099.1|458682_458811_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_155122827.1|459102_459681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059652539.1|460112_463010_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	27.0	3.2e-49
WP_059652555.1|463082_463562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059652542.1|463586_465527_+	TIGR02594 family protein	NA	A0A1U9ZAE8	Proteus_phage	36.2	8.3e-09
WP_033355802.1|465513_466065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059613606.1|466568_466829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059613608.1|467202_467406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059617961.1|467502_468303_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_059652545.1|468625_471796_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	27.7	1.6e-54
WP_059612071.1|476431_477043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088503032.1|478451_479650_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.2	6.0e-50
WP_059612080.1|479794_480118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059612082.1|480239_481019_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_059612084.1|481015_482362_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_059612086.1|482464_483076_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_155122828.1|483062_483287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059636829.1|483451_484093_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_042582986.1|484136_484664_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_059536578.1|484679_486170_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_010096526.1|486238_486742_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_042582988.1|486806_487292_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_059654348.1|487357_489193_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_059613975.1|489156_490257_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 3
NZ_CP013370	Burkholderia ubonensis strain RF23-BP41 chromosome 1, complete sequence	3724327	896336	903040	3724327		Enterobacteria_phage(50.0%)	7	NA	NA
WP_059654768.1|896336_897398_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	47.0	1.6e-86
WP_059654770.1|897409_898303_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	58.1	8.3e-97
WP_059654772.1|898287_898839_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	50.9	8.5e-44
WP_059654774.1|898835_899744_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	31.3	2.4e-19
WP_059654775.1|900020_901436_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	31.0	1.7e-56
WP_059654777.1|901437_902280_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_059654780.1|902284_903040_+	ABC transporter ATP-binding protein	NA	A7IVC2	Paramecium_bursaria_Chlorella_virus	28.9	1.8e-07
>prophage 4
NZ_CP013370	Burkholderia ubonensis strain RF23-BP41 chromosome 1, complete sequence	3724327	1427556	1434686	3724327	transposase	Ralstonia_virus(33.33%)	10	NA	NA
WP_059656002.1|1427556_1428552_-	endonuclease	NA	A6XMH8	Bacillus_virus	39.7	4.8e-53
WP_059655999.1|1428815_1429784_-	DUF932 domain-containing protein	NA	A0A0H4INH5	Stenotrophomonas_phage	42.4	3.7e-58
WP_059656024.1|1429876_1430104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088503015.1|1430838_1431129_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_059656022.1|1431376_1432111_-	hypothetical protein	NA	A4PE26	Ralstonia_virus	40.1	8.2e-34
WP_060284440.1|1432116_1432485_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059709227.1|1432579_1433059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059655996.1|1433051_1433555_-	DUF4123 domain-containing protein	NA	A4PE24	Ralstonia_virus	46.2	2.2e-22
WP_059655994.1|1433558_1433969_-	PAAR domain-containing protein	NA	Q8W6S2	Burkholderia_virus	40.7	2.2e-12
WP_059655992.1|1434059_1434686_-	hypothetical protein	NA	Q8W6R9	Burkholderia_virus	47.8	1.4e-45
>prophage 5
NZ_CP013370	Burkholderia ubonensis strain RF23-BP41 chromosome 1, complete sequence	3724327	3592397	3628619	3724327	plate,protease	Erwinia_phage(20.0%)	26	NA	NA
WP_042586564.1|3592397_3592934_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_059655274.1|3592944_3594288_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A191ZC11	Erwinia_phage	28.9	3.9e-42
WP_059655282.1|3595793_3596234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059611872.1|3596459_3597002_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_059611873.1|3597036_3598407_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_059611875.1|3598495_3598720_-	cysteine-rich CWC family protein	NA	NA	NA	NA	NA
WP_010090348.1|3599038_3599938_+	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_059611877.1|3599934_3600726_+	pyrimidine 5'-nucleotidase	NA	NA	NA	NA	NA
WP_059611878.1|3600692_3601370_+	nucleoid occlusion factor SlmA	NA	NA	NA	NA	NA
WP_059634540.1|3601410_3604083_-	type VI secretion system ATPase TssH	NA	A0A248SJW6	Salicola_phage	30.8	8.6e-73
WP_080402165.1|3604488_3605514_+	TagK domain-containing protein	NA	NA	NA	NA	NA
WP_059616432.1|3605494_3606355_+	ImpE protein superfamily protein	NA	NA	NA	NA	NA
WP_059611886.1|3606338_3606860_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_059616435.1|3606861_3608742_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_059611889.1|3608745_3609807_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_059611891.1|3609803_3610862_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_059611893.1|3610912_3611944_+	fimbrial protein	NA	NA	NA	NA	NA
WP_059655279.1|3611974_3613327_+	hypothetical protein	NA	A0A292GJ55	Xanthomonas_phage	46.1	6.4e-109
WP_059655281.1|3613379_3616832_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	42.6	1.6e-15
WP_080400576.1|3616843_3617110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080484890.1|3617182_3620605_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.2	3.7e-36
WP_059655544.1|3620704_3621268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059655542.1|3621248_3622049_-	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_059636979.1|3622045_3625954_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_059611905.1|3625968_3627273_-	type VI secretion system protein TssL	NA	NA	NA	NA	NA
WP_059611907.1|3627269_3628619_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 1
NZ_CP013371	Burkholderia ubonensis strain RF23-BP41 chromosome 2, complete sequence	3052802	623331	678028	3052802	plate	Ralstonia_phage(25.0%)	42	NA	NA
WP_059651407.1|623331_623763_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_059651405.1|623775_624438_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_080402062.1|624434_625781_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_059651403.1|625838_627227_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_155122923.1|630169_630880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155122924.1|631089_631764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155122925.1|632161_632851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059656034.1|633238_634864_+	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	27.7	4.3e-35
WP_155122926.1|635000_636332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069275271.1|636332_639854_+	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_059709257.1|639870_641685_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_059709261.1|641783_642764_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_069275272.1|642795_643440_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_155122927.1|643354_644095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010098089.1|644101_644533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059654516.1|644621_646223_-	tyrosinase family protein	NA	NA	NA	NA	NA
WP_155122928.1|646562_647153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059673748.1|647316_648423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080402137.1|648642_650400_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_059618104.1|650445_652413_-	glycosyltransferase	NA	M1HVH2	Acanthocystis_turfacea_Chlorella_virus	26.4	2.9e-25
WP_059654513.1|652415_653753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059654511.1|653773_655231_-	multidrug transporter	NA	NA	NA	NA	NA
WP_059654538.1|655983_656388_+	TIGR02594 family protein	NA	A0A249Y3Q7	Serratia_phage	43.0	2.8e-28
WP_059654536.1|656457_657894_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_059619449.1|657904_659479_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_059654509.1|659510_660602_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_059618115.1|660666_661098_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_059618117.1|661147_662086_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_059654507.1|662187_662616_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_059654505.1|662878_664126_+	DUF521 domain-containing protein	NA	NA	NA	NA	NA
WP_059654503.1|664118_664604_+	DUF126 domain-containing protein	NA	NA	NA	NA	NA
WP_059654500.1|664701_665805_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_059654498.1|665881_667915_+	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_042587262.1|667942_668347_-	DUF2471 domain-containing protein	NA	NA	NA	NA	NA
WP_059633502.1|668503_669397_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_059654495.1|669484_670273_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_059618134.1|670280_670706_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_059654493.1|670702_673432_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	32.4	1.5e-88
WP_006479553.1|673570_674056_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_059654491.1|674148_675927_-	OmpA family protein	NA	NA	NA	NA	NA
WP_059654489.1|675923_676679_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_059618142.1|676675_678028_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 1
NZ_CP013368	Burkholderia ubonensis strain RF23-BP41 chromosome 3, complete sequence	925790	0	13091	925790		Burkholderia_virus(40.0%)	9	NA	NA
WP_059657207.1|216_2361_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_059617294.1|2852_3869_+	depolymerase	NA	NA	NA	NA	NA
WP_059657205.1|3922_4474_-	glutathione peroxidase	NA	A0A1S7DM81	Molluscum_contagiosum_virus	38.1	1.2e-08
WP_059617298.1|4609_7156_-	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	35.4	5.0e-22
WP_059609962.1|7935_8841_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	77.2	4.0e-131
WP_059609963.1|8973_10260_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	71.7	6.6e-172
WP_059609964.1|10332_10668_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_059657257.1|10909_11995_-	mandelate racemase	NA	NA	NA	NA	NA
WP_059657203.1|12023_13091_-	hypothetical protein	NA	A0A127KL69	Cyanophage	35.2	3.1e-05
>prophage 2
NZ_CP013368	Burkholderia ubonensis strain RF23-BP41 chromosome 3, complete sequence	925790	19463	20366	925790		Orpheovirus(100.0%)	1	NA	NA
WP_059657193.1|19463_20366_-	class I SAM-dependent methyltransferase	NA	A0A2I2L5L3	Orpheovirus	30.7	3.6e-23
>prophage 3
NZ_CP013368	Burkholderia ubonensis strain RF23-BP41 chromosome 3, complete sequence	925790	25709	27560	925790		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_059609978.1|25709_27560_-	carbamoyltransferase	NA	A0A1B1ITZ5	uncultured_Mediterranean_phage	30.6	3.2e-58
>prophage 4
NZ_CP013368	Burkholderia ubonensis strain RF23-BP41 chromosome 3, complete sequence	925790	38765	39497	925790		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_059609987.1|38765_39497_+	ATP-binding cassette domain-containing protein	NA	F2Y302	Organic_Lake_phycodnavirus	24.9	2.1e-05
>prophage 5
NZ_CP013368	Burkholderia ubonensis strain RF23-BP41 chromosome 3, complete sequence	925790	47045	47792	925790		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_059657162.1|47045_47792_-	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	29.1	1.5e-06
>prophage 6
NZ_CP013368	Burkholderia ubonensis strain RF23-BP41 chromosome 3, complete sequence	925790	83503	85138	925790		Planktothrix_phage(100.0%)	1	NA	NA
WP_059657112.1|83503_85138_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.1	1.7e-18
>prophage 7
NZ_CP013368	Burkholderia ubonensis strain RF23-BP41 chromosome 3, complete sequence	925790	89229	91980	925790		Acinetobacter_phage(100.0%)	1	NA	NA
WP_059657105.1|89229_91980_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	25.7	3.0e-36
>prophage 8
NZ_CP013368	Burkholderia ubonensis strain RF23-BP41 chromosome 3, complete sequence	925790	99788	102277	925790		Diadromus_pulchellus_ascovirus(50.0%)	2	NA	NA
WP_059535449.1|99788_100556_-	3-hydroxyacyl-CoA dehydrogenase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	30.4	8.3e-05
WP_059657101.1|100570_102277_-	AMP-binding protein	NA	A0A2H4PQU7	Staphylococcus_phage	38.8	6.7e-79
>prophage 9
NZ_CP013368	Burkholderia ubonensis strain RF23-BP41 chromosome 3, complete sequence	925790	117273	118044	925790		Escherichia_phage(100.0%)	1	NA	NA
WP_059610072.1|117273_118044_-	DNA-binding transcriptional repressor DeoR	NA	A0A077SK06	Escherichia_phage	30.6	2.4e-20
>prophage 10
NZ_CP013368	Burkholderia ubonensis strain RF23-BP41 chromosome 3, complete sequence	925790	136827	138465	925790		Staphylococcus_phage(100.0%)	1	NA	NA
WP_059655569.1|136827_138465_-	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	30.2	3.7e-34
>prophage 11
NZ_CP013368	Burkholderia ubonensis strain RF23-BP41 chromosome 3, complete sequence	925790	141571	144120	925790		Tupanvirus(50.0%)	4	NA	NA
WP_059614129.1|141571_142444_+	class I SAM-dependent methyltransferase	NA	A0A2K9L0U7	Tupanvirus	30.6	4.4e-26
WP_059614127.1|142440_142902_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_059614125.1|142904_143168_+	acyl carrier protein	NA	NA	NA	NA	NA
WP_059614123.1|143154_144120_+	acyl-CoA desaturase	NA	V5LQE2	Emiliania_huxleyi_virus	32.4	3.5e-24
>prophage 12
NZ_CP013368	Burkholderia ubonensis strain RF23-BP41 chromosome 3, complete sequence	925790	148596	149331	925790		Bacillus_phage(100.0%)	1	NA	NA
WP_059609215.1|148596_149331_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	34.5	6.3e-34
>prophage 13
NZ_CP013368	Burkholderia ubonensis strain RF23-BP41 chromosome 3, complete sequence	925790	152473	160047	925790		Bacillus_virus(25.0%)	5	NA	NA
WP_059655576.1|152473_153166_-	OmpA family protein	NA	G3M9Z0	Bacillus_virus	38.6	1.8e-06
WP_080402184.1|153255_157701_-	hypothetical protein	NA	A0A2C9CZB7	Yersinia_phage	42.4	5.5e-08
WP_155122770.1|157903_158107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059613748.1|158843_159422_+	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	47.7	1.6e-37
WP_059613746.1|159477_160047_-	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	55.1	5.4e-41
>prophage 14
NZ_CP013368	Burkholderia ubonensis strain RF23-BP41 chromosome 3, complete sequence	925790	165518	166253	925790		Bacillus_phage(100.0%)	1	NA	NA
WP_059613736.1|165518_166253_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.8	3.2e-30
>prophage 15
NZ_CP013368	Burkholderia ubonensis strain RF23-BP41 chromosome 3, complete sequence	925790	182889	190717	925790	transposase	Staphylococcus_phage(25.0%)	6	NA	NA
WP_059652350.1|182889_183618_+|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	32.4	4.6e-21
WP_059652379.1|183719_184799_-	HAF repeat-containing protein	NA	NA	NA	NA	NA
WP_059652376.1|185232_186267_-	DUF1016 domain-containing protein	NA	Q9JMP5	Wolbachia_phage	33.3	2.6e-33
WP_059652348.1|187467_188355_-	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	41.7	1.9e-05
WP_059652345.1|188494_189748_+	MFS transporter	NA	NA	NA	NA	NA
WP_059652341.1|189766_190717_-	LysR family transcriptional regulator	NA	A0A2H4J8I9	uncultured_Caudovirales_phage	38.6	1.9e-06
>prophage 16
NZ_CP013368	Burkholderia ubonensis strain RF23-BP41 chromosome 3, complete sequence	925790	207702	213843	925790		Bacillus_thuringiensis_phage(33.33%)	4	NA	NA
WP_059652318.1|207702_209082_-	sigma-54-dependent Fis family transcriptional regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	32.9	8.2e-11
WP_059652315.1|209063_210563_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	24.2	6.0e-07
WP_059615610.1|211087_212287_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_059652312.1|212283_213843_-	D-xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.0	1.0e-09
>prophage 17
NZ_CP013368	Burkholderia ubonensis strain RF23-BP41 chromosome 3, complete sequence	925790	223561	228739	925790		Staphylococcus_phage(50.0%)	4	NA	NA
WP_069275246.1|223561_225016_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	24.9	3.4e-15
WP_059652298.1|225077_226040_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_059652291.1|226276_227020_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_059652289.1|227215_228739_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	26.7	1.0e-14
>prophage 18
NZ_CP013368	Burkholderia ubonensis strain RF23-BP41 chromosome 3, complete sequence	925790	239953	247114	925790		Paenibacillus_phage(100.0%)	1	NA	NA
WP_080402091.1|239953_247114_-	type I polyketide synthase	NA	D0R7J2	Paenibacillus_phage	32.1	2.7e-28
>prophage 19
NZ_CP013368	Burkholderia ubonensis strain RF23-BP41 chromosome 3, complete sequence	925790	253537	263324	925790		Tupanvirus(50.0%)	2	NA	NA
WP_059652262.1|253537_261541_-	type I polyketide synthase	NA	A0A2K9KZV5	Tupanvirus	27.4	3.3e-67
WP_059652259.1|261560_263324_-	carbamoyltransferase	NA	M1ICZ5	Pelagibacter_phage	29.8	5.0e-45
>prophage 20
NZ_CP013368	Burkholderia ubonensis strain RF23-BP41 chromosome 3, complete sequence	925790	278187	279507	925790		Geobacillus_virus(100.0%)	1	NA	NA
WP_059652233.1|278187_279507_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.9	4.7e-72
>prophage 21
NZ_CP013368	Burkholderia ubonensis strain RF23-BP41 chromosome 3, complete sequence	925790	303526	304051	925790		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_059655682.1|303526_304051_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A1B1IUF0	uncultured_Mediterranean_phage	54.9	2.5e-45
>prophage 22
NZ_CP013368	Burkholderia ubonensis strain RF23-BP41 chromosome 3, complete sequence	925790	321029	322328	925790		Megavirus(100.0%)	1	NA	NA
WP_059655666.1|321029_322328_-	adenylosuccinate synthase	NA	K7YXK1	Megavirus	34.0	4.2e-57
>prophage 23
NZ_CP013368	Burkholderia ubonensis strain RF23-BP41 chromosome 3, complete sequence	925790	328028	328724	925790		Vibrio_phage(100.0%)	1	NA	NA
WP_059616760.1|328028_328724_-	ParA family protein	NA	D4HTX7	Vibrio_phage	31.4	1.3e-20
>prophage 24
NZ_CP013368	Burkholderia ubonensis strain RF23-BP41 chromosome 3, complete sequence	925790	336830	338960	925790		Salmonella_phage(100.0%)	1	NA	NA
WP_059616809.1|336830_338960_+	TonB-dependent siderophore receptor	NA	A0A1B0VCF0	Salmonella_phage	27.5	3.7e-10
>prophage 25
NZ_CP013368	Burkholderia ubonensis strain RF23-BP41 chromosome 3, complete sequence	925790	367494	369339	925790		Bacillus_phage(100.0%)	1	NA	NA
WP_059616705.1|367494_369339_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.1	2.2e-27
>prophage 26
NZ_CP013368	Burkholderia ubonensis strain RF23-BP41 chromosome 3, complete sequence	925790	376740	377511	925790		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_059619556.1|376740_377511_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	27.5	8.9e-07
>prophage 27
NZ_CP013368	Burkholderia ubonensis strain RF23-BP41 chromosome 3, complete sequence	925790	383503	386704	925790		Leptospira_phage(100.0%)	1	NA	NA
WP_059673603.1|383503_386704_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.0	3.6e-41
>prophage 28
NZ_CP013368	Burkholderia ubonensis strain RF23-BP41 chromosome 3, complete sequence	925790	392316	393504	925790		Catovirus(100.0%)	1	NA	NA
WP_059615525.1|392316_393504_-	TIGR03118 family protein	NA	A0A1V0S9B1	Catovirus	28.0	1.1e-24
>prophage 29
NZ_CP013368	Burkholderia ubonensis strain RF23-BP41 chromosome 3, complete sequence	925790	398362	400927	925790	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_059657403.1|398362_400927_+|tRNA	valine--tRNA ligase	tRNA	A0A2K9KZB8	Tupanvirus	35.3	3.4e-151
>prophage 30
NZ_CP013368	Burkholderia ubonensis strain RF23-BP41 chromosome 3, complete sequence	925790	410629	412588	925790		Microcystis_phage(100.0%)	1	NA	NA
WP_059657392.1|410629_412588_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BUR2	Microcystis_phage	33.5	9.5e-21
>prophage 31
NZ_CP013368	Burkholderia ubonensis strain RF23-BP41 chromosome 3, complete sequence	925790	419767	422839	925790		Bacillus_phage(100.0%)	1	NA	NA
WP_059657387.1|419767_422839_+	cyclic nucleotide-binding domain-containing protein	NA	W8CYL7	Bacillus_phage	28.0	4.5e-41
>prophage 32
NZ_CP013368	Burkholderia ubonensis strain RF23-BP41 chromosome 3, complete sequence	925790	427138	429709	925790		Cedratvirus(50.0%)	2	NA	NA
WP_059657382.1|427138_429229_+	protein kinase	NA	A0A1M7XUH0	Cedratvirus	25.4	1.5e-11
WP_059657380.1|429250_429709_-	(2Fe-2S)-binding protein	NA	A0A0P0IVM8	Acinetobacter_phage	30.8	8.5e-05
>prophage 33
NZ_CP013368	Burkholderia ubonensis strain RF23-BP41 chromosome 3, complete sequence	925790	433640	474651	925790		Tupanvirus(66.67%)	9	NA	NA
WP_059657378.1|433640_435344_-	cyclic peptide export ABC transporter	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.9	9.2e-12
WP_059615455.1|435357_435888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059615569.1|435936_436416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059657376.1|436469_437126_-	glycosyltransferase family 25 protein	NA	A0A218MMA0	uncultured_virus	30.1	1.8e-24
WP_059657374.1|437122_446620_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	27.0	1.8e-157
WP_080402262.1|446644_455725_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	20.6	8.2e-75
WP_059657370.1|455721_459636_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	30.5	1.0e-69
WP_059657368.1|459623_461240_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_059657366.1|461250_474651_-	hybrid non-ribosomal peptide synthetase/type I polyketide synthase	NA	A0A2K9KZV5	Tupanvirus	26.7	6.6e-97
>prophage 34
NZ_CP013368	Burkholderia ubonensis strain RF23-BP41 chromosome 3, complete sequence	925790	477967	486104	925790		Paenibacillus_phage(33.33%)	4	NA	NA
WP_059657362.1|477967_482389_-	AMP-binding protein	NA	D0R7J2	Paenibacillus_phage	33.7	1.9e-32
WP_059657361.1|482646_483609_-	taurine catabolism dioxygenase TauD	NA	NA	NA	NA	NA
WP_059657359.1|483692_485003_-	diaminobutyrate--2-oxoglutarate transaminase family protein	NA	A0A1V0SKB7	Klosneuvirus	24.9	5.8e-22
WP_059617616.1|485153_486104_-	SDR family oxidoreductase	NA	A0A2K9KZK0	Tupanvirus	47.9	9.5e-83
>prophage 35
NZ_CP013368	Burkholderia ubonensis strain RF23-BP41 chromosome 3, complete sequence	925790	491750	494850	925790		Megavirus(50.0%)	2	NA	NA
WP_155122779.1|491750_492992_+	hypothetical protein	NA	L7XZI3	Megavirus	27.3	1.2e-13
WP_059657354.1|493056_494850_+	carbamoyltransferase	NA	E3SL71	Synechococcus_phage	32.3	1.5e-44
>prophage 36
NZ_CP013368	Burkholderia ubonensis strain RF23-BP41 chromosome 3, complete sequence	925790	507334	550749	925790		Paenibacillus_phage(100.0%)	6	NA	NA
WP_080402261.1|507334_514051_+	SDR family NAD(P)-dependent oxidoreductase	NA	D0R7J2	Paenibacillus_phage	27.7	1.0e-29
WP_059657348.1|514111_519421_+	SDR family NAD(P)-dependent oxidoreductase	NA	D0R7J2	Paenibacillus_phage	28.8	9.5e-23
WP_059657346.1|519420_525438_+	SDR family NAD(P)-dependent oxidoreductase	NA	D0R7J2	Paenibacillus_phage	32.5	1.2e-26
WP_059657345.1|525437_534395_+	type I polyketide synthase	NA	D0R7J2	Paenibacillus_phage	31.9	9.1e-26
WP_059657344.1|534405_543375_+	SDR family NAD(P)-dependent oxidoreductase	NA	D0R7J2	Paenibacillus_phage	32.2	5.5e-31
WP_059657342.1|543399_550749_+	SDR family NAD(P)-dependent oxidoreductase	NA	D0R7J2	Paenibacillus_phage	32.2	1.0e-30
>prophage 37
NZ_CP013368	Burkholderia ubonensis strain RF23-BP41 chromosome 3, complete sequence	925790	558534	558882	925790		Bacillus_phage(100.0%)	1	NA	NA
WP_010098558.1|558534_558882_-	GIY-YIG nuclease family protein	NA	A0A076G735	Bacillus_phage	44.1	5.2e-07
>prophage 38
NZ_CP013368	Burkholderia ubonensis strain RF23-BP41 chromosome 3, complete sequence	925790	571160	575641	925790		Bacillus_virus(50.0%)	2	NA	NA
WP_059615352.1|571160_573482_-	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	35.5	1.7e-16
WP_059615349.1|573508_575641_-	EAL domain-containing protein	NA	A0A127AWB9	Bacillus_phage	28.7	7.0e-09
>prophage 39
NZ_CP013368	Burkholderia ubonensis strain RF23-BP41 chromosome 3, complete sequence	925790	600734	684664	925790	plate,transposase	Bacillus_phage(21.43%)	68	NA	NA
WP_059617666.1|600734_602081_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_088500724.1|602108_602621_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_010088970.1|602711_603197_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_059615314.1|603303_604797_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_059615312.1|604830_605385_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_059657303.1|605418_608172_-	type VI secretion system ATPase TssH	NA	A0A1C3S747	Escherichia_phage	33.0	1.4e-86
WP_059657301.1|608812_609478_+	TagK domain-containing protein	NA	NA	NA	NA	NA
WP_059617671.1|609503_610085_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_059657299.1|610137_612027_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_059657409.1|612029_613133_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_088503020.1|613195_614212_+	type VI secretion protein ImpA	NA	NA	NA	NA	NA
WP_059657294.1|614283_616575_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	29.5	4.4e-41
WP_059657292.1|616588_619036_+	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_059657290.1|619032_620115_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_088503019.1|620211_620823_+	DUF3540 domain-containing protein	NA	NA	NA	NA	NA
WP_059617683.1|620835_621219_+	DUF4150 domain-containing protein	NA	NA	NA	NA	NA
WP_059615293.1|621581_621815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155122784.1|621818_623129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059617688.1|623139_623955_-	5'/3'-nucleotidase SurE	NA	NA	NA	NA	NA
WP_059615288.1|624172_624703_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_059657284.1|624789_625347_+	sugar O-acetyltransferase	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	32.0	7.1e-06
WP_059615284.1|625490_626816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059657282.1|626815_628387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059615281.1|628383_629475_+	AAA domain-containing protein	NA	NA	NA	NA	NA
WP_059657280.1|629474_631730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059617701.1|631757_632918_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	33.2	2.2e-41
WP_059615553.1|632936_633158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088503018.1|633208_633958_-	spermidine synthase	NA	NA	NA	NA	NA
WP_059615273.1|634026_634290_-	phosphate ABC transporter permease	NA	NA	NA	NA	NA
WP_059657277.1|634291_634741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059615551.1|634934_635279_+	alkylphosphonate utilization protein	NA	NA	NA	NA	NA
WP_059657275.1|635333_636176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010097212.1|636201_636387_-	CopG family transcriptional regulator	NA	NA	NA	NA	NA
WP_059615267.1|636493_637261_-	DUF1275 domain-containing protein	NA	NA	NA	NA	NA
WP_059657273.1|637488_639495_+	hydrogenase 4 subunit B	NA	NA	NA	NA	NA
WP_059657271.1|639488_640439_+	formate hydrogenlyase	NA	NA	NA	NA	NA
WP_010097204.1|640439_641099_+	formate hydrogenlyase	NA	NA	NA	NA	NA
WP_059615261.1|641091_642564_+	hydrogenase 4 subunit F	NA	NA	NA	NA	NA
WP_059657270.1|642567_644127_+	hydrogenase	NA	NA	NA	NA	NA
WP_059617714.1|644126_644636_+	formate hydrogenlyase	NA	NA	NA	NA	NA
WP_059657268.1|644720_645065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059657266.1|645067_645280_+	twin transmembrane helix small protein	NA	NA	NA	NA	NA
WP_124470467.1|645458_646145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059615251.1|646330_646957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059657265.1|647179_649117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059615247.1|649360_650509_+	porin	NA	NA	NA	NA	NA
WP_059592756.1|650830_652063_+	3-methyl-2-oxobutanoate dehydrogenase (2-methylpropanoyl-transferring) subunit alpha	NA	NA	NA	NA	NA
WP_059657264.1|652065_653109_+	alpha-ketoacid dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_059615240.1|653110_654421_+	2-oxo acid dehydrogenase subunit E2	NA	NA	NA	NA	NA
WP_059657263.1|654426_655818_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.3	1.7e-43
WP_080484886.1|656771_657866_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_059655101.1|657997_660721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059655099.1|660720_663438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080402849.1|663913_665176_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_059655105.1|665394_671286_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	38.3	1.0e-190
WP_059655107.1|671355_672762_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	40.1	6.6e-24
WP_088501358.1|673234_674149_+	acyl-CoA desaturase	NA	F2NZ38	Diadromus_pulchellus_ascovirus	29.9	1.9e-19
WP_059632028.1|674174_674459_+	acyl carrier protein	NA	NA	NA	NA	NA
WP_059655109.1|674471_675404_+	class I SAM-dependent methyltransferase	NA	A0A2K9L4K8	Tupanvirus	30.3	7.2e-27
WP_059655111.1|675400_676408_+	acyl-CoA desaturase	NA	A0A1B1IX11	uncultured_Mediterranean_phage	25.8	2.4e-07
WP_059655113.1|676447_677434_+	amidohydrolase	NA	NA	NA	NA	NA
WP_059655120.1|677430_679248_+	fatty acyl-AMP ligase	NA	A0A2K9L3I8	Tupanvirus	22.0	1.4e-05
WP_059615214.1|679261_679681_+	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_059655122.1|679687_680659_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_059655124.1|680750_682343_-	PAS domain S-box protein	NA	W8CYF6	Bacillus_phage	26.8	3.0e-17
WP_080402160.1|682824_683535_-	UdgX family uracil-DNA binding protein	NA	A0A127AW33	Bacillus_phage	29.1	1.6e-10
WP_059617766.1|683643_684138_-	PRC-barrel domain containing protein	NA	NA	NA	NA	NA
WP_059632016.1|684229_684664_-	CBS domain-containing protein	NA	A0A2I6B2H4	Macacine_betaherpesvirus	36.4	4.7e-13
>prophage 40
NZ_CP013368	Burkholderia ubonensis strain RF23-BP41 chromosome 3, complete sequence	925790	689983	690532	925790		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_059617929.1|689983_690532_+	type 1 glutamine amidotransferase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	36.3	1.6e-18
>prophage 41
NZ_CP013368	Burkholderia ubonensis strain RF23-BP41 chromosome 3, complete sequence	925790	701319	703191	925790		Planktothrix_phage(100.0%)	1	NA	NA
WP_059655148.1|701319_703191_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	30.7	2.0e-15
>prophage 42
NZ_CP013368	Burkholderia ubonensis strain RF23-BP41 chromosome 3, complete sequence	925790	721697	723125	925790		Burkholderia_virus(100.0%)	1	NA	NA
WP_059655170.1|721697_723125_-	MHS family MFS transporter	NA	Q6JIH2	Burkholderia_virus	28.9	9.3e-34
>prophage 43
NZ_CP013368	Burkholderia ubonensis strain RF23-BP41 chromosome 3, complete sequence	925790	728726	730573	925790		uncultured_virus(50.0%)	4	NA	NA
WP_059655178.1|728726_728960_+	molecular chaperone	NA	A0A219YK71	uncultured_virus	49.2	3.2e-08
WP_059655180.1|729069_729324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155122786.1|729409_729805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059617836.1|730009_730573_-	Hsp20/alpha crystallin family protein	NA	A0A1B2LRT2	Wolbachia_phage	32.3	4.7e-13
>prophage 44
NZ_CP013368	Burkholderia ubonensis strain RF23-BP41 chromosome 3, complete sequence	925790	743279	749143	925790		Staphylococcus_phage(50.0%)	4	NA	NA
WP_059617862.1|743279_746057_+	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	30.4	5.5e-22
WP_059617864.1|746058_747171_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_059617933.1|747225_748374_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_059655204.1|748378_749143_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	31.3	2.7e-19
>prophage 45
NZ_CP013368	Burkholderia ubonensis strain RF23-BP41 chromosome 3, complete sequence	925790	765107	771863	925790	tRNA,transposase	Orpheovirus(25.0%)	5	NA	NA
WP_063803182.1|765107_766382_-|tRNA	aspartate--tRNA(Asn) ligase	tRNA	A0A2I2L4Y8	Orpheovirus	35.6	9.4e-62
WP_059655221.1|767307_767811_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	53.0	1.1e-42
WP_059615101.1|767903_768923_+	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.5	5.0e-21
WP_059615099.1|769051_770449_+	PTS sucrose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_063803183.1|770450_771863_+	glycoside hydrolase family 32 protein	NA	S6ATV4	Bacillus_phage	26.8	1.3e-22
>prophage 46
NZ_CP013368	Burkholderia ubonensis strain RF23-BP41 chromosome 3, complete sequence	925790	775816	778347	925790		Cyanophage(50.0%)	2	NA	NA
WP_059617895.1|775816_777292_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	34.6	2.1e-73
WP_059655228.1|777969_778347_-	hypothetical protein	NA	A0A0K2QQ09	Ralstonia_phage	58.5	2.2e-30
>prophage 47
NZ_CP013368	Burkholderia ubonensis strain RF23-BP41 chromosome 3, complete sequence	925790	781819	789185	925790		Ralstonia_phage(50.0%)	6	NA	NA
WP_059655233.1|781819_782728_+	hypothetical protein	NA	A0JC28	Ralstonia_phage	32.7	1.8e-27
WP_059655235.1|782724_784107_+	type II secretory pathway protein	NA	R9TEZ5	Vibrio_phage	25.9	7.0e-10
WP_059655237.1|784598_785381_+	hypothetical protein	NA	A0A1W5LU59	Ralstonia_phage	41.4	1.0e-34
WP_059655250.1|785418_785655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059655249.1|785651_785939_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_059615582.1|788342_789185_-	alpha/beta hydrolase	NA	A0A0A0RRH5	Mycobacterium_phage	32.8	5.2e-08
>prophage 48
NZ_CP013368	Burkholderia ubonensis strain RF23-BP41 chromosome 3, complete sequence	925790	792925	805050	925790		Tupanvirus(50.0%)	3	NA	NA
WP_080402242.1|792925_800563_+	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	27.1	1.2e-156
WP_059615590.1|800629_801808_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_059657024.1|801864_805050_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.2	1.3e-56
>prophage 49
NZ_CP013368	Burkholderia ubonensis strain RF23-BP41 chromosome 3, complete sequence	925790	813675	815445	925790		Feldmannia_species_virus(100.0%)	1	NA	NA
WP_059657019.1|813675_815445_-	histidine kinase	NA	B5LWN8	Feldmannia_species_virus	26.4	7.8e-06
>prophage 50
NZ_CP013368	Burkholderia ubonensis strain RF23-BP41 chromosome 3, complete sequence	925790	824283	832611	925790		Diadromus_pulchellus_ascovirus(40.0%)	9	NA	NA
WP_059657008.1|824283_825027_-	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	32.5	5.4e-17
WP_059657006.1|825148_826057_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_059657004.1|826099_826831_-	response regulator transcription factor	NA	A0A2R2ZGH8	Clostridioides_phage	23.9	1.2e-08
WP_059657033.1|826832_827852_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	35.1	1.1e-17
WP_155122791.1|828091_828631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059657000.1|828836_829376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059656998.1|829391_830267_-	SDR family NAD(P)-dependent oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	29.4	8.6e-06
WP_059534493.1|830362_830941_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_059615633.1|831135_832611_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	34.4	9.5e-74
>prophage 51
NZ_CP013368	Burkholderia ubonensis strain RF23-BP41 chromosome 3, complete sequence	925790	846011	851005	925790		Bacillus_virus(50.0%)	3	NA	NA
WP_059656986.1|846011_847343_-	nitrate/sulfonate/bicarbonate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.5	5.5e-28
WP_059656984.1|847365_849099_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_059656982.1|849370_851005_+	chaperonin GroEL	NA	A0A240F779	uncultured_virus	47.3	4.8e-127
>prophage 52
NZ_CP013368	Burkholderia ubonensis strain RF23-BP41 chromosome 3, complete sequence	925790	855001	862410	925790		Loktanella_phage(33.33%)	7	NA	NA
WP_059656977.1|855001_856804_+	adenosylcobalamin-dependent ribonucleoside-diphosphate reductase	NA	M4QT32	Loktanella_phage	38.7	4.6e-94
WP_059673621.1|856826_858755_-	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	E5EQU5	Bathycoccus_sp._RCC1105_virus	43.5	6.3e-102
WP_059610201.1|858778_859426_-	BON domain-containing protein	NA	NA	NA	NA	NA
WP_059610202.1|859459_860110_-	BON domain-containing protein	NA	NA	NA	NA	NA
WP_059617217.1|860352_860544_+	DUF2964 domain-containing protein	NA	NA	NA	NA	NA
WP_059610204.1|860572_861709_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_059610205.1|861711_862410_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.0	1.8e-38
>prophage 53
NZ_CP013368	Burkholderia ubonensis strain RF23-BP41 chromosome 3, complete sequence	925790	868080	873345	925790		Synechococcus_phage(33.33%)	5	NA	NA
WP_059657242.1|868080_869121_-	zinc-dependent alcohol dehydrogenase family protein	NA	E3SJ82	Synechococcus_phage	26.5	5.4e-15
WP_088503044.1|869218_870994_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_059657241.1|871044_871791_-	acetoacetyl-CoA reductase	NA	A0A0K0KVL6	Prochlorococcus_phage	25.5	1.6e-05
WP_059657240.1|871780_872317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059657239.1|872505_873345_+	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	25.9	1.3e-06
>prophage 54
NZ_CP013368	Burkholderia ubonensis strain RF23-BP41 chromosome 3, complete sequence	925790	879750	889303	925790		Enterococcus_phage(25.0%)	11	NA	NA
WP_059610221.1|879750_880398_-	LemA family protein	NA	A0A0C5K8T5	Enterococcus_phage	27.5	8.9e-08
WP_080402255.1|880633_880822_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_080402254.1|880899_883068_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	35.6	4.4e-83
WP_155122792.1|883282_883453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059610222.1|883454_884021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059635107.1|884022_884451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059610224.1|884879_885653_+	fumarate/nitrate reduction transcriptional regulator Fnr	NA	NA	NA	NA	NA
WP_059657233.1|885728_886718_-	zinc-dependent alcohol dehydrogenase family protein	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.3	5.0e-18
WP_059657232.1|886914_887916_+	nitroreductase	NA	NA	NA	NA	NA
WP_059617251.1|887949_888285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059657231.1|888298_889303_+	TIGR00730 family Rossman fold protein	NA	F4YCQ1	Synechococcus_phage	36.2	3.9e-10
>prophage 55
NZ_CP013368	Burkholderia ubonensis strain RF23-BP41 chromosome 3, complete sequence	925790	899585	903296	925790		Hokovirus(100.0%)	1	NA	NA
WP_059657228.1|899585_903296_-	response regulator	NA	A0A1V0SGX0	Hokovirus	31.2	3.3e-62
>prophage 56
NZ_CP013368	Burkholderia ubonensis strain RF23-BP41 chromosome 3, complete sequence	925790	907646	913016	925790		Streptococcus_phage(50.0%)	4	NA	NA
WP_059657225.1|907646_909938_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	28.3	1.8e-50
WP_059657223.1|910174_910783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059657222.1|910906_912169_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_059657220.1|912251_913016_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.9	7.7e-19
>prophage 1
NZ_CP013369	Burkholderia ubonensis strain RF23-BP41 plasmid pRF23, complete sequence	258679	4359	59456	258679	integrase,transposase,coat	Stx2-converting_phage(25.0%)	40	NA	NA
WP_069275252.1|4359_5922_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	54.9	2.4e-152
WP_034184982.1|5951_6299_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	72.9	1.6e-40
WP_059655039.1|6295_6703_-|transposase	transposase	transposase	A0A0P0ZBP6	Stx2-converting_phage	35.3	8.9e-14
WP_088503120.1|7484_8682_+|transposase	IS3 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	62.7	2.6e-98
WP_155122796.1|8727_9573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155122797.1|9669_10908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059655043.1|11446_11803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059673668.1|12136_12574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059655049.1|12882_13803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059655051.1|13864_14521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059673670.1|15247_15967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155122798.1|17190_17499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080402154.1|17502_22017_-	type IV secretion protein Rhs	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	34.6	8.9e-22
WP_059655055.1|22032_23298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059655057.1|23313_25518_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	28.1	1.2e-43
WP_059655093.1|25967_28307_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D1G8E2	Mycobacterium_phage	33.7	6.5e-08
WP_059673672.1|28333_29503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080402156.1|29530_29716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059655063.1|29772_30708_-	trypsin-like peptidase domain-containing protein	NA	NA	NA	NA	NA
WP_059655095.1|31377_31623_+	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_059655065.1|31612_31912_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_059655067.1|31962_32319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059655069.1|33373_34342_-	ParB/RepB/Spo0J family partition protein	NA	S5VTK0	Leptospira_phage	35.5	6.8e-12
WP_059618340.1|34338_35547_-	AAA family ATPase	NA	A0A240F4U1	Ochrobactrum_phage	27.4	1.7e-28
WP_059655071.1|36371_37754_+	replication initiation protein	NA	NA	NA	NA	NA
WP_059655073.1|38396_39398_-	patatin-like phospholipase family protein	NA	A0A1B2LRS3	Wolbachia_phage	30.9	7.8e-19
WP_059655075.1|39824_41024_-	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_059655076.1|41144_41495_+	helix-turn-helix transcriptional regulator	NA	S5MCH5	Brevibacillus_phage	35.2	4.1e-07
WP_059655078.1|41494_42364_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_059655080.1|42930_43776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059655082.1|44311_46435_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_155122799.1|47211_47838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059655086.1|48210_50172_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_059636632.1|51675_52131_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_059636629.1|52127_54518_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_059636627.1|54536_55268_-	molecular chaperone	NA	NA	NA	NA	NA
WP_080400280.1|55271_55853_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_080402854.1|56663_57926_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_155122800.1|58108_58285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088503032.1|58257_59456_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.2	6.0e-50
