The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP013362	Burkholderia diffusa strain RF2-non-BP9 chromosome 1, complete sequence	3333368	392424	418271	3333368	protease,transposase,plate	uncultured_Caudovirales_phage(50.0%)	22	NA	NA
WP_059593715.1|392424_392946_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	46.7	4.8e-20
WP_155768725.1|393222_393924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059449797.1|394351_394555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059468318.1|394636_395437_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_069225057.1|395797_398977_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	28.7	3.2e-58
WP_069225058.1|399028_403669_+	sugar-binding protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	47.0	1.8e-49
WP_069225059.1|403665_404034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155768726.1|404589_404757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069225060.1|405287_405713_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_155768721.1|405900_407027_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	44.6	6.6e-59
WP_167359227.1|407147_407402_+	TNT domain-containing protein	NA	NA	NA	NA	NA
WP_059914980.1|407834_408152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069225061.1|408244_409027_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_059465239.1|409023_410370_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_059539163.1|410472_411072_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_059465241.1|411464_412106_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_059465242.1|412150_412666_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_006757139.1|412681_414172_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_006477093.1|414242_414746_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_059465243.1|414808_415294_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_059465244.1|415371_417207_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_059465245.1|417170_418271_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 2
NZ_CP013362	Burkholderia diffusa strain RF2-non-BP9 chromosome 1, complete sequence	3333368	714667	723719	3333368		Hokovirus(16.67%)	7	NA	NA
WP_059465455.1|714667_716617_+	molecular chaperone DnaK	NA	A0A1V0SH73	Hokovirus	50.3	1.5e-146
WP_059465456.1|716870_718007_+	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	26.5	8.5e-22
WP_069225163.1|718011_719931_+	bifunctional anthranilate synthase component I family protein/class IV aminotransferase	NA	S4VT78	Pandoravirus	35.9	4.0e-56
WP_069225164.1|720063_720879_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	33.3	1.1e-36
WP_059465459.1|720922_721609_-	deoxynucleoside kinase	NA	A0A249XZR7	Enterococcus_phage	24.4	1.2e-05
WP_059465460.1|721605_722148_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_059538295.1|722183_723719_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	30.3	3.0e-22
>prophage 3
NZ_CP013362	Burkholderia diffusa strain RF2-non-BP9 chromosome 1, complete sequence	3333368	1571800	1606296	3333368	capsid	Burkholderia_phage(64.86%)	48	NA	NA
WP_069225576.1|1571800_1572424_-	1-pyrroline-5-carboxylate dehydrogenase	NA	A9YX18	Burkholderia_phage	92.5	1.8e-18
WP_069225577.1|1572420_1574187_-	AAA family ATPase	NA	J7HXJ7	Pseudomonas_phage	34.7	1.8e-71
WP_069225578.1|1574199_1575375_-	hypothetical protein	NA	J7HXB6	Pseudomonas_phage	52.2	1.3e-62
WP_069225579.1|1575389_1576199_-	hypothetical protein	NA	J7HXJ4	Pseudomonas_phage	61.7	3.8e-93
WP_167359236.1|1576195_1576339_-	hypothetical protein	NA	A9YWW4	Burkholderia_phage	73.9	4.6e-10
WP_167359237.1|1576335_1576503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167359238.1|1576499_1576676_-	hypothetical protein	NA	A9YWW6	Burkholderia_phage	67.2	3.8e-14
WP_069225580.1|1576675_1577002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069225581.1|1576998_1577229_-	hypothetical protein	NA	Q3HQW9	Burkholderia_phage	57.1	1.1e-16
WP_081334236.1|1577276_1577579_-	hypothetical protein	NA	A0A2K8HLR2	Pseudomonas_phage	44.7	5.0e-14
WP_069225582.1|1577606_1578023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060127776.1|1578866_1579211_-	helix-turn-helix domain-containing protein	NA	A9YWX7	Burkholderia_phage	83.5	2.6e-46
WP_060127774.1|1579295_1579550_+	transcriptional regulator	NA	A9YWX8	Burkholderia_phage	92.1	1.4e-36
WP_059594800.1|1579592_1579817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069225584.1|1579813_1580041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069225585.1|1580073_1580874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069226368.1|1581596_1582031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069225586.1|1582027_1582501_+	RusA family crossover junction endodeoxyribonuclease	NA	A9YWY9	Burkholderia_phage	76.6	1.2e-59
WP_081334278.1|1582547_1582841_+	hypothetical protein	NA	A9YWZ0	Burkholderia_phage	58.2	2.7e-20
WP_069225588.1|1582837_1583269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155768743.1|1583378_1584140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069225589.1|1584250_1584916_+	hypothetical protein	NA	A9YWZ4	Burkholderia_phage	81.4	6.6e-107
WP_060294337.1|1584933_1585413_+	DUF2280 domain-containing protein	NA	A9YWZ5	Burkholderia_phage	92.5	6.2e-75
WP_069225590.1|1585414_1587010_+	TerL protein	NA	A9YWZ6	Burkholderia_phage	90.2	9.4e-293
WP_081334237.1|1587006_1588590_+	DUF1073 domain-containing protein	NA	A0A0P0I486	Acinetobacter_phage	61.7	5.0e-153
WP_081334238.1|1588519_1589173_+|capsid	minor capsid protein	capsid	A9YWZ8	Burkholderia_phage	70.1	1.7e-75
WP_069225592.1|1589174_1590476_+	DUF2213 domain-containing protein	NA	A0A0P0IRE1	Acinetobacter_phage	45.5	5.6e-70
WP_069225593.1|1590488_1590977_+	hypothetical protein	NA	A0A0P0I8F3	Acinetobacter_phage	56.2	2.1e-38
WP_069225594.1|1590987_1592025_+	DUF2184 domain-containing protein	NA	A0A0N7IRF2	Acinetobacter_phage	66.9	8.3e-125
WP_069225595.1|1592026_1592299_+	hypothetical protein	NA	A9YX24	Burkholderia_phage	74.0	5.4e-15
WP_069225596.1|1592307_1592691_+	DUF4054 domain-containing protein	NA	A9YX25	Burkholderia_phage	89.0	1.0e-59
WP_069225597.1|1592719_1593202_+	hypothetical protein	NA	A9YX26	Burkholderia_phage	86.2	2.3e-69
WP_069225598.1|1593237_1593459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069225599.1|1593520_1593898_+	hypothetical protein	NA	A9YX28	Burkholderia_phage	86.4	3.0e-56
WP_069225600.1|1593902_1594493_+	hypothetical protein	NA	A9YX29	Burkholderia_phage	92.3	2.4e-100
WP_069225601.1|1594502_1595978_+	DUF3383 domain-containing protein	NA	A0A0P0I492	Acinetobacter_phage	46.8	9.8e-111
WP_069225602.1|1595993_1596434_+	DUF3277 family protein	NA	A0A0P0IKY2	Acinetobacter_phage	60.3	2.9e-42
WP_069225603.1|1596436_1596988_+	hypothetical protein	NA	A0A0N7IRF3	Acinetobacter_phage	33.0	3.1e-17
WP_069225604.1|1597171_1599172_+	mannosyl-glycoprotein endo-beta-N-acetylglucosamidase	NA	A0A0M4REK7	Salmonella_phage	35.8	5.5e-40
WP_081334239.1|1599168_1599744_+	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	36.3	7.6e-19
WP_069225605.1|1599743_1600061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069225606.1|1600057_1601026_+	hypothetical protein	NA	A9YX04	Burkholderia_phage	97.2	4.0e-161
WP_069225607.1|1601022_1601400_-	hypothetical protein	NA	A9YX05	Burkholderia_phage	84.0	5.6e-55
WP_069225608.1|1601403_1602156_+	hypothetical protein	NA	A9YX06	Burkholderia_phage	90.4	4.1e-121
WP_069225609.1|1602164_1602518_+	hypothetical protein	NA	A9YX11	Burkholderia_phage	94.9	7.3e-57
WP_069225610.1|1602514_1603696_+	hypothetical protein	NA	A9YX12	Burkholderia_phage	93.6	2.9e-198
WP_069225611.1|1603695_1605216_+	DUF2612 domain-containing protein	NA	A9YX13	Burkholderia_phage	36.8	7.0e-72
WP_069225612.1|1605279_1606296_+	hypothetical protein	NA	A9YX14	Burkholderia_phage	40.0	6.2e-64
>prophage 1
NZ_CP013363	Burkholderia diffusa strain RF2-non-BP9 chromosome 2, complete sequence	2619120	1669758	1713887	2619120	plate,protease,portal,tail,terminase,holin,capsid,integrase,head	Burkholderia_phage(38.89%)	47	1666584:1666604	1714109:1714129
1666584:1666604	attL	TTACTCGTTTTCCTCGAAGTA	NA	NA	NA	NA
WP_069227253.1|1669758_1670439_-	hypothetical protein	NA	Q8W6R8	Burkholderia_virus	72.6	2.0e-95
WP_069227254.1|1670522_1670978_+	hypothetical protein	NA	C7BGE3	Burkholderia_phage	45.3	3.4e-30
WP_069227255.1|1671198_1674144_-	class I SAM-dependent DNA methyltransferase	NA	Q6NE04	Leptospira_phage	25.5	1.4e-39
WP_059464567.1|1674566_1674974_+	PAAR domain-containing protein	NA	Q8W6S2	Burkholderia_virus	42.2	3.4e-13
WP_059464566.1|1674978_1675482_+	DUF4123 domain-containing protein	NA	A4PE24	Ralstonia_virus	45.4	1.9e-21
WP_059464565.1|1675829_1676441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069227256.1|1676453_1677164_+	LysR family transcriptional regulator	NA	A4PE26	Ralstonia_virus	38.5	3.8e-36
WP_069227257.1|1677202_1677991_-	DNA adenine methylase	NA	Q8W6S4	Burkholderia_virus	91.2	1.5e-145
WP_069227258.1|1678160_1678655_-	DUF2514 family protein	NA	C7BGD9	Burkholderia_phage	54.4	1.9e-34
WP_069227259.1|1678651_1679071_-	glycoside hydrolase family protein	NA	A0A1Q1PW74	Pseudoalteromonas_phage	44.7	1.3e-23
WP_069227260.1|1679063_1679357_-|holin	holin	holin	C7BGD7	Burkholderia_phage	90.2	2.4e-37
WP_069227261.1|1679433_1680483_-	late control protein	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	47.9	2.7e-83
WP_069227262.1|1680492_1680699_-|tail	phage tail protein	tail	A0A2H4J9Z9	uncultured_Caudovirales_phage	62.7	6.9e-15
WP_069227263.1|1680673_1681552_-|tail	phage tail protein	tail	A0A2H4J875	uncultured_Caudovirales_phage	37.1	3.0e-35
WP_069227264.1|1681562_1684001_-|tail	phage tail tape measure protein	tail	A0A2H4JG00	uncultured_Caudovirales_phage	33.9	8.4e-59
WP_069227265.1|1684090_1684393_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_069227266.1|1684491_1684998_-|tail	phage major tail tube protein	tail	Q7M2A5	Pseudomonas_phage	51.9	1.1e-42
WP_069227267.1|1685007_1686177_-|tail	phage tail sheath family protein	tail	A0A2H4J869	uncultured_Caudovirales_phage	70.8	7.9e-156
WP_069227268.1|1686255_1687017_-|tail	phage tail protein	tail	E5E3Q6	Burkholderia_phage	54.8	1.3e-55
WP_059542506.1|1689075_1689654_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	43.4	5.1e-31
WP_069227270.1|1689643_1690540_-|plate	baseplate J protein	plate	S4TNY7	Salmonella_phage	40.4	1.8e-46
WP_069227271.1|1690536_1690872_-|plate	phage baseplate protein	plate	A0A2H4JA09	uncultured_Caudovirales_phage	47.2	8.6e-23
WP_069227272.1|1690871_1691072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069227273.1|1691131_1691812_-|plate	phage baseplate assembly protein V	plate	A0A1B2LRU5	Wolbachia_phage	29.8	4.9e-17
WP_069227274.1|1691815_1692340_-	hypothetical protein	NA	A0A1B2LRU9	Wolbachia_phage	43.0	1.1e-24
WP_069227275.1|1692329_1692860_-|tail	phage tail protein	tail	A0A2H4JBV1	uncultured_Caudovirales_phage	29.9	4.9e-12
WP_059546359.1|1692862_1693153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069227276.1|1693154_1694150_-|capsid	major capsid protein	capsid	A0A2H4J890	uncultured_Caudovirales_phage	60.3	4.4e-115
WP_069227277.1|1694225_1694570_-|head	head decoration protein	head	NA	NA	NA	NA
WP_069227278.1|1694600_1695710_-|protease	Clp protease ClpP	protease	A0A2H4JDI2	uncultured_Caudovirales_phage	39.1	1.6e-52
WP_069227279.1|1695711_1697199_-|portal	phage portal protein	portal	A0A2H4JFL5	uncultured_Caudovirales_phage	50.6	1.5e-130
WP_011657129.1|1697195_1697402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069227280.1|1697411_1699523_-|terminase	phage terminase large subunit family protein	terminase	A0A2D1GMT1	Marinobacter_phage	54.1	8.9e-182
WP_059540501.1|1700442_1700697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069227282.1|1700835_1701243_-	hypothetical protein	NA	C7BGG3	Burkholderia_phage	48.1	1.4e-30
WP_081334326.1|1701255_1702230_-	helix-turn-helix domain-containing protein	NA	C7BGG2	Burkholderia_phage	43.6	7.0e-65
WP_069227283.1|1702232_1703594_-	replicative DNA helicase	NA	C7BGG1	Burkholderia_phage	57.5	1.2e-142
WP_069227284.1|1703592_1703940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069227285.1|1703979_1704501_-	hypothetical protein	NA	C7BGG0	Burkholderia_phage	62.1	2.4e-48
WP_069227286.1|1704969_1705218_-	Cro/Cl family transcriptional regulator	NA	C7BGF8	Burkholderia_phage	87.0	8.8e-33
WP_081334328.1|1705303_1705702_+	hypothetical protein	NA	C7BGF7	Burkholderia_phage	78.9	8.6e-54
WP_069227289.1|1707131_1707956_+	ParB N-terminal domain-containing protein	NA	C7BGF1	Burkholderia_phage	89.4	9.2e-135
WP_081334329.1|1707980_1708220_+	AlpA family phage regulatory protein	NA	C7BGF0	Burkholderia_phage	93.7	2.6e-37
WP_155768807.1|1710059_1710788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069227291.1|1710791_1711535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069227292.1|1711733_1712456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069227293.1|1712612_1713887_-|integrase	site-specific integrase	integrase	C7BGE7	Burkholderia_phage	90.8	2.1e-234
1714109:1714129	attR	TTACTCGTTTTCCTCGAAGTA	NA	NA	NA	NA
