The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	0	13539	5096586		Planktothrix_phage(100.0%)	3	NA	NA
WP_003838907.1|3034_4210_-	MFS transporter	NA	NA	NA	NA	NA
WP_003829138.1|11751_12318_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_003018468.1|12507_13539_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	5.5e-36
>prophage 2
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	25558	29662	5096586		Saccharomonospora_phage(50.0%)	2	NA	NA
WP_003845818.1|25558_29041_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	37.0	7.7e-207
WP_003018518.1|29065_29662_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	39.8	1.3e-26
>prophage 3
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	38481	39240	5096586		Flavobacterium_phage(100.0%)	1	NA	NA
WP_003018543.1|38481_39240_-	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	41.5	7.2e-25
>prophage 4
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	50665	52099	5096586	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_003018567.1|50665_52099_-|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	29.8	2.1e-25
>prophage 5
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	56101	56446	5096586		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_003018581.1|56101_56446_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	50.5	5.9e-27
>prophage 6
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	62381	63179	5096586		Planktothrix_phage(100.0%)	1	NA	NA
WP_003845793.1|62381_63179_-	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	27.4	3.5e-14
>prophage 7
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	73823	80646	5096586	tRNA	Acanthamoeba_polyphaga_mimivirus(50.0%)	6	NA	NA
WP_080953253.1|73823_76298_-	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	29.3	1.7e-38
WP_003018620.1|76326_76857_+	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_046670954.1|76872_77577_+	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_003018625.1|77754_78210_+	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_003837490.1|78280_79177_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_071524282.1|79227_80646_+	polynucleotide adenylyltransferase PcnB	NA	G3MAR3	Bacillus_virus	35.9	5.5e-26
>prophage 8
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	86094	92133	5096586		Anomala_cuprea_entomopoxvirus(25.0%)	5	NA	NA
WP_003837480.1|86094_87021_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	4.1e-22
WP_003018654.1|87129_87792_+	carbonate dehydratase	NA	NA	NA	NA	NA
WP_003018658.1|87885_88422_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	3.9e-17
WP_069219321.1|88673_90329_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	31.8	2.5e-14
WP_046670949.1|90513_92133_-	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	55.3	4.3e-19
>prophage 9
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	99606	101031	5096586		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_003018686.1|99606_101031_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.9	4.6e-41
>prophage 10
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	112097	112661	5096586		Thiobacimonas_phage(100.0%)	1	NA	NA
WP_003018719.1|112097_112661_-	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1B0T6G1	Thiobacimonas_phage	33.1	2.1e-13
>prophage 11
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	116963	118007	5096586		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_003018732.1|116963_118007_-	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	55.0	3.4e-102
>prophage 12
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	144028	145753	5096586		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_003018799.1|144028_145753_-	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	26.7	4.6e-35
>prophage 13
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	162213	162912	5096586		Bacillus_virus(100.0%)	1	NA	NA
WP_046670931.1|162213_162912_+	thiamine ABC transporter ATP-binding protein ThiQ	NA	G3M9Y6	Bacillus_virus	38.2	8.9e-22
>prophage 14
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	170064	175454	5096586		Lymphocystis_disease_virus(50.0%)	2	NA	NA
WP_044712949.1|170064_172416_+	DNA polymerase II	NA	A0A1B2RW58	Lymphocystis_disease_virus	25.1	3.2e-15
WP_046670925.1|172547_175454_+	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.9	1.7e-21
>prophage 15
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	183185	184610	5096586		Pseudomonas_phage(50.0%)	2	NA	NA
WP_003018869.1|183185_184034_+	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A0A0YWI7	Pseudomonas_phage	45.3	6.4e-06
WP_046670921.1|184130_184610_-	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	47.1	3.0e-29
>prophage 16
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	192940	198574	5096586		Vibrio_phage(50.0%)	4	NA	NA
WP_003018896.1|192940_194458_+	L-carnitine/gamma-butyrobetaine antiport BCCT transporter	NA	A0A2I7QNT1	Vibrio_phage	22.1	2.5e-08
WP_003018898.1|194492_195635_+	crotonobetainyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_003837364.1|195740_196958_+	L-carnitine CoA-transferase	NA	NA	NA	NA	NA
WP_003845685.1|197020_198574_+	crotonobetaine/carnitine-CoA ligase	NA	A0A2K9KZV5	Tupanvirus	22.3	7.1e-19
>prophage 17
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	204006	205155	5096586		Halovirus(100.0%)	1	NA	NA
WP_003018918.1|204006_205155_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.4	2.2e-49
>prophage 18
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	209601	212418	5096586	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_016149528.1|209601_212418_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L9X8	Tupanvirus	25.5	3.0e-76
>prophage 19
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	218890	223405	5096586		uncultured_Caudovirales_phage(33.33%)	3	NA	NA
WP_003018952.1|218890_220057_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	51.5	2.6e-90
WP_003837322.1|220263_221397_-	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	34.6	2.5e-29
WP_003018959.1|221482_223405_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	50.3	1.4e-146
>prophage 20
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	227819	228773	5096586		Synechococcus_phage(100.0%)	1	NA	NA
WP_003018974.1|227819_228773_-	transaldolase	NA	A0A0E3G6C9	Synechococcus_phage	34.4	1.3e-10
>prophage 21
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	239969	241394	5096586		Ectocarpus_siliculosus_virus(100.0%)	1	NA	NA
WP_046670903.1|239969_241394_-	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	21.8	1.8e-08
>prophage 22
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	245352	250618	5096586		Bacillus_phage(33.33%)	3	NA	NA
WP_003019016.1|245352_247290_-	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	36.2	1.6e-12
WP_003845630.1|247621_249289_+	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	2.4e-41
WP_003019021.1|249388_250618_-	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	44.0	4.5e-85
>prophage 23
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	257128	258451	5096586		Geobacillus_virus(100.0%)	1	NA	NA
WP_003845626.1|257128_258451_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.3	3.4e-78
>prophage 24
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	263994	266799	5096586		Salmonella_phage(50.0%)	3	NA	NA
WP_003019081.1|263994_264156_-	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	66.0	2.8e-11
WP_003019084.1|264283_264901_-	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_003019086.1|265209_266799_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	24.8	2.7e-29
>prophage 25
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	278040	279320	5096586		Salmonella_phage(50.0%)	2	NA	NA
WP_003019130.1|278040_278580_+	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	61.7	4.9e-28
WP_003019133.1|278582_279320_+	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	51.2	2.9e-63
>prophage 26
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	282448	284930	5096586		Micromonas_pusilla_virus(50.0%)	2	NA	NA
WP_046670880.1|282448_283894_-	tagaturonate reductase	NA	G8DCZ3	Micromonas_pusilla_virus	25.6	8.6e-19
WP_003837229.1|283907_284930_-	zinc-binding alcohol dehydrogenase family protein	NA	A0A2K9L7I1	Tupanvirus	26.0	3.9e-10
>prophage 27
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	288257	289925	5096586		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_069219328.1|288257_289925_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	72.3	6.0e-08
>prophage 28
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	309931	314352	5096586		Enterobacteria_phage(50.0%)	4	NA	NA
WP_046670863.1|309931_310909_-	porin	NA	Q1MVN1	Enterobacteria_phage	49.9	1.8e-81
WP_008322159.1|311029_311233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003033268.1|311881_312655_-	Uxu operon transcriptional regulator	NA	NA	NA	NA	NA
WP_003837172.1|312876_314352_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	31.6	5.8e-47
>prophage 29
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	334399	335519	5096586	transposase	Leptospira_phage(100.0%)	1	NA	NA
WP_103278593.1|334399_335519_+|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
>prophage 30
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	340028	346977	5096586	transposase	Escherichia_phage(50.0%)	11	NA	NA
WP_069219335.1|340028_341051_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	92.1	8.9e-188
WP_155761561.1|341047_341830_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	96.5	1.8e-135
WP_069219337.1|341933_342251_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_069219338.1|342269_342491_-	DUF987 domain-containing protein	NA	NA	NA	NA	NA
WP_069219339.1|342499_342976_-	RadC family protein	NA	NA	NA	NA	NA
WP_069219340.1|342991_343450_-	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	36.2	3.7e-16
WP_069219341.1|343546_343786_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_069219342.1|343863_344337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155761562.1|344358_345054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069219344.1|345236_345938_-	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_069219345.1|346155_346977_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.4	6.1e-46
>prophage 31
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	352098	374498	5096586	tRNA	Leptospira_phage(10.0%)	15	NA	NA
WP_069219351.1|352098_355512_+	DUF4145 domain-containing protein	NA	Q6NDX2	Leptospira_phage	26.1	1.5e-16
WP_069219352.1|355572_357207_+	SAM-dependent DNA methyltransferase	NA	J7I0U9	Acinetobacter_phage	31.5	2.0e-32
WP_069219353.1|357203_358316_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048269781.1|358664_359645_+	thymidylate synthase	NA	A0A218MLB7	uncultured_virus	34.2	1.6e-21
WP_069219354.1|359641_360586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069219355.1|360588_361671_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A075BTZ7	Microcystis_phage	38.6	5.5e-10
WP_069219740.1|362137_362401_+	hypothetical protein	NA	A0A1L2CUJ8	Pectobacterium_phage	69.9	4.5e-27
WP_069219357.1|362574_363840_-	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	40.7	1.4e-81
WP_003839634.1|364331_365351_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	32.0	1.9e-44
WP_046670840.1|365498_367001_+	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.3	8.8e-83
WP_003025875.1|367102_368185_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_003839630.1|368184_369285_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_003025870.1|369551_371063_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.4	7.1e-48
WP_087051781.1|371160_371643_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_046670839.1|371642_374498_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	7.9e-141
>prophage 32
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	386641	387577	5096586		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_046670831.1|386641_387577_+	aspartate carbamoyltransferase	NA	A7RB08	Paramecium_bursaria_Chlorella_virus	40.2	1.9e-51
>prophage 33
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	391975	396021	5096586		Paramecium_bursaria_Chlorella_virus(50.0%)	2	NA	NA
WP_044699140.1|391975_394684_-	magnesium-translocating P-type ATPase	NA	M1HM40	Paramecium_bursaria_Chlorella_virus	27.5	5.9e-45
WP_069219360.1|395073_396021_+	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	3.5e-13
>prophage 34
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	399706	402936	5096586		uncultured_Caudovirales_phage(50.0%)	4	NA	NA
WP_003025782.1|399706_401845_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.4	2.0e-266
WP_032937736.1|401951_402416_+	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	57.7	1.1e-52
WP_016149473.1|402419_402704_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	71.3	1.3e-32
WP_003839576.1|402693_402936_-	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	52.5	4.3e-16
>prophage 35
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	414848	415847	5096586		Klosneuvirus(100.0%)	1	NA	NA
WP_003025742.1|414848_415847_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.1	1.1e-68
>prophage 36
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	419201	422600	5096586		Organic_Lake_phycodnavirus(50.0%)	3	NA	NA
WP_016149467.1|419201_420704_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.4	3.6e-12
WP_003025728.1|420806_421763_-	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_003025726.1|422072_422600_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	9.3e-56
>prophage 37
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	438473	440027	5096586		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_003844953.1|438473_440027_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	31.0	3.3e-08
>prophage 38
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	459416	538568	5096586	integrase,protease,transposase,tRNA	Escherichia_phage(33.33%)	67	507201:507250	524478:524527
WP_046670813.1|459416_461879_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.5	9.4e-66
WP_003025609.1|462035_462461_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_069219364.1|462677_463976_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.6	3.8e-66
WP_003025602.1|464078_464276_-	DUF2065 family protein	NA	NA	NA	NA	NA
WP_003025595.1|464358_465363_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_003025593.1|465365_466619_-|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_003025589.1|466808_468089_-	GTPase HflX	NA	NA	NA	NA	NA
WP_003025584.1|468163_468472_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_016149447.1|468556_469507_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_046670812.1|469499_471365_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	42.1	2.6e-60
WP_032937771.1|471374_472706_-	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	30.1	1.1e-17
WP_003025570.1|472722_473184_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_032947889.1|473155_474703_-	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_044699183.1|474701_475841_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_003839477.1|476714_477260_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	41.0	2.2e-28
WP_008323067.1|477341_478418_+	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_003844975.1|478510_479479_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_069219365.1|479496_482811_+	miniconductance mechanosensitive channel MscM	NA	NA	NA	NA	NA
WP_069219366.1|482876_484379_-	glutamate/gamma-aminobutyrate family transporter YjeM	NA	NA	NA	NA	NA
WP_003830517.1|484593_485571_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	29.1	8.1e-29
WP_003025543.1|485895_487686_+	fumarate reductase (quinol) flavoprotein subunit	NA	NA	NA	NA	NA
WP_003025540.1|487678_488413_+	succinate dehydrogenase/fumarate reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_003025537.1|488423_488819_+	fumarate reductase subunit FrdC	NA	NA	NA	NA	NA
WP_003025535.1|488829_489186_+	fumarate reductase subunit FrdD	NA	NA	NA	NA	NA
WP_003025533.1|489228_490104_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_046670810.1|490235_491381_+	CMY-2 family class C beta-lactamase	NA	NA	NA	NA	NA
WP_003025522.1|491473_492007_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	54.8	1.6e-47
WP_000118520.1|492003_492321_-	quaternary ammonium compound-resistance protein SugE	NA	NA	NA	NA	NA
WP_003025485.1|492577_493177_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003025482.1|493207_493354_-	lipoprotein toxin entericidin B	NA	NA	NA	NA	NA
WP_069219367.1|493461_493596_-	lipoprotein antitoxin entericidin A	NA	NA	NA	NA	NA
WP_003025478.1|493653_494220_-	elongation factor P	NA	NA	NA	NA	NA
WP_003839459.1|494261_495290_+	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_003844989.1|495474_496338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003025468.1|496517_496871_-	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_003025464.1|497005_498652_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.1	2.9e-188
WP_000027827.1|498695_498989_-	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	43.3	1.2e-12
WP_046670805.1|499264_500530_+	L-methionine/branched-chain amino acid transporter	NA	NA	NA	NA	NA
WP_003025457.1|500579_501056_-	membrane protein FxsA	NA	NA	NA	NA	NA
WP_003025452.1|501394_502831_+	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_003025449.1|502946_504248_+	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
WP_003025447.1|504376_504724_+	divalent cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_046670803.1|504699_506409_+	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_003025441.1|506445_507021_+	transcriptional regulator	NA	NA	NA	NA	NA
507201:507250	attL	GGGATTGAAAATCCCCGTGTCCTTGGTTCGATTCCGAGTCCGGGCACCAA	NA	NA	NA	NA
WP_031250069.1|507964_508552_+	hypothetical protein	NA	O21975	Escherichia_phage	57.0	1.0e-58
WP_069219368.1|508898_510086_+|integrase	site-specific integrase	integrase	A0A221SAN4	Ralstonia_phage	32.0	2.8e-31
WP_069219369.1|510128_512054_-	DUF927 domain-containing protein	NA	NA	NA	NA	NA
WP_069219370.1|512126_513398_-|integrase	site-specific integrase	integrase	Q9T1P3	Pseudomonas_phage	31.4	6.4e-18
WP_069219371.1|513841_514195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017382949.1|514187_514619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069219372.1|514666_515095_+	DUF2787 domain-containing protein	NA	NA	NA	NA	NA
WP_069219373.1|515153_515618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071977973.1|515596_515836_+	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_049012550.1|515913_516297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032610118.1|516439_517189_+	DUF3944 domain-containing protein	NA	NA	NA	NA	NA
WP_069219374.1|517291_518005_+	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_081328878.1|518063_518378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069219376.1|519677_522923_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	54.8	8.5e-99
WP_001218761.1|524721_525975_+	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	38.8	8.4e-79
524478:524527	attR	GGGATTGAAAATCCCCGTGTCCTTGGTTCGATTCCGAGTCCGGGCACCAA	NA	NA	NA	NA
WP_069219379.1|527749_528901_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.0	6.4e-41
WP_016243822.1|529291_529609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069219380.1|529708_531391_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	36.7	5.0e-10
WP_001067855.1|531752_532457_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_069219381.1|535332_536313_-|transposase	IS5 family transposase	transposase	A0A077SK28	Escherichia_phage	97.5	1.2e-181
WP_000780222.1|536438_536720_-	helix-turn-helix transcriptional regulator	NA	A0A2I6TC97	Escherichia_phage	38.0	1.3e-08
WP_000493286.1|536700_537030_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2I6TCA4	Escherichia_phage	43.1	3.1e-17
WP_069219382.1|537863_538568_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
>prophage 39
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	566237	569055	5096586		Bacillus_phage(50.0%)	3	NA	NA
WP_003841135.1|566237_567320_+	two-component system sensor histidine kinase PmrB	NA	W8CYF6	Bacillus_phage	27.2	4.5e-12
WP_008321468.1|567313_567403_-	LpxT activity modulator PmrR	NA	NA	NA	NA	NA
WP_003841133.1|567552_569055_-	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	31.5	2.4e-56
>prophage 40
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	575627	576416	5096586		Pithovirus(100.0%)	1	NA	NA
WP_003841124.1|575627_576416_+	phosphonate ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	29.0	1.5e-12
>prophage 41
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	582153	591740	5096586		Escherichia_phage(40.0%)	11	NA	NA
WP_003844769.1|582153_582912_+	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	28.2	1.8e-15
WP_046671387.1|583001_583682_+	phosphonate C-P lyase system protein PhnL	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.7	1.1e-08
WP_003031811.1|583678_584815_+	alpha-D-ribose 1-methylphosphonate 5-triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_003844764.1|584817_585372_+	ribose 1,5-bisphosphokinase	NA	NA	NA	NA	NA
WP_003031809.1|585358_585793_+	aminoalkylphosphonate N-acetyltransferase	NA	NA	NA	NA	NA
WP_046671376.1|585801_586560_+	phosphonate metabolism protein PhnP	NA	NA	NA	NA	NA
WP_046671375.1|586612_586954_-	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	83.6	1.4e-44
WP_046671374.1|586980_587283_-	hypothetical protein	NA	A0A222YWE2	Escherichia_phage	76.0	4.1e-40
WP_003031807.1|587438_587768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044702173.1|587837_590102_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_003844755.1|590216_591740_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.9	1.4e-11
>prophage 42
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	597549	599535	5096586		Tetraselmis_virus(100.0%)	1	NA	NA
WP_044714894.1|597549_599535_+	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	44.3	7.9e-148
>prophage 43
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	616553	618512	5096586		Staphylococcus_phage(100.0%)	1	NA	NA
WP_003826645.1|616553_618512_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	41.5	4.6e-92
>prophage 44
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	624731	626081	5096586		Moraxella_phage(100.0%)	1	NA	NA
WP_003031735.1|624731_626081_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	71.4	8.8e-159
>prophage 45
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	632972	685683	5096586	protease,integrase,tail,holin,tRNA,portal,terminase	Enterobacteria_phage(29.17%)	59	625619:625635	667867:667883
625619:625635	attL	GCAGCAGGAACAGGCCG	NA	NA	NA	NA
WP_046671365.1|632972_633497_-	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	94.5	4.3e-53
WP_046671364.1|633748_636571_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.6	0.0e+00
WP_003031719.1|636686_637043_-	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_003826615.1|637170_637884_-	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_016149405.1|638132_639326_-	aromatic amino acid transaminase	NA	NA	NA	NA	NA
WP_003844721.1|639454_640534_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	28.5	6.2e-30
WP_003826610.1|640550_641966_-	replicative DNA helicase	NA	O80281	Escherichia_phage	77.9	1.8e-199
WP_003841359.1|642030_643014_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_003031713.1|643315_643558_-	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_103798251.1|643691_644729_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_069219387.1|644816_645911_+|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	84.8	6.2e-179
WP_020838546.1|645943_646333_-	DNA repair protein	NA	Q1MVE7	Enterobacteria_phage	73.6	9.3e-53
WP_069219388.1|646411_646654_+	DinI family protein	NA	Q6UAW0	Klebsiella_phage	75.3	2.2e-28
WP_069219389.1|646788_648156_-	hypothetical protein	NA	A0A1V0E5M2	Salmonella_phage	50.2	1.4e-106
WP_069219390.1|648217_651787_-	host specificity protein J	NA	K7P7G9	Enterobacteria_phage	88.9	0.0e+00
WP_069219391.1|651841_652432_-|tail	tail assembly protein	tail	K7PH91	Enterobacterial_phage	74.5	1.1e-73
WP_003826218.1|652466_652889_-	hypothetical protein	NA	J9Q806	Salmonella_phage	40.7	5.4e-22
WP_069219392.1|652920_653631_-	peptidase P60	NA	K7PGR2	Enterobacteria_phage	91.5	1.1e-136
WP_069219393.1|653632_654388_-|tail	phage minor tail protein L	tail	K7PGX3	Enterobacteria_phage	86.1	6.3e-130
WP_008322439.1|654384_654732_-	hypothetical protein	NA	K7PJT2	Enterobacteria_phage	69.6	2.3e-39
WP_069219394.1|654735_657252_-|tail	phage tail tape measure protein	tail	K7PKR0	Enterobacteria_phage	69.6	0.0e+00
WP_071596416.1|657229_657550_-|tail	phage tail assembly protein T	tail	K7PHE1	Enterobacteria_phage	70.8	9.4e-35
WP_008784480.1|657558_657966_-|tail	phage minor tail protein G	tail	K7PM17	Enterobacteria_phage	58.6	1.7e-25
WP_048220762.1|658002_658740_-|tail	tail fiber protein	tail	O64327	Escherichia_phage	62.9	9.6e-83
WP_008784478.1|658747_659146_-|tail	tail protein	tail	K7PHM6	Enterobacterial_phage	62.8	4.0e-43
WP_069219395.1|659142_659697_-|tail	phage tail protein	tail	K7P7A8	Enterobacteria_phage	77.3	1.1e-62
WP_048240894.1|659709_659985_-	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	61.5	6.8e-26
WP_008784475.1|659977_660304_-	DUF2190 family protein	NA	K7PJY3	Enterobacterial_phage	60.2	1.1e-30
WP_071977977.1|660395_662420_-|protease	Clp protease ClpP	protease	K7PKX4	Enterobacterial_phage	85.3	0.0e+00
WP_044700357.1|662364_663873_-|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	86.3	6.0e-257
WP_001082414.1|663869_664085_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	82.9	1.5e-25
WP_069219396.1|664081_666184_-|terminase	phage terminase large subunit family protein	terminase	K7PH52	Enterobacterial_phage	86.1	0.0e+00
WP_044700360.1|666183_666672_-	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	94.4	8.9e-77
WP_069219398.1|667415_667613_-	hypothetical protein	NA	K7PHC3	Enterobacterial_phage	93.8	1.5e-27
WP_155761563.1|667784_668186_-	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	47.2	6.3e-20
667867:667883	attR	GCAGCAGGAACAGGCCG	NA	NA	NA	NA
WP_069219399.1|668182_668665_-	TIGR02594 family protein	NA	A0A222YWL8	Escherichia_phage	73.1	4.8e-67
WP_069219400.1|668654_668993_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	56.9	9.6e-30
WP_069219401.1|669290_670160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003826156.1|670422_670845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069219402.1|670867_671233_-	antitermination protein Q	NA	K7PGW2	Enterobacterial_phage	89.2	4.5e-57
WP_069219403.1|671250_672306_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	1.7e-117
WP_069219404.1|672316_672838_-	hypothetical protein	NA	Q8W639	Enterobacteria_phage	39.7	3.3e-05
WP_081328880.1|673652_674129_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	37.5	2.1e-14
WP_069219406.1|674110_674509_-	RusA family crossover junction endodeoxyribonuclease	NA	Q8HA93	Salmonella_phage	89.3	6.1e-60
WP_069219407.1|674505_675825_-	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	52.7	1.9e-118
WP_003034734.1|675821_676688_-	GntR family transcriptional regulator	NA	U5P0A0	Shigella_phage	87.8	1.9e-34
WP_003034732.1|676677_676857_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	73.1	3.0e-14
WP_047722332.1|677029_677581_-	hypothetical protein	NA	Q8SBF4	Shigella_phage	53.5	5.4e-46
WP_044702968.1|677609_677852_-	chaperone TorD	NA	NA	NA	NA	NA
WP_048220746.1|677988_678675_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C1P9	Escherichia_phage	42.0	2.3e-38
WP_069219408.1|678666_679548_-	NAD-dependent DNA ligase	NA	U3PB51	Vibrio_phage	30.5	1.2e-34
WP_069219409.1|680831_681749_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	64.0	1.3e-105
WP_069219410.1|682137_682677_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	80.4	2.1e-79
WP_069219411.1|682837_683092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069219413.1|683515_683701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069219414.1|683704_684337_+	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	72.0	3.1e-29
WP_069219744.1|684338_684911_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	81.6	3.9e-92
WP_044253340.1|684949_685222_+	pyocin activator protein PrtN	NA	S5MQM5	Escherichia_phage	87.8	1.5e-38
WP_044253343.1|685248_685683_-	hypothetical protein	NA	A0A0S2SYH1	Pseudomonas_phage	52.4	3.2e-38
>prophage 46
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	689522	690131	5096586		Lactococcus_phage(100.0%)	1	NA	NA
WP_003031703.1|689522_690131_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
>prophage 47
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	697314	698424	5096586		Mycoplasma_phage(100.0%)	1	NA	NA
WP_003031682.1|697314_698424_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
>prophage 48
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	714262	715048	5096586		Pseudomonas_phage(100.0%)	1	NA	NA
WP_003844703.1|714262_715048_-	nucleotidyltransferase domain-containing protein	NA	A0A2D1GQQ2	Pseudomonas_phage	45.9	7.4e-49
>prophage 49
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	727811	728667	5096586		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_136397905.1|727811_727985_+	hypothetical protein	NA	A0A2H4JB52	uncultured_Caudovirales_phage	48.2	4.4e-07
WP_046671412.1|728388_728667_+	putative addiction module antidote protein	NA	A0A141GEX5	Brucella_phage	51.2	1.9e-12
>prophage 50
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	732079	735763	5096586		Dickeya_phage(100.0%)	1	NA	NA
WP_003031615.1|732079_735763_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	3.7e-26
>prophage 51
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	749003	750593	5096586		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_046671416.1|749003_750593_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.4	1.2e-66
>prophage 52
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	756047	757811	5096586		Bacillus_phage(50.0%)	3	NA	NA
WP_001044509.1|756047_756320_-	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	57.8	5.5e-20
WP_003842015.1|756506_757097_-	YjaG family protein	NA	NA	NA	NA	NA
WP_003033072.1|757130_757811_-	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	30.1	3.3e-21
>prophage 53
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	763074	783611	5096586		Indivirus(14.29%)	17	NA	NA
WP_046671421.1|763074_763833_+	HesA/MoeB/ThiF family protein	NA	A0A1V0SCZ9	Indivirus	32.1	2.0e-11
WP_003033088.1|763813_764014_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_003842025.1|764015_764786_+	thiazole synthase	NA	NA	NA	NA	NA
WP_046671422.1|764782_765904_+	2-iminoacetate synthase ThiH	NA	NA	NA	NA	NA
WP_003033098.1|766035_766248_-	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	78.6	2.2e-24
WP_003033102.1|767341_767647_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_003033104.1|767651_767969_+	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_069219418.1|768080_772304_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	27.4	1.0e-67
WP_003033111.1|772380_776409_-	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.4	1.6e-22
WP_003033114.1|776729_777095_-	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_001207203.1|777161_777659_-	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_003033119.1|778073_778781_-	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_003033122.1|778784_779213_-	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_003033125.1|779367_779913_-	transcription termination/antitermination protein NusG	NA	A0A291AUS6	Sinorhizobium_phage	29.6	1.1e-14
WP_003033128.1|779914_780298_-	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_003031109.1|780528_781713_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	7.5e-13
WP_003031107.1|782660_783611_+	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	8.7e-28
>prophage 54
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	792390	794247	5096586		Acinetobacter_phage(100.0%)	1	NA	NA
WP_003028868.1|792390_794247_-	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	29.3	1.0e-08
>prophage 55
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	810254	810917	5096586		Synechococcus_phage(100.0%)	1	NA	NA
WP_016151282.1|810254_810917_+	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	33.2	1.1e-29
>prophage 56
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	832082	833414	5096586		Erwinia_phage(100.0%)	1	NA	NA
WP_003028803.1|832082_833414_+	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.2	2.6e-46
>prophage 57
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	836769	837615	5096586		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_003028793.1|836769_837615_+	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	29.5	1.8e-16
>prophage 58
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	851092	853161	5096586		Feldmannia_irregularis_virus(50.0%)	2	NA	NA
WP_003028763.1|851092_851791_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	29.5	1.5e-05
WP_003840485.1|851787_853161_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	1.1e-15
>prophage 59
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	856204	856825	5096586		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
WP_003840480.1|856204_856825_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	57.4	1.0e-61
>prophage 60
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	874502	877553	5096586		Escherichia_phage(100.0%)	1	NA	NA
WP_152659866.1|874502_877553_+	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.9	2.2e-08
>prophage 61
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	880884	881793	5096586		Acanthamoeba_polyphaga_moumouvirus(100.0%)	1	NA	NA
WP_046671350.1|880884_881793_+	alpha/beta hydrolase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	30.8	4.6e-26
>prophage 62
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	884934	887731	5096586		Escherichia_phage(50.0%)	3	NA	NA
WP_003847907.1|884934_885738_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	29.6	4.9e-24
WP_003847909.1|885771_886668_-	sugar kinase	NA	NA	NA	NA	NA
WP_046671353.1|886834_887731_+	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	93.8	4.6e-63
>prophage 63
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	900439	902909	5096586		Ectocarpus_siliculosus_virus(50.0%)	2	NA	NA
WP_003028636.1|900439_901489_+	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.6	2.6e-09
WP_003028633.1|901499_902909_+	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.7	9.0e-05
>prophage 64
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	906822	909609	5096586		Enterococcus_phage(100.0%)	1	NA	NA
WP_003028623.1|906822_909609_-	DNA polymerase I	NA	A8E2B3	Enterococcus_phage	30.3	4.9e-47
>prophage 65
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	921790	922405	5096586		Streptococcus_phage(100.0%)	1	NA	NA
WP_046671388.1|921790_922405_-	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	45.7	1.4e-18
>prophage 66
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	933354	936674	5096586		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_046671394.1|933354_934146_-	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	32.0	3.0e-26
WP_003017886.1|934148_934697_-	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_003017888.1|934700_934955_-	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_003017891.1|935033_936674_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.5	1.3e-42
>prophage 67
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	948637	952074	5096586	transposase	Sodalis_phage(50.0%)	3	NA	NA
WP_032950636.1|948637_949522_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	52.0	5.7e-66
WP_046671397.1|949560_950181_-	threonine export protein RhtC	NA	NA	NA	NA	NA
WP_003844630.1|950244_952074_-	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	38.5	2.5e-84
>prophage 68
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	955992	959838	5096586		Bacillus_phage(100.0%)	3	NA	NA
WP_069219425.1|955992_958155_-	DNA helicase II	NA	A7KV33	Bacillus_phage	37.6	1.7e-116
WP_003017925.1|958219_958936_-	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_003841210.1|958935_959838_-	tyrosine recombinase XerC	NA	A0A142F1N9	Bacillus_phage	29.5	1.9e-24
>prophage 69
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	976257	980456	5096586		uncultured_marine_virus(33.33%)	4	NA	NA
WP_032938462.1|976257_977388_-	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	41.7	1.1e-18
WP_046671402.1|977392_978070_-	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_032950623.1|978066_979329_-	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	27.2	2.7e-24
WP_032950621.1|979325_980456_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	26.5	7.4e-26
>prophage 70
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	984509	989938	5096586		Indivirus(33.33%)	4	NA	NA
WP_001280776.1|984509_984839_-	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	38.5	4.2e-14
WP_003017994.1|984982_986251_+	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.2	8.3e-42
WP_069219426.1|986387_987869_+	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
WP_003829018.1|987916_989938_-	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.8	2.2e-113
>prophage 71
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	999059	1000706	5096586		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_003841174.1|999059_1000706_-	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.8	5.3e-65
>prophage 72
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	1016056	1020050	5096586		Tupanvirus(50.0%)	3	NA	NA
WP_003023764.1|1016056_1017562_-	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2K9L0W2	Tupanvirus	21.9	1.7e-17
WP_003023766.1|1017569_1017989_-	D-ribose pyranase	NA	NA	NA	NA	NA
WP_046671079.1|1018181_1020050_-	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.5	4.2e-66
>prophage 73
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	1023324	1024317	5096586		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_016151221.1|1023324_1024317_-	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.7	2.9e-50
>prophage 74
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	1036599	1047208	5096586		Chrysochromulina_ericina_virus(20.0%)	9	NA	NA
WP_003023811.1|1036599_1037970_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	37.6	2.1e-35
WP_046671076.1|1038194_1040024_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	42.4	4.4e-129
WP_003023814.1|1040358_1041399_+	phosphate ABC transporter substrate-binding protein PstS	NA	M4QHS4	Cyanophage	35.8	2.0e-46
WP_003023817.1|1041543_1042503_+	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_003023819.1|1042502_1043393_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_003023821.1|1043439_1044213_+	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	30.6	3.4e-14
WP_003023824.1|1044227_1044953_+	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_032950596.1|1045037_1045703_-	6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
WP_046671073.1|1045870_1047208_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	37.8	1.6e-64
>prophage 75
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	1054183	1061692	5096586		Staphylococcus_phage(33.33%)	7	NA	NA
WP_003023846.1|1054183_1054441_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
WP_003844432.1|1054404_1054764_-	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_003023858.1|1054781_1054922_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_003023861.1|1055528_1056932_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_069219430.1|1056936_1058037_+	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	34.7	3.1e-53
WP_003844434.1|1058175_1059249_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_003023868.1|1059277_1061692_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.1	1.8e-114
>prophage 76
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	1065798	1066733	5096586		Synechococcus_phage(100.0%)	2	NA	NA
WP_003023882.1|1065798_1066212_+	heat shock chaperone IbpA	NA	A0A1D8KSJ6	Synechococcus_phage	35.2	4.6e-18
WP_003840609.1|1066304_1066733_+	heat shock chaperone IbpB	NA	A0A1D8KPX5	Synechococcus_phage	36.4	2.7e-13
>prophage 77
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	1074854	1079695	5096586		Salmonella_phage(50.0%)	5	NA	NA
WP_044714253.1|1074854_1076039_-	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	25.1	3.0e-17
WP_003840641.1|1076232_1077066_-	EamA family transporter	NA	NA	NA	NA	NA
WP_003840643.1|1077189_1077279_-	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
WP_003827118.1|1077800_1077899_+	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_046671059.1|1078006_1079695_+	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	30.4	2.9e-58
>prophage 78
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	1102129	1103044	5096586	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_046671049.1|1102129_1103044_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	47.2	8.3e-68
>prophage 79
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	1111736	1114562	5096586		Escherichia_phage(100.0%)	1	NA	NA
WP_069219431.1|1111736_1114562_+	intestinal colonization autotransporter adhesin MisL	NA	A0A2L1IV18	Escherichia_phage	47.9	3.0e-100
>prophage 80
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	1128389	1129781	5096586		environmental_Halophage(100.0%)	1	NA	NA
WP_003024026.1|1128389_1129781_-	xanthine/proton symporter XanP	NA	H9YQ34	environmental_Halophage	95.9	2.5e-68
>prophage 81
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	1134041	1139069	5096586		Bordetella_phage(33.33%)	4	NA	NA
WP_003024038.1|1134041_1136156_-	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
WP_000135058.1|1136174_1136450_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_003024042.1|1136504_1137128_-	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	35.6	2.2e-19
WP_046671084.1|1137389_1139069_+	NAD-dependent DNA ligase LigB	NA	F8SJM3	Pseudomonas_phage	22.5	5.5e-25
>prophage 82
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	1143150	1147713	5096586		Xanthomonas_phage(25.0%)	7	NA	NA
WP_003024065.1|1143150_1143606_-	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	60.1	1.6e-48
WP_100280309.1|1143586_1144807_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.8	9.4e-43
WP_003837605.1|1144978_1145644_+	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_003024071.1|1145862_1146099_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_003024094.1|1146119_1146287_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_003844529.1|1146385_1147195_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	31.6	3.1e-26
WP_003024099.1|1147233_1147713_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	43.2	6.3e-27
>prophage 83
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	1159718	1169090	5096586		Prochlorococcus_phage(20.0%)	9	NA	NA
WP_003827312.1|1159718_1160651_-	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	37.1	1.0e-36
WP_003837635.1|1160866_1162063_+	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.1	4.1e-35
WP_003024132.1|1162072_1163098_+	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	80.8	2.3e-18
WP_003844540.1|1163290_1164328_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_046671019.1|1164328_1165264_-	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_003837638.1|1165267_1166551_-	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	34.3	1.8e-07
WP_046671018.1|1166560_1168105_-	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_003024148.1|1168354_1168786_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_003844542.1|1168838_1169090_+	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	53.4	2.2e-15
>prophage 84
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	1186488	1188333	5096586		Tupanvirus(100.0%)	1	NA	NA
WP_032937191.1|1186488_1188333_+	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	25.5	5.3e-13
>prophage 85
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	1191345	1192434	5096586		Streptococcus_phage(100.0%)	1	NA	NA
WP_003844556.1|1191345_1192434_-	hypothetical protein	NA	A0A1S5SAB0	Streptococcus_phage	43.0	9.8e-68
>prophage 86
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	1219749	1220745	5096586		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_046671082.1|1219749_1220745_-	acyltransferase	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	24.8	3.5e-11
>prophage 87
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	1225103	1228010	5096586		Morganella_phage(50.0%)	4	NA	NA
WP_000014594.1|1225103_1225316_-	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
WP_003024273.1|1225595_1225886_-	HTH-type transcriptional regulator	NA	NA	NA	NA	NA
WP_003837709.1|1226266_1226977_+	DUF3053 domain-containing protein	NA	NA	NA	NA	NA
WP_046671001.1|1227035_1228010_-	glyoxylate/hydroxypyruvate reductase GhrB	NA	M1HST2	Paramecium_bursaria_Chlorella_virus	27.0	2.9e-18
>prophage 88
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	1233420	1235754	5096586		Escherichia_phage(100.0%)	1	NA	NA
WP_046670995.1|1233420_1235754_+	molybdopterin guanine dinucleotide-containing S/N-oxide reductase	NA	A0A077SK27	Escherichia_phage	30.6	2.0e-73
>prophage 89
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	1246056	1248041	5096586		Planktothrix_phage(50.0%)	2	NA	NA
WP_003846117.1|1246056_1247040_+	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.2	1.5e-14
WP_003846120.1|1247036_1248041_+	dipeptide ABC transporter ATP binding subunit DppF	NA	G3M9Y6	Bacillus_virus	29.9	1.1e-17
>prophage 90
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	1279044	1281087	5096586		Indivirus(100.0%)	1	NA	NA
WP_069219437.1|1279044_1281087_+	oligopeptidase A	NA	A0A1V0SD92	Indivirus	23.3	2.3e-46
>prophage 91
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	1298837	1302254	5096586		Bacillus_phage(100.0%)	1	NA	NA
WP_069219445.1|1298837_1302254_-	AAA family ATPase	NA	A7KV33	Bacillus_phage	27.3	1.2e-47
>prophage 92
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	1310221	1314446	5096586		Anomala_cuprea_entomopoxvirus(50.0%)	3	NA	NA
WP_032937231.1|1310221_1312969_+	ribosome-associated ATPase/putative transporter RbbA	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	32.6	8.7e-20
WP_046671262.1|1312968_1314093_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_046671263.1|1314170_1314446_+	type II toxin-antitoxin system HicA family toxin	NA	R4JMD3	Burkholderia_phage	47.6	3.2e-15
>prophage 93
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	1319040	1323113	5096586		Dickeya_phage(50.0%)	4	NA	NA
WP_003837818.1|1319040_1319706_-	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	54.9	3.3e-58
WP_003023404.1|1319874_1320120_+	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	4.7e-10
WP_046671265.1|1320213_1322412_-	Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA	NA	E4ZFI9	Streptococcus_phage	37.6	1.0e-116
WP_016151123.1|1322486_1323113_-	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	60.2	2.3e-29
>prophage 94
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	1328326	1331156	5096586		Staphylococcus_phage(50.0%)	3	NA	NA
WP_003023420.1|1328326_1328995_+	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	27.6	1.5e-13
WP_003837835.1|1328987_1330046_+	cell division protein FtsX	NA	NA	NA	NA	NA
WP_003023425.1|1330301_1331156_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.9	7.0e-45
>prophage 95
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	1336899	1338398	5096586		Anomala_cuprea_entomopoxvirus(50.0%)	2	NA	NA
WP_003023438.1|1336899_1337667_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.1	3.7e-13
WP_003827581.1|1337684_1338398_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	G9BWD6	Planktothrix_phage	30.1	3.7e-15
>prophage 96
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	1342176	1343987	5096586		Planktothrix_phage(50.0%)	2	NA	NA
WP_069219450.1|1342176_1343247_+	sn-glycerol-3-phosphate import ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	32.0	3.4e-20
WP_046671268.1|1343243_1343987_+	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	25.7	1.7e-10
>prophage 97
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	1368290	1370738	5096586		Dickeya_phage(100.0%)	1	NA	NA
WP_003023492.1|1368290_1370738_+	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	82.1	3.6e-33
>prophage 98
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	1378083	1380477	5096586		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_046671277.1|1378083_1380477_+	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	41.4	7.3e-15
>prophage 99
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	1386473	1387436	5096586	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_046671280.1|1386473_1387436_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	56.8	7.6e-72
>prophage 100
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	1393942	1398485	5096586		Bacillus_phage(66.67%)	5	NA	NA
WP_135953044.1|1393942_1394668_+	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
WP_003837891.1|1394664_1396017_+	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	23.6	4.3e-12
WP_003837894.1|1396073_1396370_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003847996.1|1396422_1396740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003023529.1|1396862_1398485_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.5	8.1e-143
>prophage 101
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	1415447	1416284	5096586		Vibrio_phage(100.0%)	1	NA	NA
WP_003023558.1|1415447_1416284_+	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	49.1	8.4e-67
>prophage 102
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	1435289	1439335	5096586		Acinetobacter_phage(33.33%)	3	NA	NA
WP_046671296.1|1435289_1435853_+	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	57.1	2.7e-61
WP_046671297.1|1435938_1437156_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	28.2	5.7e-32
WP_069219455.1|1437247_1439335_-	hypothetical protein	NA	H9YQA8	environmental_Halophage	89.1	5.5e-67
>prophage 103
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	1443070	1448358	5096586		Bacillus_virus(25.0%)	4	NA	NA
WP_046671298.1|1443070_1443790_-	NUDIX hydrolase	NA	G3MA14	Bacillus_virus	27.9	4.3e-19
WP_032937275.1|1443981_1444842_+	ribose-phosphate pyrophosphokinase	NA	G0X553	Salmonella_phage	40.6	5.6e-50
WP_044713846.1|1444856_1446347_+	nicotinate phosphoribosyltransferase	NA	A0A218KC49	Bacillus_phage	52.4	1.7e-142
WP_046671299.1|1446456_1448358_-	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	33.9	1.5e-74
>prophage 104
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	1454114	1459686	5096586		uncultured_Caudovirales_phage(50.0%)	7	NA	NA
WP_003023646.1|1454114_1454501_+	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	40.6	6.7e-19
WP_003837966.1|1454500_1454860_+	sulfurtransferase complex subunit TusC	NA	NA	NA	NA	NA
WP_003837968.1|1454867_1455155_+	sulfurtransferase complex subunit TusB	NA	A0A2H4JG28	uncultured_Caudovirales_phage	40.2	1.1e-05
WP_003023654.1|1455280_1455655_+	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_003023657.1|1455750_1456221_+	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_003023659.1|1456317_1458432_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.1	6.2e-58
WP_003031109.1|1458501_1459686_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	7.5e-13
>prophage 105
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	1479585	1481057	5096586	tRNA	Prochlorococcus_phage(50.0%)	2	NA	NA
WP_046671425.1|1479585_1480533_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	39.8	2.0e-08
WP_003031159.1|1480547_1481057_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.3	2.6e-18
>prophage 106
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	1491510	1495666	5096586		Bacillus_virus(50.0%)	4	NA	NA
WP_003025300.1|1491510_1492269_-	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.7	3.1e-20
WP_003025299.1|1492276_1493380_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_046670184.1|1493389_1494571_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003025295.1|1494640_1495666_-	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.5	9.0e-71
>prophage 107
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	1502272	1551065	5096586	integrase,tail,protease,tRNA	uncultured_Caudovirales_phage(38.46%)	51	1503180:1503239	1513972:1514056
WP_046670188.1|1502272_1503157_-	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	32.8	2.8e-28
1503180:1503239	attL	TTAATAAAAAAGGCGCTTCCCCATGCCGAGTAGCGCCTTTTAAAACAAACATTTAACTGA	NA	NA	NA	NA
WP_069219456.1|1503446_1504670_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	87.5	5.8e-218
WP_069219457.1|1504666_1505539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069219458.1|1505652_1505862_+	AlpA family phage regulatory protein	NA	A0A2H4JB58	uncultured_Caudovirales_phage	84.1	8.8e-26
WP_071978007.1|1506226_1506418_-	toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_069219459.1|1506551_1506824_+	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	76.7	4.7e-35
WP_069219460.1|1506816_1507041_+	aminotransferase	NA	A0A2H4JBA1	uncultured_Caudovirales_phage	74.1	1.5e-15
WP_069219461.1|1507037_1507406_+	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	89.3	2.9e-56
WP_069219462.1|1507402_1509208_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	46.3	2.1e-123
WP_155761567.1|1509507_1509810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044067013.1|1509959_1510154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069219463.1|1510150_1512064_+|protease	Clp protease ClpP	protease	K7PKX4	Enterobacterial_phage	57.9	1.5e-215
WP_155761568.1|1512275_1512467_+	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	43.1	3.2e-06
WP_069219464.1|1512453_1513062_+|tail	tail assembly protein	tail	K7PM97	Enterobacterial_phage	67.0	1.7e-64
WP_069219746.1|1513070_1513409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071698762.1|1513459_1513795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000462905.1|1514037_1514334_-	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
1513972:1514056	attR	TTAATAAAAAAGGCGCTTCCCCATGCCGAGTAGCGCCTTTTAAAACAAACATTTAACTGATTAGTATCAGTTCATGCCGTATTTT	NA	NA	NA	NA
WP_003025224.1|1514359_1515325_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_046670189.1|1515623_1516400_-	carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_016151073.1|1516527_1517409_-	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_003839880.1|1517420_1518872_-	sodium/pantothenate symporter	NA	NA	NA	NA	NA
WP_003025216.1|1518861_1519104_-	YhdT family protein	NA	NA	NA	NA	NA
WP_003025213.1|1519211_1520561_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_003025210.1|1520571_1521042_-	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_046670192.1|1521434_1522034_-	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_046670193.1|1522034_1523039_-	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_016151069.1|1523158_1524133_-	oxidoreductase	NA	NA	NA	NA	NA
WP_003839888.1|1524358_1526299_+	RNase E specificity factor CsrD	NA	NA	NA	NA	NA
WP_000913396.1|1526605_1527649_+	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
WP_003025198.1|1527715_1528738_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_003025196.1|1528738_1529227_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_003839891.1|1529234_1529828_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_003025190.1|1529817_1531287_+	ribonuclease G	NA	NA	NA	NA	NA
WP_046670195.1|1531398_1535214_+	AsmA2 domain-containing protein	NA	NA	NA	NA	NA
WP_003025183.1|1535375_1536821_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_046670196.1|1536907_1537837_-	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
WP_003025177.1|1538021_1538225_+	AaeX family protein	NA	NA	NA	NA	NA
WP_003025174.1|1538232_1539165_+	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
WP_003025171.1|1539170_1541138_+	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
WP_003025168.1|1541257_1541536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003025165.1|1541593_1541860_-	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_046670198.1|1542235_1542706_-	transcriptional regulator ArgR	NA	NA	NA	NA	NA
WP_003025158.1|1543142_1544078_+	malate dehydrogenase	NA	NA	NA	NA	NA
WP_003025154.1|1544134_1545202_-	outer membrane-stress sensor serine endopeptidase DegS	NA	NA	NA	NA	NA
WP_003025151.1|1545291_1546659_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.3	2.5e-20
WP_003025147.1|1546827_1547226_-	DUF1043 family protein	NA	NA	NA	NA	NA
WP_003839902.1|1547418_1548546_+	cell division protein ZapE	NA	NA	NA	NA	NA
WP_003025141.1|1548764_1549193_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_003025138.1|1549208_1549601_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_003025132.1|1549917_1550556_+	stringent starvation protein A	NA	NA	NA	NA	NA
WP_003025130.1|1550561_1551065_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	7.3e-26
>prophage 108
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	1554905	1556396	5096586		Burkholderia_virus(100.0%)	1	NA	NA
WP_003025119.1|1554905_1556396_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	23.9	2.4e-08
>prophage 109
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	1560558	1561641	5096586		Salmonella_phage(100.0%)	1	NA	NA
WP_046670201.1|1560558_1561641_-	DUF1016 domain-containing protein	NA	A0A0U2BZN7	Salmonella_phage	90.0	2.2e-75
>prophage 110
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	1568416	1582552	5096586		Staphylococcus_phage(25.0%)	16	NA	NA
WP_003839924.1|1568416_1569346_+	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	32.8	6.7e-17
WP_003025089.1|1569550_1571887_+	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	30.8	4.9e-40
WP_003839926.1|1572116_1572770_+	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_003839927.1|1572766_1573486_+	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_003025086.1|1573616_1573889_-	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_003025085.1|1573885_1574740_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.4e-05
WP_003025083.1|1574785_1575277_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_003025078.1|1575360_1575648_-	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	43.2	4.2e-10
WP_003025074.1|1575670_1577104_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_003025073.1|1577150_1577876_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
WP_003025070.1|1577882_1578431_-	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_003025068.1|1578399_1578975_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_003025065.1|1578971_1579538_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	76.3	4.2e-54
WP_003025063.1|1579558_1580545_-	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.5	1.9e-38
WP_003839941.1|1580558_1581536_-	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_003025057.1|1581751_1582552_+	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	30.6	9.6e-20
>prophage 111
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	1586656	1588135	5096586		Vibrio_phage(50.0%)	2	NA	NA
WP_003839952.1|1586656_1586941_-	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	65.7	6.0e-17
WP_003025033.1|1587163_1588135_-	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	26.2	1.6e-08
>prophage 112
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	1594828	1597710	5096586	protease	Micromonas_pusilla_virus(50.0%)	2	NA	NA
WP_003025013.1|1594828_1596763_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.6	4.1e-117
WP_046670209.1|1596861_1597710_+	dihydropteroate synthase	NA	S4VNV0	Pandoravirus	31.2	2.3e-19
>prophage 113
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	1603535	1610180	5096586		Dickeya_phage(50.0%)	4	NA	NA
WP_069219468.1|1603535_1604879_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	93.7	4.8e-64
WP_003024996.1|1605496_1605949_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_003024992.1|1605977_1607465_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_003844847.1|1607489_1610180_+	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.4	2.5e-24
>prophage 114
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	1615770	1617678	5096586		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_046670214.1|1615770_1617678_+	DEAD/DEAH family ATP-dependent RNA helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.8	4.6e-52
>prophage 115
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	1623442	1629531	5096586		Invertebrate_iridovirus(33.33%)	8	NA	NA
WP_003844855.1|1623442_1623742_-	GIY-YIG nuclease family protein	NA	S6DF82	Invertebrate_iridovirus	53.2	4.2e-13
WP_044714511.1|1623794_1624223_+	YhbP family protein	NA	NA	NA	NA	NA
WP_003024957.1|1624260_1624896_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_044701311.1|1624989_1625565_-	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_003024948.1|1625574_1626165_-	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.8	3.2e-12
WP_003024946.1|1626199_1626595_-	YraN family protein	NA	NA	NA	NA	NA
WP_046670219.1|1626552_1628604_-	penicillin-binding protein activator	NA	NA	NA	NA	NA
WP_003024942.1|1628667_1629531_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.6	5.6e-50
>prophage 116
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	1641384	1642491	5096586		Bacillus_phage(100.0%)	1	NA	NA
WP_069219469.1|1641384_1642491_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	W8CYL7	Bacillus_phage	29.6	9.2e-13
>prophage 117
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	1652384	1653530	5096586		Streptococcus_phage(100.0%)	1	NA	NA
WP_046670227.1|1652384_1653530_+	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	39.9	1.2e-47
>prophage 118
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	1657013	1657592	5096586		uncultured_archaeal_virus(100.0%)	1	NA	NA
WP_044701290.1|1657013_1657592_-	recombinase family protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	37.7	8.4e-18
>prophage 119
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	1667815	1670110	5096586		Tetraselmis_virus(100.0%)	1	NA	NA
WP_003024871.1|1667815_1670110_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	40.4	5.3e-156
>prophage 120
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	1690561	1691530	5096586		Escherichia_phage(100.0%)	1	NA	NA
WP_003828551.1|1690561_1691530_-	TerC family protein	NA	A0A291LBC5	Escherichia_phage	31.8	3.5e-32
>prophage 121
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	1702551	1714598	5096586	tRNA	Herpes_simplex_virus(25.0%)	9	NA	NA
WP_046670249.1|1702551_1705644_-	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	34.0	3.8e-157
WP_003024771.1|1705851_1706835_-	transcriptional regulator EbgR	NA	NA	NA	NA	NA
WP_069219475.1|1707044_1707377_+|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_048998748.1|1707450_1708893_-	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.7	2.7e-33
WP_003841468.1|1709260_1710781_+	PAS domain-containing methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	49.3	2.9e-33
WP_046670252.1|1710834_1711509_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_046670253.1|1711748_1712531_+	siderophore-interacting protein	NA	NA	NA	NA	NA
WP_003024755.1|1712527_1713376_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003846231.1|1713443_1714598_+	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.8	1.6e-84
>prophage 122
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	1728818	1737693	5096586	tRNA	Acinetobacter_phage(25.0%)	6	NA	NA
WP_003838090.1|1728818_1730816_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	27.2	1.9e-08
WP_003846277.1|1730826_1731876_-	YncE family protein	NA	NA	NA	NA	NA
WP_003024699.1|1732037_1733885_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
WP_003024697.1|1734244_1735990_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.8	8.4e-77
WP_001144069.1|1736227_1736443_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_046670280.1|1736679_1737693_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.5	3.7e-109
>prophage 123
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	1749085	1750327	5096586		Sinorhizobium_phage(100.0%)	1	NA	NA
WP_016150993.1|1749085_1750327_-	multifunctional CCA addition/repair protein	NA	A0A0F6YPT7	Sinorhizobium_phage	49.3	1.8e-94
>prophage 124
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	1755577	1757011	5096586		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_003838125.1|1755577_1757011_+	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	28.8	2.2e-38
>prophage 125
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	1760608	1761262	5096586		Staphylococcus_phage(100.0%)	1	NA	NA
WP_069219477.1|1760608_1761262_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.3	8.3e-46
>prophage 126
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	1766954	1775051	5096586		Ralstonia_phage(25.0%)	8	NA	NA
WP_032937372.1|1766954_1768115_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	42.9	6.5e-86
WP_003024591.1|1768120_1768798_-	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	45.0	2.6e-34
WP_032937374.1|1768955_1770440_-	outer membrane channel protein TolC	NA	NA	NA	NA	NA
WP_003024585.1|1770645_1771278_+	ADP-ribose diphosphatase	NA	A0A1S6L1P8	Vibrio_phage	34.7	1.2e-20
WP_003024582.1|1771274_1771697_+	DUF1249 family protein	NA	NA	NA	NA	NA
WP_003838143.1|1771721_1772549_+	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
WP_003024575.1|1772548_1773130_+	esterase YqiA	NA	NA	NA	NA	NA
WP_003024571.1|1773158_1775051_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	34.8	2.0e-92
>prophage 127
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	1783686	1786462	5096586		Stx_converting_phage(50.0%)	2	NA	NA
WP_003024544.1|1783686_1784085_+	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	43.9	9.9e-18
WP_003024543.1|1784203_1786462_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.5	4.4e-86
>prophage 128
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	1790570	1795815	5096586		Pseudomonas_phage(33.33%)	4	NA	NA
WP_003024532.1|1790570_1792742_+	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.4	1.3e-103
WP_003024529.1|1792845_1793301_-	HIT family protein	NA	Q5YEY9	Rock_bream_iridovirus	34.7	2.1e-19
WP_046670293.1|1793344_1794799_-	DASS family sodium-coupled anion symporter	NA	NA	NA	NA	NA
WP_003024520.1|1794987_1795815_-	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	46.0	1.1e-63
>prophage 129
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	1805514	1807155	5096586		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_046670294.1|1805514_1807155_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	54.7	7.5e-11
>prophage 130
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	1821624	1871926	5096586	integrase,protease,transposase,tRNA	Leptospira_phage(25.0%)	46	1814334:1814348	1860355:1860369
1814334:1814348	attL	TGTAGGCCTGATAAG	NA	NA	NA	NA
WP_103278593.1|1821624_1822745_-|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
WP_069219480.1|1823631_1824528_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_069219481.1|1824559_1825900_-	MFS transporter	NA	NA	NA	NA	NA
WP_069219482.1|1826438_1827104_-	RraA family protein	NA	NA	NA	NA	NA
WP_103015411.1|1829356_1830476_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.4	3.9e-51
WP_081328897.1|1831057_1831855_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_069219485.1|1831950_1833579_-	PTS transporter subunit IICB	NA	NA	NA	NA	NA
WP_045332107.1|1833638_1835372_-	alpha-glucosidase	NA	NA	NA	NA	NA
WP_045332106.1|1835440_1836406_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_016236480.1|1836675_1837656_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	1.2e-184
WP_023293482.1|1837803_1838115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032610119.1|1838173_1838887_-	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_032610118.1|1838989_1839739_-	DUF3944 domain-containing protein	NA	NA	NA	NA	NA
WP_017382952.1|1839882_1840266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023293480.1|1840343_1840583_-	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023337779.1|1840561_1841026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023337778.1|1841084_1841513_-	DUF2787 domain-containing protein	NA	NA	NA	NA	NA
WP_023337777.1|1841560_1841992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023337776.1|1841984_1842338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032610116.1|1842937_1844269_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B3AZY4	Gordonia_phage	26.9	4.8e-16
WP_032610115.1|1844330_1846253_+	DUF927 domain-containing protein	NA	NA	NA	NA	NA
WP_032673100.1|1846328_1846679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069219486.1|1846730_1847918_-|integrase	site-specific integrase	integrase	A0A221SAN4	Ralstonia_phage	31.7	3.6e-31
WP_003838203.1|1850931_1853067_+	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_003027130.1|1853120_1854377_-	nucleoside permease	NA	NA	NA	NA	NA
WP_049001609.1|1854588_1855674_-	membrane-bound lytic murein transglycosylase MltC	NA	A0A0H3V0Q1	Geobacillus_virus	39.0	4.5e-12
WP_003027126.1|1855760_1856030_-	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_003846351.1|1856057_1857110_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_003027117.1|1857270_1857990_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_003027115.1|1857989_1858316_+	DUF469 domain-containing protein	NA	NA	NA	NA	NA
WP_003838208.1|1858365_1859085_+	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_003027108.1|1859273_1860320_+	L-asparaginase 2	NA	NA	NA	NA	NA
WP_046670298.1|1860435_1861572_-	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
1860355:1860369	attR	TGTAGGCCTGATAAG	NA	NA	NA	NA
WP_046670300.1|1861564_1862158_-	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_003027101.1|1862165_1862456_-	YggU family protein	NA	NA	NA	NA	NA
WP_003027097.1|1862452_1863019_-	YggT family protein	NA	NA	NA	NA	NA
WP_003838215.1|1863037_1863742_-	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_003027090.1|1863759_1864740_+	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_003027087.1|1864736_1865153_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_129622349.1|1865152_1865788_-	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_046670302.1|1865827_1866775_-	glutathione synthase	NA	NA	NA	NA	NA
WP_003027080.1|1866794_1867526_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_016150969.1|1867600_1868308_-	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_003838223.1|1868402_1868900_-|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_003027074.1|1868977_1870372_-	sugar porter family MFS transporter	NA	O13311	Aichi_virus	25.5	1.4e-26
WP_003027071.1|1870771_1871926_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	5.3e-128
>prophage 131
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	1884697	1885381	5096586		Bacillus_virus(100.0%)	1	NA	NA
WP_046670308.1|1884697_1885381_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	24.5	2.6e-10
>prophage 132
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	1902891	1904124	5096586		Catovirus(100.0%)	1	NA	NA
WP_003026984.1|1902891_1904124_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	47.6	4.1e-102
>prophage 133
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	1912380	1917586	5096586		Prochlorococcus_phage(50.0%)	3	NA	NA
WP_044713822.1|1912380_1915254_+	aminomethyl-transferring glycine dehydrogenase	NA	M4QFZ1	Prochlorococcus_phage	51.0	3.4e-261
WP_032937431.1|1915315_1916059_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_069219487.1|1916152_1917586_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	26.3	2.2e-30
>prophage 134
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	1922287	1935957	5096586	integrase,transposase,tRNA	Bacillus_phage(33.33%)	12	1918511:1918525	1936710:1936724
1918511:1918525	attL	TTTTTCAGCGTTTCC	NA	NA	NA	NA
WP_003026928.1|1922287_1923184_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	27.9	2.5e-29
WP_003825520.1|1923207_1923921_+	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_016150943.1|1923926_1925660_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.5	1.3e-61
WP_096878465.1|1925751_1926849_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
WP_003026911.1|1926859_1928377_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.9	1.3e-86
WP_032948043.1|1928454_1929009_-	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_016150941.1|1929175_1929934_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A7K9	Microcystis_virus	37.3	3.2e-09
WP_048998164.1|1930251_1931442_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.2	3.6e-140
WP_085950818.1|1931468_1932589_-|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
WP_000790483.1|1933126_1933558_-	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_032433718.1|1933808_1935284_-	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	29.7	1.8e-27
WP_038633715.1|1935276_1935957_-	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	35.7	7.8e-31
1936710:1936724	attR	GGAAACGCTGAAAAA	NA	NA	NA	NA
>prophage 135
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	1943130	1946593	5096586		uncultured_virus(50.0%)	3	NA	NA
WP_069219488.1|1943130_1945584_+	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	34.9	5.8e-84
WP_043016712.1|1945624_1945822_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_000287501.1|1945855_1946593_-	peptidase	NA	A8ATH6	Listeria_phage	41.0	1.0e-12
>prophage 136
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	1951687	1964195	5096586	transposase	uncultured_Caudovirales_phage(50.0%)	13	NA	NA
WP_001188930.1|1951687_1952368_+	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
WP_009654301.1|1952364_1953765_+	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.9	6.4e-19
WP_038633679.1|1953980_1954415_+	copper resistance system metallochaperone PcoE	NA	NA	NA	NA	NA
WP_049025755.1|1955958_1956309_+	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	51.9	3.6e-24
WP_048998181.1|1956356_1956719_+	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_049014748.1|1956735_1958487_+	arsenite efflux transporter ATPase subunit ArsA	NA	NA	NA	NA	NA
WP_049014746.1|1958534_1959824_+	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.5	2.1e-170
WP_048998205.1|1959836_1960262_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	5.2e-49
WP_035897605.1|1960387_1960906_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_048998204.1|1960932_1961394_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_048998203.1|1961455_1962058_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_048998202.1|1962101_1962797_+	B3/4 domain-containing protein	NA	NA	NA	NA	NA
WP_094487604.1|1962988_1964195_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	62.9	5.7e-101
>prophage 137
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	1971555	1975857	5096586		Yersinia_phage(33.33%)	7	NA	NA
WP_048998193.1|1971555_1972380_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.0	6.8e-45
WP_048998192.1|1972588_1973299_+	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_048998191.1|1973324_1973861_+	DUF4339 domain-containing protein	NA	NA	NA	NA	NA
WP_048998190.1|1973912_1974479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048998189.1|1974568_1974979_+	hypothetical protein	NA	A0A1B2IBY1	Erwinia_phage	53.0	3.1e-30
WP_048998188.1|1975056_1975296_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_069219491.1|1975398_1975857_+	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	35.5	2.9e-13
>prophage 138
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	1987142	1987748	5096586		Canarypox_virus(100.0%)	1	NA	NA
WP_003033877.1|1987142_1987748_+	ankyrin repeat domain-containing protein	NA	Q6VZ28	Canarypox_virus	26.9	3.2e-07
>prophage 139
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	2002482	2005921	5096586	transposase	Trichoplusia_ni_ascovirus(33.33%)	3	NA	NA
WP_046670332.1|2002482_2003244_+	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.1	3.5e-19
WP_003840970.1|2003559_2004978_+	sugar porter family MFS transporter	NA	O13311	Aichi_virus	26.7	5.1e-24
WP_003033929.1|2005033_2005921_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	45.8	1.4e-67
>prophage 140
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	2009682	2010693	5096586		Enterobacteria_phage(100.0%)	1	NA	NA
WP_003846454.1|2009682_2010693_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	30.4	5.6e-33
>prophage 141
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	2017270	2024094	5096586		Moraxella_phage(33.33%)	6	NA	NA
WP_003033961.1|2017270_2017984_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.3	5.3e-46
WP_046670337.1|2018059_2018755_-	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_003033982.1|2019439_2019970_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_003033984.1|2019982_2022229_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	24.6	5.1e-10
WP_003033987.1|2022417_2023293_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_003033990.1|2023299_2024094_+	thymidylate synthase	NA	R4IFY1	Cronobacter_phage	62.0	1.9e-116
>prophage 142
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	2029574	2040771	5096586		Klosneuvirus(25.0%)	5	NA	NA
WP_069219495.1|2029574_2032463_+	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	25.0	9.0e-68
WP_046670343.1|2032455_2036001_+	exodeoxyribonuclease V subunit beta	NA	A7KV33	Bacillus_phage	20.1	5.8e-08
WP_003034009.1|2035997_2037827_+	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	34.4	1.9e-18
WP_003034012.1|2037951_2039283_-	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_003840937.1|2039517_2040771_+	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	28.4	2.7e-13
>prophage 143
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	2051190	2053726	5096586	tRNA	Pandoravirus(50.0%)	3	NA	NA
WP_003846496.1|2051190_2051997_+|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	32.8	2.2e-16
WP_003840390.1|2052074_2052521_-	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_046670350.1|2052520_2053726_-	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	36.2	1.9e-72
>prophage 144
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	2061960	2063460	5096586		Bacillus_virus(100.0%)	1	NA	NA
WP_003034052.1|2061960_2063460_+	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.3	4.6e-15
>prophage 145
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	2070211	2070967	5096586		Bacillus_phage(100.0%)	1	NA	NA
WP_003840372.1|2070211_2070967_-	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	28.7	8.8e-07
>prophage 146
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	2075882	2076731	5096586		Vibrio_phage(100.0%)	1	NA	NA
WP_003034084.1|2075882_2076731_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.3	1.8e-40
>prophage 147
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	2081256	2089338	5096586		Oenococcus_phage(25.0%)	5	NA	NA
WP_032941178.1|2081256_2082597_+	glucarate dehydratase	NA	Q6A202	Oenococcus_phage	23.9	1.2e-06
WP_003840351.1|2082617_2083958_+	glucarate dehydratase	NA	NA	NA	NA	NA
WP_003034114.1|2084039_2085182_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	40.7	4.8e-49
WP_003840349.1|2085225_2087982_-	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	29.5	1.0e-52
WP_046670357.1|2088039_2089338_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	28.1	1.8e-36
>prophage 148
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	2092812	2095836	5096586		Only_Syngen_Nebraska_virus(50.0%)	2	NA	NA
WP_003034127.1|2092812_2094450_+	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.6	6.7e-153
WP_003034129.1|2094537_2095836_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	57.9	1.4e-129
>prophage 149
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	2099198	2099870	5096586		Vibrio_phage(100.0%)	1	NA	NA
WP_003034139.1|2099198_2099870_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	24.6	3.9e-14
>prophage 150
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	2107212	2109245	5096586		Hokovirus(50.0%)	2	NA	NA
WP_044713391.1|2107212_2108640_+	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	25.8	7.9e-33
WP_003034157.1|2108639_2109245_+	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	37.9	6.1e-27
>prophage 151
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	2112418	2116122	5096586		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_003825728.1|2112418_2113180_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	46.7	2.5e-57
WP_003034172.1|2113173_2113800_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	50.6	4.4e-36
WP_003034174.1|2113939_2115067_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.4	1.4e-05
WP_000081498.1|2115129_2116122_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
>prophage 152
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	2119598	2122160	5096586		Cafeteria_roenbergensis_virus(100.0%)	1	NA	NA
WP_016150901.1|2119598_2122160_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.9	4.1e-32
>prophage 153
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	2130735	2137073	5096586	holin	Yersinia_phage(33.33%)	6	NA	NA
WP_003840305.1|2130735_2133114_-|holin	choline trimethylamine-lyase	holin	A0A2C9CWX5	Yersinia_phage	37.5	8.1e-06
WP_008322725.1|2133127_2133457_-	multidrug efflux SMR transporter	NA	E5EPE2	Acinetobacter_phage	33.0	4.2e-06
WP_003037438.1|2133453_2133804_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_016150895.1|2134549_2135401_-	iron/manganese ABC transporter permease subunit SitD	NA	NA	NA	NA	NA
WP_016150894.1|2135397_2136255_-	iron/manganese ABC transporter permease subunit SitC	NA	NA	NA	NA	NA
WP_003840297.1|2136257_2137073_-	iron/manganese ABC transporter ATP-binding protein SitB	NA	W5SAS9	Pithovirus	28.1	1.2e-12
>prophage 154
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	2172897	2173863	5096586		Tetraselmis_virus(100.0%)	1	NA	NA
WP_003037353.1|2172897_2173863_-	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	33.9	1.8e-36
>prophage 155
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	2179354	2184775	5096586	tRNA	Pseudomonas_phage(25.0%)	5	NA	NA
WP_046670378.1|2179354_2179852_+	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	50.3	2.2e-30
WP_003037330.1|2179944_2181009_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.8	4.0e-114
WP_046670379.1|2181095_2181596_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_046670380.1|2181724_2184352_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.8	8.4e-81
WP_000906486.1|2184589_2184775_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
>prophage 156
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	2199406	2204703	5096586		Bacillus_virus(20.0%)	5	NA	NA
WP_003037282.1|2199406_2200609_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	38.1	1.9e-27
WP_003839677.1|2200963_2201923_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A0M4S3B4	Mycobacterium_phage	71.5	5.0e-132
WP_046670386.1|2201933_2204078_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	48.9	4.0e-198
WP_003037273.1|2204050_2204461_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	41.0	6.6e-17
WP_003846033.1|2204457_2204703_-	glutaredoxin-like protein NrdH	NA	A0A0M7REK7	Lactobacillus_phage	42.5	2.9e-12
>prophage 157
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	2210466	2214487	5096586		Clostridioides_phage(50.0%)	4	NA	NA
WP_003037241.1|2210466_2210916_+	peptidoglycan-binding protein LysM	NA	A0A1V0DZX0	Clostridioides_phage	38.2	3.7e-05
WP_046670393.1|2210928_2211615_-	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_003839698.1|2211660_2213061_-	GABA permease	NA	NA	NA	NA	NA
WP_046670394.1|2213203_2214487_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.6	2.4e-28
>prophage 158
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	2218489	2219203	5096586		Bacillus_virus(100.0%)	1	NA	NA
WP_003037218.1|2218489_2219203_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	37.1	3.1e-14
>prophage 159
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	2245734	2250955	5096586		Tetraselmis_virus(50.0%)	5	NA	NA
WP_044699634.1|2245734_2246946_+	glycosyltransferase family 4 protein	NA	A0A2P0VNG4	Tetraselmis_virus	31.6	1.3e-12
WP_046670406.1|2246947_2248060_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_046670407.1|2248062_2248470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046670408.1|2248500_2249892_+	DUF4832 domain-containing protein	NA	NA	NA	NA	NA
WP_046670409.1|2249938_2250955_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	46.5	7.2e-81
>prophage 160
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	2262316	2265559	5096586		Ectocarpus_siliculosus_virus(100.0%)	1	NA	NA
WP_069219502.1|2262316_2265559_+	transporter substrate-binding domain-containing protein	NA	Q8QKV7	Ectocarpus_siliculosus_virus	30.3	2.1e-33
>prophage 161
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	2275754	2281577	5096586		Micromonas_sp._RCC1109_virus(50.0%)	4	NA	NA
WP_046670419.1|2275754_2277680_+	3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing)	NA	E5EQ70	Micromonas_sp._RCC1109_virus	23.1	1.3e-25
WP_003845960.1|2278023_2279010_+	inositol 2-dehydrogenase	NA	NA	NA	NA	NA
WP_032949851.1|2279048_2279978_+	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_046670420.1|2280029_2281577_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.7	6.6e-09
>prophage 162
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	2287622	2291978	5096586		Escherichia_phage(100.0%)	1	NA	NA
WP_046670423.1|2287622_2291978_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	37.8	1.8e-144
>prophage 163
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	2297897	2298104	5096586		Moraxella_phage(100.0%)	1	NA	NA
WP_000795663.1|2297897_2298104_+	AlpA family transcriptional regulator	NA	A0A0R6PGY4	Moraxella_phage	41.1	8.5e-05
>prophage 164
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	2313075	2318264	5096586	integrase	Escherichia_phage(50.0%)	3	2310360:2310372	2333416:2333428
2310360:2310372	attL	TTTAAAACCTTTT	NA	NA	NA	NA
WP_069219507.1|2313075_2314347_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	91.1	5.7e-216
WP_086538730.1|2314906_2316070_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_046670438.1|2316077_2318264_-	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	29.8	5.5e-17
2333416:2333428	attR	TTTAAAACCTTTT	NA	NA	NA	NA
>prophage 165
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	2331581	2332064	5096586		Staphylococcus_phage(100.0%)	1	NA	NA
WP_003031211.1|2331581_2332064_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	1.2e-28
>prophage 166
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	2343398	2346954	5096586		Pseudomonas_phage(50.0%)	4	NA	NA
WP_003839838.1|2343398_2344625_-	diguanylate cyclase DgcN	NA	A0A2K8I9Y5	Pseudomonas_phage	37.6	1.1e-06
WP_069219509.1|2344617_2345136_-	YfiR family protein	NA	NA	NA	NA	NA
WP_046670443.1|2345294_2345669_-	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_003031241.1|2345883_2346954_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	50.9	4.5e-89
>prophage 167
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	2352908	2355482	5096586		Enterobacteria_phage(100.0%)	1	NA	NA
WP_003031249.1|2352908_2355482_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.2	1.5e-127
>prophage 168
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	2361313	2362612	5096586		Burkholderia_virus(100.0%)	1	NA	NA
WP_003037551.1|2361313_2362612_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	31.1	5.3e-44
>prophage 169
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	2367911	2373485	5096586	tRNA	Achromobacter_phage(25.0%)	5	NA	NA
WP_003037559.1|2367911_2368331_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	36.5	8.3e-15
WP_003037560.1|2368538_2369618_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_003037561.1|2369651_2370341_-	uracil-DNA glycosylase	NA	A0A076JX67	Equid_alphaherpesvirus	49.3	7.9e-55
WP_003037563.1|2370658_2371042_+	autonomous glycyl radical cofactor GrcA	NA	A0A1W5N098	Cronobacter_phage	70.9	3.6e-33
WP_003037569.1|2372156_2373485_-	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	29.1	2.5e-41
>prophage 170
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	2379329	2383069	5096586		Streptococcus_phage(50.0%)	3	NA	NA
WP_003037577.1|2379329_2381129_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.1	3.8e-24
WP_003037578.1|2381144_2382119_+	signal peptidase I	NA	NA	NA	NA	NA
WP_003037579.1|2382388_2383069_+	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.8	1.6e-20
>prophage 171
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	2386085	2386346	5096586		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_003037590.1|2386085_2386346_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	54.7	1.7e-18
>prophage 172
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	2392647	2403973	5096586		Bacillus_phage(50.0%)	7	NA	NA
WP_046670158.1|2392647_2396535_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	59.0	3.8e-130
WP_003037614.1|2397171_2398602_+	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	25.6	1.2e-12
WP_032949809.1|2398624_2399368_+	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_046670157.1|2399364_2400702_+	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	34.1	1.4e-10
WP_002914032.1|2400762_2401101_+	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_016150774.1|2401202_2402393_-	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_003037627.1|2402719_2403973_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	53.4	3.9e-100
>prophage 173
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	2423266	2424775	5096586		Bacillus_virus(100.0%)	1	NA	NA
WP_046670150.1|2423266_2424775_-	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.4	4.6e-15
>prophage 174
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	2430395	2436750	5096586		Faustovirus(20.0%)	8	NA	NA
WP_003838433.1|2430395_2431610_+	IscS subfamily cysteine desulfurase	NA	A0A1X7C038	Faustovirus	32.6	1.2e-34
WP_002913991.1|2431635_2432022_+	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	77.3	2.7e-52
WP_003037681.1|2432042_2432366_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	47.7	9.2e-22
WP_003037683.1|2432474_2432990_+	co-chaperone HscB	NA	NA	NA	NA	NA
WP_003838439.1|2433005_2434856_+	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.9	1.4e-103
WP_003037690.1|2434857_2435193_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_003037694.1|2435204_2435405_+	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_003037696.1|2435466_2436750_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	35.4	9.9e-35
>prophage 175
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	2446594	2447026	5096586		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_003037710.1|2446594_2447026_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.1	5.3e-17
>prophage 176
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	2456003	2457545	5096586		Acinetobacter_phage(100.0%)	1	NA	NA
WP_069219513.1|2456003_2457545_+	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	57.4	4.1e-160
>prophage 177
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	2468849	2475028	5096586		Bodo_saltans_virus(33.33%)	5	NA	NA
WP_046670144.1|2468849_2470217_-	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.0	3.4e-41
WP_003037756.1|2470377_2471844_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.5	5.7e-87
WP_003037760.1|2471907_2473485_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_152659852.1|2473539_2474460_-	small-conductance mechanosensitive channel MscS	NA	NA	NA	NA	NA
WP_049002457.1|2474824_2475028_-	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	71.4	5.6e-17
>prophage 178
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	2481455	2487053	5096586		Prochlorococcus_phage(33.33%)	5	NA	NA
WP_003838482.1|2481455_2482097_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	40.6	4.5e-28
WP_003838485.1|2482093_2483131_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	42.4	6.3e-72
WP_046670141.1|2483426_2484857_+	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_003037929.1|2485040_2485667_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_003037932.1|2485763_2487053_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	36.7	1.7e-63
>prophage 179
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	2496967	2497681	5096586		Synechococcus_phage(100.0%)	1	NA	NA
WP_046670138.1|2496967_2497681_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3HWF9	Synechococcus_phage	35.7	9.1e-38
>prophage 180
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	2533560	2543097	5096586		Paenibacillus_phage(20.0%)	11	NA	NA
WP_003038046.1|2533560_2534430_-	N-acetylmuramoyl-L-alanine amidase AmiA	NA	A0A0N9SGH1	Paenibacillus_phage	33.3	1.5e-18
WP_003038048.1|2534642_2535068_+	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_003847269.1|2535054_2535504_+	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_046670129.1|2535563_2536139_+	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_003838547.1|2536232_2537132_+	porphyrinogen peroxidase	NA	S4VVJ7	Pandoravirus	32.4	1.5e-24
WP_003038057.1|2537304_2538096_+	SDR family oxidoreductase UcpA	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.8	6.8e-18
WP_003038059.1|2538253_2539270_+	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003038061.1|2539270_2540104_+	sulfate/thiosulfate ABC transporter permease CysT	NA	NA	NA	NA	NA
WP_003038064.1|2540103_2540979_+	sulfate/thiosulfate ABC transporter permease CysW	NA	NA	NA	NA	NA
WP_003847288.1|2540968_2542066_+	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G9BWD6	Planktothrix_phage	38.9	6.3e-30
WP_003838552.1|2542185_2543097_+	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	43.8	4.8e-60
>prophage 181
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	2547080	2556947	5096586		Hokovirus(25.0%)	9	NA	NA
WP_003038080.1|2547080_2548808_-	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.1	7.4e-17
WP_003038086.1|2548853_2549111_-	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_003038091.1|2549494_2550466_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	3.3e-75
WP_152659851.1|2550629_2551391_-	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_003038097.1|2551621_2552629_+	cell division protein ZipA	NA	NA	NA	NA	NA
WP_003838570.1|2552700_2554716_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	43.4	1.5e-149
WP_003038102.1|2554717_2554936_+	DUF3820 family protein	NA	NA	NA	NA	NA
WP_003038103.1|2554932_2555931_-	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_046670126.1|2556020_2556947_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	25.9	2.6e-08
>prophage 182
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	2581670	2582405	5096586		Clostridioides_phage(100.0%)	1	NA	NA
WP_032936528.1|2581670_2582405_-	response regulator transcription factor	NA	A0A2R2ZGH8	Clostridioides_phage	25.8	1.6e-13
>prophage 183
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	2586882	2587803	5096586		Morganella_phage(100.0%)	1	NA	NA
WP_046670111.1|2586882_2587803_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	53.9	1.8e-75
>prophage 184
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	2595860	2611272	5096586		Morganella_phage(25.0%)	15	NA	NA
WP_032936544.1|2595860_2597759_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	24.3	8.4e-14
WP_003839291.1|2597933_2598563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032171695.1|2599381_2600338_+	HNH endonuclease	NA	A0A1S6KZY3	Salmonella_phage	78.5	7.4e-144
WP_069219519.1|2600416_2601292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001185337.1|2601754_2602027_-	ogr/Delta-like zinc finger family protein	NA	A0A2I8TV89	Erwinia_phage	46.9	6.3e-08
WP_069219521.1|2602026_2602788_-	septation initiation protein	NA	NA	NA	NA	NA
WP_069219522.1|2603188_2605861_-	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	34.4	1.6e-58
WP_069219523.1|2605857_2606241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069219524.1|2606237_2606522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069219525.1|2606553_2606913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081328898.1|2606905_2607082_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000153152.1|2607439_2607652_-	AlpA family phage regulatory protein	NA	A0A1W6JPE9	Morganella_phage	49.2	6.9e-10
WP_069219527.1|2607765_2608707_-	hypothetical protein	NA	A0A1W6JPD1	Morganella_phage	46.8	2.2e-07
WP_069219528.1|2608706_2609996_-	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	39.6	1.9e-73
WP_046670109.1|2610330_2611272_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	89.6	2.6e-149
>prophage 185
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	2620462	2621548	5096586		Pandoravirus(100.0%)	1	NA	NA
WP_044701213.1|2620462_2621548_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	46.7	1.0e-88
>prophage 186
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	2630028	2631165	5096586		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_046670106.1|2630028_2631165_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	26.6	2.3e-19
>prophage 187
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	2637662	2639180	5096586		Mollivirus(100.0%)	1	NA	NA
WP_003028127.1|2637662_2639180_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	1.4e-88
>prophage 188
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	2643536	2644310	5096586		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_003839331.1|2643536_2644310_+	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	27.7	3.6e-08
>prophage 189
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	2658147	2658747	5096586		Salmonella_phage(100.0%)	1	NA	NA
WP_016150702.1|2658147_2658747_-	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	38.6	5.3e-07
>prophage 190
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	2677664	2678669	5096586		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
WP_003839364.1|2677664_2678669_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	25.7	1.4e-28
>prophage 191
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	2691350	2695455	5096586		Tupanvirus(66.67%)	3	NA	NA
WP_046670099.1|2691350_2693333_-	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.5	6.3e-20
WP_003027648.1|2693329_2694313_-	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	A8CG95	Salmonella_phage	32.5	9.9e-35
WP_016150690.1|2694315_2695455_-	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L0G1	Tupanvirus	27.2	5.7e-26
>prophage 192
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	2704540	2716542	5096586		Pseudomonas_phage(33.33%)	7	NA	NA
WP_003839410.1|2704540_2705608_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	50.9	2.3e-08
WP_003027609.1|2705781_2706036_-	ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE	NA	G9IAA2	Pseudomonas_phage	76.1	2.4e-25
WP_003834668.1|2706035_2707166_-	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.6	2.8e-174
WP_003845121.1|2707276_2709562_-	ribonucleoside-diphosphate reductase subunit alpha	NA	I3UMG3	Colwellia_phage	63.8	2.3e-284
WP_003027601.1|2710050_2710779_-	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
WP_044701169.1|2710937_2713574_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	31.1	2.8e-92
WP_044701167.1|2713695_2716542_+	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	25.8	4.1e-41
>prophage 193
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	2720729	2729278	5096586		Enterobacteria_phage(20.0%)	7	NA	NA
WP_003027588.1|2720729_2721845_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	58.4	8.4e-115
WP_046670095.1|2721960_2723013_+	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_046670093.1|2723092_2724157_+	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A2P1EL10	Moumouvirus	52.9	1.1e-18
WP_003027582.1|2724156_2724807_+	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	34.3	2.9e-06
WP_003027580.1|2724882_2726526_+	multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	22.8	2.8e-10
WP_003027576.1|2726631_2728068_+	magnesium transporter	NA	NA	NA	NA	NA
WP_069219753.1|2728030_2729278_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	49.3	4.7e-82
>prophage 194
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	2738078	2738699	5096586		Bacillus_virus(100.0%)	1	NA	NA
WP_003027545.1|2738078_2738699_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	24.5	1.4e-10
>prophage 195
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	2747667	2755300	5096586		Vibrio_phage(50.0%)	7	NA	NA
WP_003027504.1|2747667_2748675_+	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	47.6	1.0e-82
WP_003027502.1|2748795_2749080_-	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_044701147.1|2749204_2750965_-	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.8	9.3e-100
WP_003027496.1|2751115_2751823_+	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_003027494.1|2751838_2753029_+	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	22.4	1.4e-19
WP_085951589.1|2753362_2753707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046670087.1|2753710_2755300_-	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	31.8	6.1e-18
>prophage 196
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	2761067	2765371	5096586		Bacillus_phage(50.0%)	4	NA	NA
WP_003027474.1|2761067_2761637_-	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	S5MM68	Bacillus_phage	37.6	2.3e-12
WP_003840063.1|2762050_2762764_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_016150669.1|2762798_2763785_-	GTP-binding protein	NA	NA	NA	NA	NA
WP_003840066.1|2763904_2765371_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	30.2	2.0e-39
>prophage 197
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	2787838	2788696	5096586		Catovirus(100.0%)	1	NA	NA
WP_003027428.1|2787838_2788696_-	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	32.8	4.4e-23
>prophage 198
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	2792606	2796699	5096586		Acinetobacter_phage(50.0%)	3	NA	NA
WP_003027416.1|2792606_2794592_-	ligand-gated channel protein	NA	A0A0P0I887	Acinetobacter_phage	32.6	4.5e-10
WP_046670072.1|2794871_2795708_-	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_003027410.1|2796030_2796699_+	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.8	4.1e-56
>prophage 199
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	2800403	2801924	5096586		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_003027396.1|2800403_2801924_+	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	32.8	3.4e-10
>prophage 200
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	2816305	2817040	5096586		Streptococcus_phage(100.0%)	1	NA	NA
WP_046670063.1|2816305_2817040_-	class I SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	44.0	1.0e-52
>prophage 201
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	2827805	2836224	5096586	tRNA	Enterobacteria_phage(66.67%)	9	NA	NA
WP_046670058.1|2827805_2828753_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	25.6	4.9e-07
WP_046670057.1|2828736_2829468_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003027354.1|2829448_2829556_-	protein YohO	NA	NA	NA	NA	NA
WP_003027351.1|2829607_2830339_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	93.5	1.0e-105
WP_046670056.1|2830564_2832250_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.4	1.1e-280
WP_003840155.1|2832246_2832966_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_003027346.1|2833012_2833483_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	76.9	4.9e-64
WP_046670055.1|2833525_2833984_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	67.3	1.5e-49
WP_003027344.1|2834190_2836224_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	4.0e-54
>prophage 202
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	2847184	2851690	5096586		Serratia_phage(50.0%)	5	NA	NA
WP_016150633.1|2847184_2848189_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	27.7	2.4e-12
WP_003027315.1|2848185_2849463_-	MFS transporter	NA	NA	NA	NA	NA
WP_071977988.1|2849446_2849680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003027312.1|2849715_2850768_+	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_032949625.1|2850790_2851690_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	28.6	3.7e-12
>prophage 203
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	2854919	2855648	5096586		Planktothrix_phage(100.0%)	1	NA	NA
WP_003027295.1|2854919_2855648_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.0	1.1e-27
>prophage 204
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	2861360	2863079	5096586		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_003027264.1|2861360_2863079_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	23.8	8.9e-31
>prophage 205
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	2874330	2888397	5096586	protease,tRNA	Bacillus_phage(25.0%)	10	NA	NA
WP_003840216.1|2874330_2876277_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	41.8	2.4e-40
WP_003036813.1|2876351_2876576_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	62.7	3.6e-17
WP_003036810.1|2876899_2877220_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	3.5e-13
WP_003036804.1|2877250_2879527_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.1	1.4e-164
WP_044701894.1|2879796_2881158_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	92.9	5.3e-204
WP_003841759.1|2881317_2881650_-	YegP family protein	NA	NA	NA	NA	NA
WP_003036797.1|2881785_2882508_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	32.7	9.2e-30
WP_003844344.1|2882504_2883908_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.2	5.0e-32
WP_044711356.1|2883907_2885320_-	MFS transporter	NA	NA	NA	NA	NA
WP_046670050.1|2885316_2888397_-	multidrug efflux RND transporter permease subunit MdtC	NA	S5VTK5	Leptospira_phage	22.7	9.9e-65
>prophage 206
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	2893204	2894557	5096586		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_044701901.1|2893204_2894557_-	molecular chaperone	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	20.5	3.9e-05
>prophage 207
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	2899175	2909813	5096586		Catovirus(20.0%)	9	NA	NA
WP_003036776.1|2899175_2899817_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	38.3	2.2e-35
WP_003036774.1|2899908_2900490_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	43.2	3.2e-33
WP_069219540.1|2900516_2902370_+	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_069219541.1|2902414_2903998_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	44.9	1.2e-37
WP_003834266.1|2904653_2905793_+	polysaccharide export protein	NA	NA	NA	NA	NA
WP_069219542.1|2905798_2906248_+	low molecular weight protein-tyrosine-phosphatase Wzb	NA	NA	NA	NA	NA
WP_069219543.1|2906244_2908407_+	tyrosine-protein kinase Wzc	NA	A0A1X9I5D6	Streptococcus_phage	30.8	2.4e-17
WP_000206145.1|2908479_2909322_+	colanic acid biosynthesis glycosyltransferase WcaA	NA	NA	NA	NA	NA
WP_069219544.1|2909324_2909813_+	colanic acid biosynthesis acetyltransferase WcaB	NA	A0A191KBJ5	Streptococcus_virus	41.0	1.6e-09
>prophage 208
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	2913559	2920288	5096586		Synechococcus_phage(25.0%)	6	NA	NA
WP_003036748.1|2913559_2914681_+	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	65.5	2.4e-133
WP_069219548.1|2914683_2915649_+	GDP-L-fucose synthase	NA	M1I5W5	Acanthocystis_turfacea_Chlorella_virus	50.6	2.6e-88
WP_069219549.1|2915651_2916131_+	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_069219550.1|2916127_2917354_+	colanic acid biosynthesis fucosyltransferase WcaI	NA	NA	NA	NA	NA
WP_069219754.1|2917353_2918790_+	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	31.8	1.5e-52
WP_069219551.1|2918917_2920288_+	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	26.5	2.1e-30
>prophage 209
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	2925749	2933379	5096586		Enterobacteria_phage(33.33%)	7	NA	NA
WP_069219556.1|2925749_2927144_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	34.6	1.2e-22
WP_069219557.1|2927292_2928288_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A0K1L6Z1	Scale_drop_disease_virus	28.5	1.1e-09
WP_069219558.1|2928525_2929419_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	40.3	4.3e-45
WP_069219559.1|2929784_2930870_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	52.8	2.2e-99
WP_069219560.1|2930869_2931739_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.3	4.6e-108
WP_069219561.1|2931745_2932147_+	WxcM-like domain-containing protein	NA	NA	NA	NA	NA
WP_069219562.1|2932275_2933379_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	E5ES42	Bathycoccus_sp._RCC1105_virus	29.1	5.9e-36
>prophage 210
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	2938764	2943248	5096586		Ostreococcus_lucimarinus_virus(33.33%)	4	NA	NA
WP_069219568.1|2938764_2940171_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	2.3e-37
WP_069219569.1|2940406_2941573_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	53.7	1.3e-113
WP_069219570.1|2941615_2942185_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_069219571.1|2942243_2943248_-	NAD-dependent epimerase	NA	A0A218MKE7	uncultured_virus	28.2	2.6e-14
>prophage 211
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	2953771	2954671	5096586		Cellulophaga_phage(100.0%)	1	NA	NA
WP_003834191.1|2953771_2954671_-	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	97.4	4.8e-12
>prophage 212
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	2962632	2965287	5096586		Escherichia_phage(50.0%)	3	NA	NA
WP_003844270.1|2962632_2963211_+	thiosulfate reductase electron transport protein PhsB	NA	A0A077SL61	Escherichia_phage	38.0	2.1e-21
WP_003844268.1|2963207_2963975_+	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
WP_046670013.1|2964114_2965287_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	86.4	4.1e-197
>prophage 213
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	2984943	2985753	5096586		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_003030258.1|2984943_2985753_+	propanediol diffusion facilitator PduF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	27.8	1.7e-11
>prophage 214
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	2999247	3000063	5096586		Amsacta_moorei_entomopoxvirus(100.0%)	1	NA	NA
WP_016150565.1|2999247_3000063_+	energy-coupling factor ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	24.2	2.5e-07
>prophage 215
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	3005032	3005716	5096586		Bacillus_virus(100.0%)	1	NA	NA
WP_003030299.1|3005032_3005716_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.7	4.0e-27
>prophage 216
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	3010789	3015054	5096586		Burkholderia_phage(50.0%)	4	NA	NA
WP_069219584.1|3010789_3011965_-	porin	NA	Q1MVN1	Enterobacteria_phage	55.3	2.9e-105
WP_003839062.1|3012406_3013099_+	phosphohydrolase	NA	S4W232	Pandoravirus	27.1	8.0e-07
WP_046670000.1|3013175_3014606_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.4	1.6e-102
WP_044711129.1|3014586_3015054_+	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	3.4e-33
>prophage 217
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	3041772	3042525	5096586		Bacillus_virus(100.0%)	1	NA	NA
WP_003030477.1|3041772_3042525_+	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.4	6.4e-26
>prophage 218
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	3048740	3052822	5096586	transposase	Escherichia_phage(50.0%)	2	NA	NA
WP_155761569.1|3048740_3049757_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	2.9e-186
WP_069219589.1|3050770_3052822_+	sigma-70 family RNA polymerase sigma factor	NA	G8CLC7	Synechococcus_phage	35.5	1.5e-29
>prophage 219
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	3073704	3075219	5096586		Cedratvirus(100.0%)	1	NA	NA
WP_069219592.1|3073704_3075219_+	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A285PWH2	Cedratvirus	29.2	1.6e-12
>prophage 220
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	3085612	3096673	5096586		uncultured_Caudovirales_phage(40.0%)	7	NA	NA
WP_046669986.1|3085612_3089239_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	24.7	1.3e-28
WP_003839151.1|3089349_3090621_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_032936849.1|3091027_3092683_+	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	24.8	1.2e-08
WP_003844172.1|3092726_3094328_+	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	41.9	1.2e-10
WP_003034649.1|3094347_3095220_+	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_003839158.1|3095216_3096266_+	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.0	1.8e-05
WP_003034656.1|3096283_3096673_+	chemotaxis protein CheY	NA	Q56AR1	Bacillus_thuringiensis_phage	31.3	1.3e-06
>prophage 221
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	3104685	3111232	5096586	tRNA	Tupanvirus(33.33%)	7	NA	NA
WP_003034673.1|3104685_3106419_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.6	1.7e-85
WP_003034677.1|3106657_3107224_+	VOC family protein	NA	NA	NA	NA	NA
WP_032936856.1|3107226_3107973_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_003839177.1|3108216_3109185_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_003034686.1|3109181_3109925_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	31.3	3.2e-25
WP_003034689.1|3109965_3110361_-	membrane protein	NA	NA	NA	NA	NA
WP_069219593.1|3110413_3111232_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	79.5	1.0e-56
>prophage 222
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	3115085	3121292	5096586		Bacillus_virus(50.0%)	7	NA	NA
WP_003034867.1|3115085_3115607_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.6e-10
WP_003844153.1|3115687_3116299_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_003034872.1|3116307_3117318_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.4	1.6e-08
WP_003034874.1|3117396_3118182_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_046671223.1|3118178_3118934_-	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	5.0e-18
WP_003844151.1|3119012_3119957_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_003034883.1|3119972_3121292_+	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	36.8	1.2e-14
>prophage 223
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	3125224	3126700	5096586		Cyanophage(100.0%)	1	NA	NA
WP_003034896.1|3125224_3126700_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.1	8.3e-78
>prophage 224
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	3134449	3138936	5096586		Klebsiella_phage(33.33%)	7	NA	NA
WP_003833802.1|3134449_3135112_-	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	31.1	9.1e-08
WP_046671220.1|3135135_3135792_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_003034925.1|3135898_3136129_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	1.0e-14
WP_003034928.1|3136272_3136647_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_032935389.1|3136650_3137523_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_003034934.1|3137543_3137882_+	YebY family protein	NA	NA	NA	NA	NA
WP_003034937.1|3138294_3138936_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.5	8.7e-56
>prophage 225
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	3146382	3148431	5096586		Moraxella_phage(100.0%)	1	NA	NA
WP_003034960.1|3146382_3148431_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.7	1.2e-87
>prophage 226
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	3156491	3157612	5096586	transposase	Leptospira_phage(100.0%)	1	NA	NA
WP_103278593.1|3156491_3157612_-|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
>prophage 227
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	3169756	3172425	5096586	transposase	Bacillus_phage(50.0%)	2	NA	NA
WP_046671139.1|3169756_3170407_+	transglycosylase SLT domain-containing protein	NA	U5PVY0	Bacillus_phage	36.1	6.0e-12
WP_094487604.1|3171218_3172425_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	62.9	5.7e-101
>prophage 228
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	3178227	3178437	5096586		Morganella_phage(100.0%)	1	NA	NA
WP_001062678.1|3178227_3178437_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 229
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	3185934	3187494	5096586		Moraxella_phage(100.0%)	1	NA	NA
WP_003844070.1|3185934_3187494_+	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	45.4	5.1e-41
>prophage 230
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	3191362	3247114	5096586	head,coat,integrase,lysis,tRNA,portal,terminase	Enterobacteria_phage(29.79%)	73	3205627:3205650	3247405:3247428
WP_086539009.1|3191362_3192727_-	aminodeoxychorismate synthase component 1	NA	S4VNU7	Pandoravirus	40.2	8.3e-40
WP_003020986.1|3192807_3192987_+	YoaH family protein	NA	NA	NA	NA	NA
WP_003020984.1|3192993_3193338_-	RidA family protein	NA	NA	NA	NA	NA
WP_003020980.1|3193478_3195389_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	33.1	9.1e-93
WP_046671124.1|3195447_3196143_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	A0A0R6PI74	Moraxella_phage	35.4	5.8e-05
WP_003020975.1|3196237_3196822_+	Slp family lipoprotein	NA	NA	NA	NA	NA
WP_003020970.1|3197026_3198712_+	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	25.3	3.4e-35
WP_008322612.1|3198796_3199912_+	ribonuclease D	NA	NA	NA	NA	NA
WP_032949464.1|3199962_3201048_-	tartrate dehydrogenase	NA	NA	NA	NA	NA
WP_046671121.1|3201151_3202069_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001185666.1|3202155_3202422_-	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_003020956.1|3202425_3203238_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_003844062.1|3203261_3203969_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_003020949.1|3204095_3204389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046671119.1|3204458_3205118_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_085951605.1|3205195_3205657_+	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
3205627:3205650	attL	TATTTTGAACAAACCTTCATGGGC	NA	NA	NA	NA
WP_069219598.1|3205683_3206967_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	58.2	1.3e-138
WP_069219599.1|3207001_3207250_-	excisionase family protein	NA	S4TND0	Salmonella_phage	51.9	1.2e-16
WP_069219600.1|3207358_3207583_-	DUF551 domain-containing protein	NA	NA	NA	NA	NA
WP_069219601.1|3207592_3207823_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	65.3	3.5e-23
WP_069219602.1|3207806_3208124_-	DUF2591 domain-containing protein	NA	A0A2P1MXA7	Escherichia_phage	61.7	2.1e-26
WP_069219603.1|3208123_3208345_-	conjugal transfer protein TraR	NA	A0A0N7C211	Escherichia_phage	47.0	6.5e-11
WP_069219605.1|3208894_3209518_-	exonuclease	NA	A0A0U4JVN8	Pseudomonas_phage	58.3	1.4e-58
WP_069219606.1|3209514_3210261_-	phage recombination protein Bet	NA	A0A0M4RD39	Salmonella_phage	68.3	1.4e-65
WP_069219607.1|3210279_3210564_-	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	90.4	3.6e-46
WP_069219608.1|3210571_3211543_-	hypothetical protein	NA	A0A077KCC0	Edwardsiella_phage	73.7	2.1e-37
WP_069219758.1|3211629_3211809_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047500189.1|3211842_3212049_-	phage encoded cell division inhibitor protein	NA	K7PM31	Enterobacteria_phage	84.4	4.3e-25
WP_155761572.1|3212200_3212452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069219610.1|3212703_3212886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069219611.1|3212872_3213172_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069219613.1|3213768_3214401_-	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	38.9	2.0e-33
WP_069219614.1|3214499_3214715_+	helix-turn-helix transcriptional regulator	NA	Q716D6	Shigella_phage	56.7	4.7e-14
WP_069219615.1|3214834_3215137_+	hypothetical protein	NA	A5VW96	Enterobacteria_phage	63.9	6.3e-25
WP_069219616.1|3215170_3215776_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_069219617.1|3215768_3216656_+	hypothetical protein	NA	G8C7U5	Escherichia_phage	79.6	5.5e-117
WP_069219618.1|3216640_3217513_+	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	66.5	8.9e-104
WP_069219619.1|3217509_3217917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069219620.1|3218202_3218394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069219621.1|3218433_3218991_+	hypothetical protein	NA	A0A0F6N6A6	Escherichia_phage	42.9	1.2e-08
WP_071977991.1|3218987_3219539_+	ead/Ea22-like family protein	NA	A0A2H4N7C3	Pectobacterium_phage	62.0	4.4e-32
WP_069219622.1|3219540_3219966_+	hypothetical protein	NA	A0A2D2W6E9	Pectobacterium_phage	50.7	2.1e-37
WP_069219623.1|3219976_3220822_+	hypothetical protein	NA	A0A0F6TJ66	Escherichia_coli_O157_typing_phage	35.9	8.6e-19
WP_069219624.1|3221024_3221462_+	NinB protein	NA	G8C7V3	Escherichia_phage	64.8	1.1e-49
WP_081328889.1|3221461_3222049_+	protein NinG	NA	A0A1P8DTE0	Proteus_phage	59.3	9.1e-52
WP_069219626.1|3222045_3222240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069219627.1|3222236_3223001_+	antitermination protein	NA	Q5G8R6	Enterobacteria_phage	84.3	2.1e-125
WP_080762982.1|3223977_3224181_+	hypothetical protein	NA	O80287	Bacteriophage	83.6	4.1e-28
WP_081328890.1|3224152_3224647_+	lysozyme	NA	A0A2H4FND7	Salmonella_phage	87.0	1.4e-77
WP_069219628.1|3224643_3225111_+|lysis	lysis protein	lysis	A0A2D1GLQ7	Escherichia_phage	77.4	1.8e-58
WP_069219629.1|3225156_3225351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069219630.1|3225420_3225663_+	DUF2560 family protein	NA	Q76H60	Enterobacteria_phage	96.2	7.3e-32
WP_069219631.1|3225741_3226167_+	ubiquitin carboxyl-hydrolase	NA	Q716H4	Shigella_phage	89.4	4.2e-67
WP_069219632.1|3226163_3227579_+|terminase	PBSX family phage terminase large subunit	terminase	A5VW75	Enterobacteria_phage	94.1	3.3e-265
WP_069219633.1|3227578_3229762_+|portal	portal protein	portal	A0A088CQ69	Enterobacteria_phage	85.0	0.0e+00
WP_069219634.1|3229849_3230737_+	scaffolding protein	NA	A0A088CPT0	Enterobacteria_phage	63.3	1.2e-79
WP_069219635.1|3230755_3232009_+|coat	coat protein	coat	A0A088CQ56	Enterobacteria_phage	91.4	3.2e-219
WP_069219636.1|3232060_3232294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069219637.1|3232293_3232482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069219638.1|3232462_3232924_+|head	head DNA stabilization protein	head	A5VW70	Enterobacteria_phage	88.9	7.8e-75
WP_069219639.1|3232933_3234352_+	hypothetical protein	NA	I1TEJ1	Salmonella_phage	88.1	1.9e-252
WP_069219640.1|3234351_3235221_+	hypothetical protein	NA	Q716G6	Shigella_phage	68.2	5.8e-79
WP_069219641.1|3235223_3235595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069219642.1|3235591_3236188_+	hypothetical protein	NA	A0A0A0P253	Enterobacteria_phage	43.9	2.7e-27
WP_155761573.1|3236201_3237518_+	DNA injection protein	NA	Q9AYZ0	Salmonella_phage	54.1	7.9e-96
WP_069219760.1|3237700_3239461_+	injection protein	NA	A0A2I7QQN9	Vibrio_phage	38.9	7.1e-100
WP_069219643.1|3239478_3239790_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081328891.1|3240403_3241072_+	Bro-N domain-containing protein	NA	H6WRU8	Salmonella_phage	46.0	4.8e-33
WP_069219645.1|3241134_3241878_+	hypothetical protein	NA	A0A0P0ZDC0	Stx2-converting_phage	57.3	1.2e-61
WP_069219646.1|3241930_3242185_-	Arc family DNA-binding protein	NA	A0A088CPT2	Enterobacteria_phage	59.5	9.7e-19
WP_069219648.1|3244260_3245841_-	hypothetical protein	NA	B9UDL6	Salmonella_phage	30.0	1.3e-44
WP_069219649.1|3245837_3246755_-	glycosyltransferase family 2 protein	NA	U5P087	Shigella_phage	88.5	4.0e-155
WP_069219650.1|3246751_3247114_-	GtrA family protein	NA	U5P0S6	Shigella_phage	82.5	2.0e-49
3247405:3247428	attR	TATTTTGAACAAACCTTCATGGGC	NA	NA	NA	NA
>prophage 231
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	3263848	3264610	5096586		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_046671111.1|3263848_3264610_-	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	31.1	7.5e-14
>prophage 232
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	3278681	3282688	5096586	transposase	Enterobacteria_phage(50.0%)	4	NA	NA
WP_003020862.1|3278681_3279413_-	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	50.3	2.4e-54
WP_003020858.1|3279616_3280846_-	diguanylate phosphodiesterase	NA	NA	NA	NA	NA
WP_003020856.1|3281163_3281400_+	two-component-system connector protein YcgZ	NA	NA	NA	NA	NA
WP_085950818.1|3281567_3282688_-|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
>prophage 233
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	3296330	3299941	5096586	transposase	Stx2-converting_phage(50.0%)	4	NA	NA
WP_004189163.1|3296330_3296771_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	60.3	2.6e-19
WP_004189161.1|3296767_3297118_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	63.8	5.2e-39
WP_004902302.1|3297148_3298741_+|transposase	IS66-like element ISKox1 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.8	3.2e-176
WP_155761574.1|3298924_3299941_-|transposase	IS5 family transposase	transposase	Q38213	Escherichia_phage	98.8	1.2e-184
>prophage 234
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	3312429	3313623	5096586		Pseudomonas_phage(100.0%)	1	NA	NA
WP_001515215.1|3312429_3313623_-	DUF4102 domain-containing protein	NA	A0A1B0VMI6	Pseudomonas_phage	39.1	2.9e-73
>prophage 235
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	3318272	3324012	5096586		Klosneuvirus(33.33%)	4	NA	NA
WP_086529289.1|3318272_3319658_+	diaminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.2	3.3e-28
WP_046671099.1|3319673_3321137_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_003020797.1|3321257_3322940_-	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	22.5	1.3e-21
WP_001518537.1|3323064_3324012_-	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	8.6e-44
>prophage 236
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	3327259	3331266	5096586		Pseudomonas_phage(50.0%)	5	NA	NA
WP_003020786.1|3327259_3328342_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	38.8	4.3e-07
WP_016150354.1|3328341_3329175_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_003020779.1|3329171_3329564_+	SirB family protein	NA	NA	NA	NA	NA
WP_003020775.1|3329566_3330376_+	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_003020772.1|3330411_3331266_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	38.8	2.4e-45
>prophage 237
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	3344488	3354729	5096586		Escherichia_phage(25.0%)	10	NA	NA
WP_003020747.1|3344488_3346027_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	40.5	1.8e-19
WP_003020745.1|3346023_3346734_+	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_003020743.1|3346733_3347411_+	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_003020737.1|3348357_3349200_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	48.8	9.8e-15
WP_003020734.1|3349255_3349711_-	YchJ family protein	NA	NA	NA	NA	NA
WP_003020732.1|3349822_3350734_+	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_003020729.1|3350824_3351838_+	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_003020727.1|3352042_3352951_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.5	3.7e-60
WP_003020723.1|3353087_3353501_-	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_003020720.1|3354111_3354729_+	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	54.3	8.6e-53
>prophage 238
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	3363159	3366056	5096586		Planktothrix_phage(33.33%)	3	NA	NA
WP_003833364.1|3363159_3364173_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppD	NA	G9BWD6	Planktothrix_phage	29.4	4.5e-14
WP_003020696.1|3364169_3365174_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	30.2	6.8e-15
WP_003020693.1|3365219_3366056_+	ion transporter	NA	A0A1B0Y2S3	Lactobacillus_phage	40.0	1.4e-08
>prophage 239
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	3378571	3381529	5096586		Acinetobacter_phage(100.0%)	2	NA	NA
WP_046671246.1|3378571_3379930_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	41.2	7.8e-38
WP_069219661.1|3379933_3381529_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.6	3.2e-51
>prophage 240
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	3386497	3391885	5096586	protease	Chrysochromulina_ericina_virus(50.0%)	4	NA	NA
WP_003843987.1|3386497_3387259_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.7	3.0e-07
WP_003843986.1|3387480_3388527_+|protease	protease SohB	protease	NA	NA	NA	NA
WP_003020616.1|3388637_3388889_-	YciN family protein	NA	NA	NA	NA	NA
WP_003840713.1|3389287_3391885_+	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	34.7	2.5e-85
>prophage 241
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	3396729	3397320	5096586		Staphylococcus_phage(100.0%)	1	NA	NA
WP_003020601.1|3396729_3397320_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.4	7.7e-43
>prophage 242
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	3405224	3407159	5096586		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_046670765.1|3405224_3407159_-	exoribonuclease II	NA	A0A2H4UVB7	Bodo_saltans_virus	24.5	5.9e-07
>prophage 243
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	3410549	3412350	5096586		Bacillus_virus(50.0%)	2	NA	NA
WP_003020558.1|3410549_3411356_-	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	27.4	1.3e-13
WP_003020556.1|3411357_3412350_-	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	24.7	4.7e-08
>prophage 244
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	3430308	3431391	5096586		Planktothrix_phage(100.0%)	1	NA	NA
WP_069219663.1|3430308_3431391_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.7	7.3e-23
>prophage 245
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	3443739	3445696	5096586		Escherichia_phage(50.0%)	3	NA	NA
WP_046670748.1|3443739_3444510_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	29.1	5.1e-18
WP_046670747.1|3444630_3445014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003843945.1|3445186_3445696_+	zinc-binding dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	42.9	2.1e-28
>prophage 246
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	3449366	3461857	5096586	tRNA	Streptococcus_phage(12.5%)	11	NA	NA
WP_003840811.1|3449366_3449882_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	54.5	1.2e-23
WP_003843940.1|3450107_3450671_+	DNA endonuclease SmrA	NA	NA	NA	NA	NA
WP_003843938.1|3450683_3451916_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	34.4	9.0e-17
WP_046670743.1|3451983_3454098_-	bifunctional diguanylate cyclase/phosphodiesterase	NA	G3MA91	Bacillus_virus	31.0	3.4e-16
WP_016150306.1|3454509_3455619_+	hypothetical protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	23.0	2.8e-09
WP_003020379.1|3455771_3456755_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_046670742.1|3457227_3458601_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	5.1e-53
WP_046670740.1|3458694_3459630_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	93.8	1.4e-139
WP_069219664.1|3459828_3460263_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	51.4	3.6e-29
WP_003020366.1|3460344_3460557_-	KTSC domain-containing protein	NA	NA	NA	NA	NA
WP_069219665.1|3460702_3461857_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	56.7	1.5e-114
>prophage 247
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	3466835	3467825	5096586		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_003020354.1|3466835_3467825_-	2-hydroxyacid dehydrogenase	NA	M1HMI7	Paramecium_bursaria_Chlorella_virus	42.8	3.3e-70
>prophage 248
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	3472766	3476669	5096586		Klosneuvirus(100.0%)	1	NA	NA
WP_046670738.1|3472766_3476669_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.7	7.6e-54
>prophage 249
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	3481471	3483865	5096586		Escherichia_phage(33.33%)	3	NA	NA
WP_044700084.1|3481471_3482002_+	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	1.4e-19
WP_003020321.1|3482174_3482594_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	58.5	3.9e-33
WP_046670733.1|3482596_3483865_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	77.9	2.9e-196
>prophage 250
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	3490619	3493596	5096586		Synechococcus_phage(50.0%)	2	NA	NA
WP_003020293.1|3490619_3491738_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.6	3.6e-33
WP_069219666.1|3491907_3493596_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	28.2	1.4e-15
>prophage 251
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	3515453	3517415	5096586		Phage_TP(100.0%)	1	NA	NA
WP_044710814.1|3515453_3517415_+	U32 family peptidase	NA	Q6DW11	Phage_TP	27.8	1.6e-23
>prophage 252
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	3520863	3525289	5096586		Cronobacter_phage(50.0%)	4	NA	NA
WP_123924900.1|3520863_3521280_+	type II toxin-antitoxin system HicB family antitoxin	NA	F1C593	Cronobacter_phage	55.6	6.9e-30
WP_046670716.1|3521372_3522782_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_003020212.1|3523110_3524256_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003020210.1|3524272_3525289_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	58.9	2.5e-25
>prophage 253
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	3546046	3547588	5096586		Salmonella_phage(100.0%)	1	NA	NA
WP_046670710.1|3546046_3547588_-	methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	52.6	8.3e-36
>prophage 254
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	3553938	3554712	5096586		Bacillus_virus(100.0%)	1	NA	NA
WP_003836184.1|3553938_3554712_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.0	1.7e-18
>prophage 255
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	3565100	3566645	5096586		Escherichia_phage(100.0%)	1	NA	NA
WP_003020103.1|3565100_3566645_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.5	1.1e-19
>prophage 256
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	3574735	3575818	5096586		Enterobacteria_phage(100.0%)	1	NA	NA
WP_003836220.1|3574735_3575818_-	porin OmpD	NA	Q1MVN1	Enterobacteria_phage	70.4	4.2e-143
>prophage 257
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	3582171	3584569	5096586		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_032935729.1|3582171_3582774_+	inorganic diphosphatase	NA	A0A1B1ISK6	uncultured_Mediterranean_phage	39.1	2.6e-22
WP_069219670.1|3582853_3584569_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	25.5	1.3e-37
>prophage 258
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	3594364	3596279	5096586		Planktothrix_phage(100.0%)	2	NA	NA
WP_046670686.1|3594364_3595300_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	27.8	9.2e-14
WP_003020012.1|3595292_3596279_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.5	7.2e-17
>prophage 259
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	3602168	3604112	5096586		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_069219672.1|3602168_3604112_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	32.8	1.0e-11
>prophage 260
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	3609569	3611309	5096586		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_069219673.1|3609569_3611309_-	type I secretion system permease/ATPase	NA	F2Y1V6	Organic_Lake_phycodnavirus	29.8	7.7e-14
>prophage 261
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	3625671	3626475	5096586		Streptococcus_phage(100.0%)	1	NA	NA
WP_000619352.1|3625671_3626475_+	TIGR02391 family protein	NA	A0A1S5SBU1	Streptococcus_phage	36.0	2.6e-33
>prophage 262
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	3649328	3658818	5096586	transposase	Escherichia_phage(33.33%)	6	NA	NA
WP_001118619.1|3649328_3650252_-|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	100.0	2.2e-177
WP_024223630.1|3650384_3651551_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_000998254.1|3652103_3653627_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	38.7	8.3e-89
WP_000248952.1|3653616_3654801_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_000779017.1|3654797_3655481_+	YecA family protein	NA	NA	NA	NA	NA
WP_001077330.1|3655533_3658818_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	27.0	8.1e-65
>prophage 263
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	3664071	3724627	5096586	integrase,protease,transposase	Escherichia_phage(21.43%)	58	3649328:3649387	3668117:3669118
3649328:3649387	attL	TTCAGGCAATACGCACGCTTTCAGGCATACCTGCTTTCGTCATTTTGTTCAGCGCTCGTA	NA	NA	NA	NA
WP_000169430.1|3664071_3665742_-|integrase	integrase	integrase	NA	NA	NA	NA
WP_069219678.1|3665704_3667147_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_001118619.1|3667251_3668175_+|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	100.0	2.2e-177
WP_016150236.1|3668517_3669051_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003836295.1|3669161_3669920_+	trans-aconitate 2-methyltransferase	NA	NA	NA	NA	NA
3668117:3669118	attR	TACGAGCGCTGAACAAAATGACGAAAGCAGGTATGCCTGAAAGCGTGCGTATTGCCTGAAAACACAACCCGCTACGGGGGAGACTTACCCGAAATCTGATTTATTCAACAAAGCCATCATCAACTATGAGATGAGTTCTCTGGTTGTTCCTCGATAAATGTAAGATGGTATATGCCATGAACTTAGCGGATGCCCCGTAATTTTTGTGTTATGAAGTCATCGTAAGTCCACAACTAAACTTTGGCAACTGACTGATTCATCGGTAAGTTCCTGAAAGAGAGGGACTCATGAACTTAAGAGCAAACCCACCATATTTAACATAATATACATTATGCGCACTTAGATGGAGTAAGAAAGAACCTGTGTTTTTTTGGTCGTCCTTGTGCAGCTGAAACATAGTGTTAAACGGCGCTGCTGCGTATCAGACGATACAGAACATGTTGTGCTAATCGATGATCTGGCGGCAACGCGGGATGCACAAACTCTTCTGCTTTACTCATGCCAAGGCGTATCATCAGGTTCTCAGACGGTTTGTTCAGCACCGAAGTAAAAGAAACCACCTCAGTTAACGCCAGTTCCTCGAAAGCAAAAGTCAGGCAGGCTTCAGCAGCTTCCAATGCAAACCCCTGATGCCAGAATGATTTCGCAAGACGCCAGCCTATTTCAGTACAGGGTGAAAAATGAAACTTATCAGGTTGTGGATGTAAACCTACGCAGCCCACAAACTGGTGTGTTTCTTGTAGTTCAACGGCCCAAAATCCCCAGCCGCGCTCTGTAATGCCTTCCTGGAATCTTGCGGCAAGATTGTCGCTTTCCGTCCGTAGCAATGGAGCCGGAAAAAAACGCATCACATCGGAATCGGTATTTAACGCGGCGAATGGCGCTCTGTCTTTCGCTTCCCACTGACGGAGAATCAGTCTCGATGTTTCCAGCATAAATCTGCCCTTATCATTCATTTTCATATAATCTTCTAAAAGAAGCTGCTCATCGGCAAGGACTAAT	NA	NA	NA	NA
WP_003836296.1|3670051_3670429_+	GFA family protein	NA	NA	NA	NA	NA
WP_046670674.1|3670425_3671340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046670673.1|3671555_3673007_-	tagaturonate reductase	NA	NA	NA	NA	NA
WP_003843635.1|3673113_3673641_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003836300.1|3673721_3674081_-	DUF4186 domain-containing protein	NA	NA	NA	NA	NA
WP_003032436.1|3674080_3675007_-	glutaminase B	NA	NA	NA	NA	NA
WP_046670672.1|3675069_3676647_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_046670670.1|3676750_3678139_-	succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_003032431.1|3678242_3679118_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_046670669.1|3679340_3680537_+	sugar transporter	NA	NA	NA	NA	NA
WP_003032428.1|3680573_3681239_-	MarC family NAAT transporter	NA	NA	NA	NA	NA
WP_003032426.1|3681496_3681931_+	multiple antibiotic resistance transcriptional regulator MarR	NA	NA	NA	NA	NA
WP_003032424.1|3681949_3682333_+	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	3.6e-09
WP_003032422.1|3682363_3682582_+	multiple antibiotic resistance protein MarB	NA	NA	NA	NA	NA
WP_016150229.1|3683306_3684206_-	O-acetylserine/cysteine exporter	NA	NA	NA	NA	NA
WP_046670667.1|3684404_3685592_+	efflux MFS transporter YdeE	NA	NA	NA	NA	NA
WP_003032416.1|3685635_3686334_-	urea ABC transporter ATP-binding subunit UrtE	NA	A0A2H4PQG7	Staphylococcus_phage	25.6	2.6e-13
WP_032935768.1|3686343_3687141_-	urea ABC transporter ATP-binding protein UrtD	NA	A0A285PWH2	Cedratvirus	27.5	2.1e-11
WP_046670665.1|3687140_3688214_-	urea ABC transporter permease subunit UrtC	NA	NA	NA	NA	NA
WP_046670663.1|3688213_3689788_-	urea ABC transporter permease subunit UrtB	NA	NA	NA	NA	NA
WP_003032408.1|3689831_3691103_-	urea ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003032406.1|3691589_3691685_+	protein MgtS	NA	NA	NA	NA	NA
WP_003836309.1|3691968_3692895_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.0	4.2e-19
WP_003836310.1|3693092_3693311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155761576.1|3693541_3694748_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	62.5	1.7e-100
WP_152659859.1|3694951_3696994_-	peptidyl-dipeptidase Dcp	NA	NA	NA	NA	NA
WP_003032398.1|3697134_3697881_+	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
WP_003032396.1|3697967_3698654_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003032393.1|3698845_3699049_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	2.9e-13
WP_046670659.1|3699124_3700591_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	32.2	2.4e-45
WP_003836325.1|3700754_3702089_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_046670658.1|3702149_3703364_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.7	5.7e-48
WP_003032384.1|3703471_3703798_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	54.9	2.2e-23
WP_003032382.1|3703951_3704293_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_003032379.1|3704328_3704889_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_003843601.1|3704896_3705607_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_085954018.1|3705709_3706018_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_003843596.1|3708649_3709267_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.1	2.1e-75
WP_046670656.1|3709268_3710123_+	dimethylsulfoxide reductase	NA	NA	NA	NA	NA
WP_003028918.1|3710165_3710780_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.0	4.0e-26
WP_032941314.1|3710899_3712189_+	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_003028922.1|3712144_3712840_-	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_003028923.1|3712965_3714186_-	ROK family transcriptional regulator	NA	NA	NA	NA	NA
WP_003836337.1|3714304_3715213_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003028925.1|3715320_3716574_+	MFS transporter	NA	NA	NA	NA	NA
WP_046670654.1|3716604_3717294_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_046670653.1|3717437_3718928_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	30.3	3.1e-24
WP_003028928.1|3718924_3719647_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.6	1.1e-35
WP_046670651.1|3719836_3720841_+	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_016150213.1|3720840_3721467_+	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_046670650.1|3721514_3723002_+	carboxypeptidase M32	NA	NA	NA	NA	NA
WP_003028934.1|3723139_3723535_+	acid resistance repetitive basic protein Asr	NA	NA	NA	NA	NA
WP_046670649.1|3723805_3724627_+|protease	serine protease	protease	NA	NA	NA	NA
>prophage 264
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	3740775	3742077	5096586		Bacillus_phage(100.0%)	1	NA	NA
WP_046670790.1|3740775_3742077_+	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	23.8	6.8e-15
>prophage 265
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	3767188	3768463	5096586	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_003029168.1|3767188_3768463_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	42.6	6.5e-87
>prophage 266
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	3775381	3775906	5096586		Salmonella_phage(100.0%)	1	NA	NA
WP_003029187.1|3775381_3775906_-	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	55.7	1.7e-46
>prophage 267
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	3781008	3792050	5096586		Streptomyces_phage(16.67%)	11	NA	NA
WP_046670631.1|3781008_3781839_+	C40 family peptidase	NA	A0A2H5BM69	Streptomyces_phage	41.6	3.2e-18
WP_003029205.1|3781966_3782548_+	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	46.0	3.4e-43
WP_003029207.1|3782587_3783757_-	MFS transporter	NA	NA	NA	NA	NA
WP_003029209.1|3783932_3784022_-	stress response protein YnhF	NA	NA	NA	NA	NA
WP_003029211.1|3784319_3785345_+	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.3	8.2e-32
WP_003029215.1|3785341_3786274_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003836456.1|3786387_3787593_+	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_044699909.1|3787883_3789032_+	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	44.9	1.6e-84
WP_003832752.1|3789073_3789721_-	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	37.3	1.2e-23
WP_003836464.1|3789938_3791312_+	multidrug efflux MATE transporter MdtK	NA	NA	NA	NA	NA
WP_046670628.1|3791351_3792050_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	29.4	8.7e-09
>prophage 268
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	3798669	3805464	5096586	tRNA	Bacillus_phage(50.0%)	6	NA	NA
WP_046670622.1|3798669_3799152_+	glutathione peroxidase	NA	Q6VZR0	Canarypox_virus	40.7	6.6e-24
WP_046670621.1|3799317_3800427_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_003836481.1|3800546_3802331_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	35.0	2.8e-19
WP_046670620.1|3802532_3803537_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003029256.1|3803957_3804704_-	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	32.4	1.5e-06
WP_003836487.1|3804774_3805464_-	YafY family transcriptional regulator	NA	A0A1B0RXM1	Streptococcus_phage	29.1	3.1e-11
>prophage 269
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	3816407	3822228	5096586		Tupanvirus(33.33%)	5	NA	NA
WP_046670615.1|3816407_3817160_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	30.8	6.7e-07
WP_003029283.1|3817156_3818161_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_046670612.1|3818147_3819203_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016150167.1|3819383_3820646_-	4-aminobutyrate transaminase	NA	A0A1V0SKB7	Klosneuvirus	25.4	4.7e-21
WP_046670611.1|3820752_3822228_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	27.8	6.9e-16
>prophage 270
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	3832161	3836708	5096586		Planktothrix_phage(33.33%)	6	NA	NA
WP_044712312.1|3832161_3832980_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	43.6	2.3e-37
WP_046670606.1|3832979_3833765_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003029326.1|3833754_3834432_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_032947969.1|3834441_3835254_-	hypothetical protein	NA	A0A077K9W7	Edwardsiella_phage	32.5	6.8e-05
WP_046670604.1|3835257_3836043_-	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
WP_046670786.1|3836039_3836708_-	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	37.8	4.1e-24
>prophage 271
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	3843582	3855185	5096586	transposase	Escherichia_phage(40.0%)	9	NA	NA
WP_085951548.1|3843582_3844335_+	tetrathionate reductase subunit TtrB	NA	A0A077SL61	Escherichia_phage	40.0	8.7e-23
WP_069219683.1|3844335_3845358_+	tetrathionate reductase subunit TtrC	NA	NA	NA	NA	NA
WP_046670598.1|3845350_3848416_+	tetrathionate reductase subunit TtrA	NA	A0A077SK27	Escherichia_phage	26.0	4.7e-06
WP_094487604.1|3849394_3850602_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	62.9	5.7e-101
WP_003843488.1|3851105_3852074_+	hypothetical protein	NA	A0A2H4J6N0	uncultured_Caudovirales_phage	25.2	2.7e-16
WP_046670596.1|3852042_3852459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003029358.1|3852667_3853480_-	methionine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003029361.1|3853501_3854170_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_046670595.1|3854162_3855185_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.4	3.8e-13
>prophage 272
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	3863973	3869064	5096586		environmental_halophage(33.33%)	5	NA	NA
WP_046670591.1|3863973_3865194_-	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	42.6	5.6e-96
WP_003836582.1|3865190_3866462_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_003029383.1|3866436_3867183_-	Fe-S cluster assembly ATPase SufC	NA	A0A1V0SE00	Indivirus	25.0	3.0e-07
WP_003029384.1|3867199_3868687_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_003029385.1|3868695_3869064_-	Fe-S cluster assembly scaffold SufA	NA	A0A2H4N7N5	Lake_Baikal_phage	39.4	5.6e-15
>prophage 273
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	3889537	3895955	5096586		Staphylococcus_phage(33.33%)	4	NA	NA
WP_046670582.1|3889537_3891175_+	medium-chain fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	29.9	9.1e-33
WP_032935925.1|3891242_3893621_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.3	3.9e-170
WP_003030553.1|3893948_3894782_+	posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR	NA	NA	NA	NA	NA
WP_003030555.1|3894908_3895955_+	3-deoxy-7-phosphoheptulonate synthase AroH	NA	A0A0B5IW14	Pandoravirus	47.1	8.8e-82
>prophage 274
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	3901253	3914841	5096586	tRNA	Tupanvirus(22.22%)	15	NA	NA
WP_046670579.1|3901253_3902033_+	heme ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	26.8	1.3e-10
WP_003843460.1|3902029_3903472_-	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	35.3	7.7e-52
WP_003836643.1|3903533_3904247_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_003836644.1|3904563_3905028_-	lipoprotein nlpC	NA	A0A1V0DZX6	Clostridioides_phage	38.2	3.5e-14
WP_003030567.1|3905105_3905855_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	30.3	9.3e-09
WP_003030569.1|3905854_3906406_-	glutathione peroxidase	NA	NA	NA	NA	NA
WP_003832584.1|3906466_3907447_-	vitamin B12 ABC transporter permease BtuC	NA	A0A2H4IY97	uncultured_Caudovirales_phage	24.8	6.7e-15
WP_003030571.1|3907600_3907900_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_003030574.1|3907904_3910292_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_003832580.1|3910307_3911291_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.4e-33
WP_152659856.1|3911490_3911622_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_003030578.1|3911660_3912017_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_003030583.1|3912072_3912270_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_048997935.1|3912366_3912909_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	8.2e-15
WP_003832572.1|3912912_3914841_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.8	4.4e-127
>prophage 275
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	3920108	3925858	5096586		Trichoplusia_ni_ascovirus(33.33%)	5	NA	NA
WP_046670573.1|3920108_3920870_+	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.1	3.1e-20
WP_085951595.1|3920953_3921553_+	metal-dependent hydrolase	NA	A0A127AVX7	Bacillus_phage	34.3	7.7e-06
WP_003840905.1|3921688_3923080_+	L-cystine transporter	NA	NA	NA	NA	NA
WP_080602219.1|3923143_3923398_-	cell division activator CedA	NA	NA	NA	NA	NA
WP_069219685.1|3923599_3925858_+	catalase HPII	NA	A0A2K9L572	Tupanvirus	47.6	1.7e-138
>prophage 276
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	3932006	3932837	5096586		Bacillus_virus(100.0%)	1	NA	NA
WP_032936096.1|3932006_3932837_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.9	2.0e-73
>prophage 277
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	3940383	3941604	5096586		Klosneuvirus(100.0%)	1	NA	NA
WP_003840894.1|3940383_3941604_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	28.6	4.2e-27
>prophage 278
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	3951460	3953407	5096586		Streptococcus_phage(100.0%)	1	NA	NA
WP_003030667.1|3951460_3953407_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.7	5.3e-40
>prophage 279
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	3958235	3962295	5096586		Tupanvirus(50.0%)	4	NA	NA
WP_155267879.1|3958235_3958880_+	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L6K4	Tupanvirus	37.2	9.4e-18
WP_003840879.1|3958917_3960276_-	MFS transporter	NA	NA	NA	NA	NA
WP_003030679.1|3960416_3961175_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_044700027.1|3961311_3962295_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	23.4	7.4e-06
>prophage 280
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	3967957	3969211	5096586		Tupanvirus(100.0%)	1	NA	NA
WP_046670558.1|3967957_3969211_+	glycoside hydrolase family 18 protein	NA	A0A2K9L3D4	Tupanvirus	30.7	4.1e-25
>prophage 281
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	3977176	3978460	5096586		Bacillus_phage(100.0%)	1	NA	NA
WP_003030708.1|3977176_3978460_+	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	26.6	1.9e-09
>prophage 282
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	3985854	3986880	5096586		Bacillus_virus(100.0%)	1	NA	NA
WP_046670551.1|3985854_3986880_+	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	26.3	1.8e-10
>prophage 283
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	4005476	4072262	5096586	head,integrase,tail,capsid,holin,tRNA,portal,terminase	Klebsiella_phage(26.92%)	83	4038237:4038251	4074394:4074408
WP_134215802.1|4005476_4005689_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	88.9	7.8e-22
WP_046670544.1|4005932_4006358_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	5.6e-51
WP_046670543.1|4006370_4007660_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	70.7	4.2e-166
WP_003030762.1|4007704_4008025_-	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	44.8	3.2e-19
WP_061549503.1|4008110_4008809_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	67.7	3.8e-89
WP_003840850.1|4009196_4009439_+	DinI family protein	NA	Q6UAW0	Klebsiella_phage	77.9	1.5e-29
WP_003030767.1|4009613_4010123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003030769.1|4010257_4011508_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	94.4	9.4e-22
WP_046670541.1|4011710_4012328_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_052946586.1|4012362_4013295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046670539.1|4013304_4013766_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_003832402.1|4013819_4014926_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_003841885.1|4014960_4015602_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_044711951.1|4015605_4016976_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.3	2.5e-108
WP_044702837.1|4017412_4018081_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.8	1.3e-81
WP_044702835.1|4018385_4018622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046670535.1|4018804_4019764_-	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_044700520.1|4019777_4020308_-	DUF3833 domain-containing protein	NA	NA	NA	NA	NA
WP_044700522.1|4020304_4020832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044700524.1|4020828_4021314_-	DUF2878 domain-containing protein	NA	NA	NA	NA	NA
WP_044700526.1|4021310_4022531_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_044700528.1|4022527_4023250_-	DUF1365 domain-containing protein	NA	NA	NA	NA	NA
WP_069219687.1|4023251_4024508_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_044700533.1|4024504_4025224_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_044700535.1|4025220_4025655_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_044700539.1|4025858_4026587_-	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	44.8	7.8e-45
WP_044700540.1|4026822_4027407_-	DUF4376 domain-containing protein	NA	Q7BQC6	Enterobacteria_phage	47.9	1.1e-46
WP_046670531.1|4029403_4032805_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	70.4	0.0e+00
WP_071681833.1|4032877_4033555_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	71.1	2.0e-71
WP_069219688.1|4033452_4034187_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	77.9	3.2e-115
WP_046670530.1|4034198_4034894_-|tail	phage minor tail protein L	tail	Q687F1	Enterobacteria_phage	71.0	1.0e-94
WP_044700550.1|4034902_4035235_-|tail	tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	67.0	2.0e-40
WP_044700552.1|4035235_4038526_-|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	65.3	0.0e+00
4038237:4038251	attL	CCGGTGATAGCCTGC	NA	NA	NA	NA
WP_044700554.1|4038773_4039136_-|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	56.8	2.5e-28
WP_044700555.1|4039198_4039681_-|tail	major tail shaft subunit	tail	Q6UAX0	Klebsiella_phage	81.2	4.7e-62
WP_044700558.1|4039714_4040116_-	hypothetical protein	NA	Q6UAX1	Klebsiella_phage	85.0	1.1e-56
WP_046670528.1|4040112_4040502_-	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	63.7	4.3e-42
WP_044700562.1|4040470_4040821_-|head	phage head closure protein	head	Q6UAX3	Klebsiella_phage	73.9	1.6e-43
WP_003832371.1|4040817_4041135_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6UAX4	Klebsiella_phage	79.6	2.8e-39
WP_044700565.1|4041115_4041493_-	hypothetical protein	NA	Q6UAX5	Klebsiella_phage	59.5	3.2e-18
WP_044700568.1|4041590_4042877_-|capsid	phage major capsid protein	capsid	Q6UAX6	Klebsiella_phage	87.6	8.0e-210
WP_044700569.1|4042949_4043870_-	S49 family peptidase	NA	Q6UAX7	Klebsiella_phage	79.7	6.0e-135
WP_044700572.1|4043906_4045166_-|portal	phage portal protein	portal	Q6UAX8	Klebsiella_phage	89.0	7.1e-219
WP_003832363.1|4045165_4045345_-	hypothetical protein	NA	Q6UAX9	Klebsiella_phage	71.2	3.3e-13
WP_016150031.1|4045338_4047066_-|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	92.8	0.0e+00
WP_003832359.1|4047062_4047560_-|terminase	phage terminase small subunit P27 family	terminase	Q8HAD7	Salmonella_phage	93.9	1.3e-83
WP_047715729.1|4047793_4048156_-	HNH endonuclease	NA	Q6UAS2	Klebsiella_phage	86.7	3.7e-56
WP_044700576.1|4048431_4048971_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	79.0	6.4e-44
WP_001100119.1|4049343_4049517_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000756041.1|4049721_4049952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057069020.1|4050025_4050214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000066494.1|4050224_4050437_-	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	72.9	4.6e-22
WP_079938067.1|4050815_4050971_-	DUF2514 family protein	NA	NA	NA	NA	NA
WP_044700634.1|4051008_4051206_-	hypothetical protein	NA	K7PHC3	Enterobacterial_phage	90.8	3.7e-26
WP_000990801.1|4051596_4051827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088169141.1|4051823_4052357_-	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
WP_046670524.1|4052335_4052884_-	lysozyme	NA	K7PM52	Enterobacteria_phage	94.5	2.1e-98
WP_003832349.1|4052855_4053134_-|holin	holin	holin	K7P6H9	Enterobacteria_phage	100.0	3.9e-45
WP_044700587.1|4053287_4053476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080941995.1|4053578_4053995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044700635.1|4054747_4055362_-	hypothetical protein	NA	H9C175	Pectobacterium_phage	76.9	1.0e-85
WP_046670521.1|4055375_4056416_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	49.7	1.3e-96
WP_044700591.1|4056412_4056772_-	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	65.3	1.4e-42
WP_044700593.1|4056774_4056975_-	hypothetical protein	NA	H6WRY8	Salmonella_phage	60.0	1.2e-16
WP_071681812.1|4057104_4057350_-	hypothetical protein	NA	H6WRY6	Salmonella_phage	63.0	2.9e-20
WP_044700595.1|4057395_4057629_-	DinI family protein	NA	K7PM44	Enterobacteria_phage	83.1	6.0e-31
WP_044700597.1|4057915_4059007_-	permease	NA	NA	NA	NA	NA
WP_038641364.1|4059107_4059404_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_038641366.1|4059471_4059897_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	4.3e-51
WP_038641369.1|4059909_4061199_-	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.8	9.6e-171
WP_044700601.1|4061245_4062997_-	arsenite efflux transporter ATPase subunit ArsA	NA	NA	NA	NA	NA
WP_038641374.1|4063014_4063377_-	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_044700602.1|4063424_4063778_-	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	51.9	4.8e-24
WP_122984015.1|4063901_4064447_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	77.5	3.2e-67
WP_122984016.1|4064358_4065474_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	54.0	8.9e-48
WP_044700607.1|4065522_4066077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003832309.1|4066080_4066293_-	helix-turn-helix transcriptional regulator	NA	A0A077K9X2	Edwardsiella_phage	59.7	3.8e-16
WP_003832307.1|4066398_4066779_+	helix-turn-helix domain-containing protein	NA	K7PH71	Enterobacterial_phage	66.7	6.5e-19
WP_044700608.1|4067115_4067382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046670777.1|4067754_4068081_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_052946585.1|4068222_4070694_+	exonuclease	NA	K7P6V4	Enterobacteria_phage	38.8	6.0e-113
WP_032943036.1|4070760_4070976_+	hypothetical protein	NA	A0A0U2RY08	Escherichia_phage	56.3	5.7e-20
WP_044700610.1|4070975_4072262_+|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	50.4	5.5e-110
4074394:4074408	attR	CCGGTGATAGCCTGC	NA	NA	NA	NA
>prophage 284
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	4077263	4084974	5096586		Mycoplasma_phage(50.0%)	8	NA	NA
WP_069219689.1|4077263_4078400_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	40.3	7.2e-29
WP_046670510.1|4078383_4079241_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	25.8	4.3e-10
WP_003030794.1|4079237_4080017_+	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_003030797.1|4080044_4081091_+	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_003030799.1|4081190_4082012_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	36.1	3.3e-23
WP_003030802.1|4082027_4082939_-	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_003030804.1|4083028_4084273_-	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_003030805.1|4084272_4084974_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.3	4.9e-36
>prophage 285
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	4092257	4092515	5096586		Erwinia_phage(100.0%)	1	NA	NA
WP_003030810.1|4092257_4092515_-	DUF1471 domain-containing protein	NA	A0A1B2IFR9	Erwinia_phage	35.7	2.8e-05
>prophage 286
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	4131729	4133454	5096586		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_046670482.1|4131729_4132686_+	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	27.0	4.1e-17
WP_046670480.1|4132686_4133454_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.9	1.4e-12
>prophage 287
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	4138567	4144579	5096586		Acinetobacter_phage(33.33%)	5	NA	NA
WP_046670476.1|4138567_4140346_+	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	33.4	1.4e-79
WP_003036277.1|4140401_4141835_-	PTS glucose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_003036276.1|4142128_4142926_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_046670474.1|4142936_4143941_-	DNA polymerase III subunit delta'	NA	A0A1V0DYC6	Dinoroseobacter_phage	34.8	1.1e-07
WP_003036268.1|4143937_4144579_-	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	38.2	1.3e-27
>prophage 288
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	4147865	4148992	5096586		Ralstonia_phage(50.0%)	2	NA	NA
WP_000103754.1|4147865_4148102_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
WP_003036255.1|4148257_4148992_-	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	7.7e-16
>prophage 289
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	4163731	4164682	5096586		Brevibacillus_phage(100.0%)	1	NA	NA
WP_032936209.1|4163731_4164682_-	flagellar assembly peptidoglycan hydrolase FlgJ	NA	S5M633	Brevibacillus_phage	30.9	1.6e-10
>prophage 290
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	4179918	4180164	5096586		Enterobacteria_phage(100.0%)	1	NA	NA
WP_003036157.1|4179918_4180164_+	DNA damage-inducible protein I	NA	K7PM44	Enterobacteria_phage	50.0	1.1e-14
>prophage 291
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	4184882	4188664	5096586		Morganella_phage(50.0%)	3	NA	NA
WP_003036136.1|4184882_4185803_+	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferasee	NA	A0A1W6JP29	Morganella_phage	41.6	1.0e-57
WP_046670460.1|4185958_4187179_+	multidrug efflux MFS transporter MdtG	NA	NA	NA	NA	NA
WP_069219698.1|4187242_4188664_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.7	2.2e-19
>prophage 292
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	4196880	4198832	5096586	transposase	Scale_drop_disease_virus(50.0%)	2	NA	NA
WP_046670455.1|4196880_4197423_-	O-acetyl-ADP-ribose deacetylase	NA	A0A0K1L687	Scale_drop_disease_virus	49.3	1.9e-27
WP_069219700.1|4197851_4198832_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	98.8	4.0e-185
>prophage 293
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	4202811	4206616	5096586		Pelagibacter_phage(50.0%)	5	NA	NA
WP_003036082.1|4202811_4203645_+	curli production assembly/transport protein CsgG	NA	M1ICK2	Pelagibacter_phage	39.7	3.0e-40
WP_008320293.1|4203691_4204174_-	DUF1097 domain-containing protein	NA	NA	NA	NA	NA
WP_046670454.1|4204275_4204830_-	molecular chaperone	NA	NA	NA	NA	NA
WP_003836800.1|4204853_4205591_-	phosphatase	NA	NA	NA	NA	NA
WP_046670453.1|4205677_4206616_-	glyoxylate/hydroxypyruvate reductase GhrA	NA	A0A1B1IVB5	uncultured_Mediterranean_phage	28.5	4.1e-06
>prophage 294
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	4211532	4212441	5096586		Cronobacter_phage(100.0%)	1	NA	NA
WP_086529159.1|4211532_4212441_-	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	77.1	6.9e-91
>prophage 295
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	4225221	4225395	5096586		Enterobacteria_phage(100.0%)	1	NA	NA
WP_003036022.1|4225221_4225395_-	general stress protein	NA	Q9KX95	Enterobacteria_phage	92.6	1.4e-05
>prophage 296
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	4230597	4231293	5096586		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_003836817.1|4230597_4231293_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	33.2	3.9e-17
>prophage 297
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	4244106	4245027	5096586		Klosneuvirus(100.0%)	1	NA	NA
WP_003035957.1|4244106_4245027_+	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	39.0	3.6e-10
>prophage 298
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	4252699	4253515	5096586		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_003846879.1|4252699_4253515_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.8	1.4e-13
>prophage 299
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	4258797	4259457	5096586	protease	uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_003035917.1|4258797_4259457_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	8.9e-48
>prophage 300
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	4263707	4265762	5096586		Bacillus_phage(100.0%)	1	NA	NA
WP_046671317.1|4263707_4265762_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	1.0e-20
>prophage 301
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	4278307	4280215	5096586		Tupanvirus(100.0%)	1	NA	NA
WP_003836846.1|4278307_4280215_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	28.4	2.1e-49
>prophage 302
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	4289106	4295595	5096586	tRNA	Bacillus_virus(33.33%)	4	NA	NA
WP_032936311.1|4289106_4289874_+	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.1	1.7e-29
WP_032936314.1|4289945_4292558_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	21.4	1.6e-18
WP_046671313.1|4292824_4294027_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_032936329.1|4294194_4295595_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	35.9	3.8e-80
>prophage 303
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	4299371	4299920	5096586		Rhodobacter_phage(100.0%)	1	NA	NA
WP_003035820.1|4299371_4299920_-	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	32.6	3.5e-05
>prophage 304
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	4314658	4319199	5096586		Bacillus_phage(100.0%)	3	NA	NA
WP_003035784.1|4314658_4316407_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	30.7	2.4e-60
WP_069219704.1|4316443_4318708_-	ComEC family protein	NA	NA	NA	NA	NA
WP_003035780.1|4318914_4319199_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	39.1	9.2e-10
>prophage 305
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	4324253	4325342	5096586		Streptococcus_phage(100.0%)	1	NA	NA
WP_003847007.1|4324253_4325342_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.2	5.9e-81
>prophage 306
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	4329466	4332675	5096586		Tetraselmis_virus(100.0%)	2	NA	NA
WP_003035753.1|4329466_4331749_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	42.0	3.8e-162
WP_003035751.1|4331934_4332675_+	pyruvate formate lyase-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	1.0e-20
>prophage 307
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	4337488	4354108	5096586	tRNA	Escherichia_phage(25.0%)	10	NA	NA
WP_003836904.1|4337488_4338106_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_069219705.1|4338116_4340561_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	50.6	7.8e-222
WP_003836908.1|4340797_4342090_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	46.1	2.5e-94
WP_003836910.1|4342182_4343526_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	4.3e-81
WP_003831898.1|4343536_4344148_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_069219706.1|4344259_4348360_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	49.2	2.9e-88
WP_002439523.1|4348494_4348989_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_003035727.1|4349536_4350505_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.3	1.9e-62
WP_046669942.1|4350619_4352386_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	25.6	1.4e-23
WP_016149854.1|4352386_4354108_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	23.6	1.8e-15
>prophage 308
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	4358755	4372135	5096586		Streptococcus_phage(20.0%)	15	NA	NA
WP_044701666.1|4358755_4359883_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.4	1.6e-28
WP_003035378.1|4359924_4360413_-	YbjO family protein	NA	NA	NA	NA	NA
WP_003035376.1|4360472_4361318_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_044701670.1|4361314_4362268_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_003035373.1|4362277_4363411_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.9	1.1e-29
WP_046669940.1|4363549_4364662_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_003035368.1|4365095_4365572_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_003836932.1|4365662_4366565_-	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.0	2.0e-37
WP_044701671.1|4366624_4367347_-	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_003845523.1|4367330_4367621_-	YbjC family protein	NA	NA	NA	NA	NA
WP_003035358.1|4367793_4368057_+	glutaredoxin, GrxA family	NA	A0A2I7SAE2	Vibrio_phage	67.9	3.8e-26
WP_003035356.1|4368091_4368472_-	membrane protein	NA	NA	NA	NA	NA
WP_003035354.1|4368741_4370427_+	transporter	NA	NA	NA	NA	NA
WP_069219707.1|4370488_4370758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069219708.1|4370923_4372135_+	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	89.9	8.7e-190
>prophage 309
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	4380326	4382332	5096586		Escherichia_phage(50.0%)	2	NA	NA
WP_003836960.1|4380326_4381085_+	DNA-binding transcriptional repressor DeoR	NA	A0A077SK06	Escherichia_phage	28.8	3.9e-15
WP_003035316.1|4381129_4382332_-	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	47.1	2.9e-97
>prophage 310
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	4389936	4391808	5096586		Planktothrix_phage(100.0%)	1	NA	NA
WP_003836972.1|4389936_4391808_-	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	27.2	3.7e-14
>prophage 311
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	4395986	4404257	5096586		Synechococcus_phage(33.33%)	6	NA	NA
WP_003836983.1|4395986_4396649_-	fructose-6-phosphate aldolase	NA	A0A1D8KKK9	Synechococcus_phage	31.8	2.2e-22
WP_046669904.1|4396781_4397681_+	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_032936392.1|4397686_4400119_+	glycyl radical protein	NA	A0A076YHZ7	Citrobacter_phage	50.9	2.3e-08
WP_044701108.1|4400286_4401102_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_003035273.1|4401255_4402518_+	DUF1479 domain-containing protein	NA	NA	NA	NA	NA
WP_003035269.1|4402661_4404257_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.5	8.5e-60
>prophage 312
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	4409326	4414517	5096586		Enterobacteria_phage(33.33%)	6	NA	NA
WP_003035257.1|4409326_4409842_-	outer membrane protein OmpX	NA	A5LH44	Enterobacteria_phage	33.7	1.9e-16
WP_046669902.1|4410195_4411083_+	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_003035253.1|4411385_4411889_+	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	28.1	5.5e-05
WP_003837002.1|4412254_4413001_+	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_003035248.1|4413138_4413798_+	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_003035246.1|4413794_4414517_+	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	41.1	2.8e-34
>prophage 313
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	4420888	4426969	5096586		Synechococcus_phage(33.33%)	6	NA	NA
WP_003035235.1|4420888_4421566_+	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	30.6	3.4e-18
WP_003035233.1|4421644_4421911_+	DksA/TraR family C4-type zinc finger protein	NA	A0A2C9CZU7	Yersinia_phage	51.1	3.6e-16
WP_003035231.1|4422214_4422475_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_003845417.1|4422572_4423658_-	malate/lactate/ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_003035227.1|4423820_4424789_-	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_003837021.1|4424818_4426969_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	27.3	2.8e-42
>prophage 314
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	4430936	4435900	5096586		Diachasmimorpha_longicaudata_entomopoxvirus(50.0%)	4	NA	NA
WP_016149827.1|4430936_4432280_-	ATP-dependent RNA helicase RhlE	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.0	5.0e-53
WP_003035216.1|4432501_4433179_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_046669900.1|4433175_4434171_+	secretion protein HlyD	NA	NA	NA	NA	NA
WP_003845404.1|4434163_4435900_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	31.5	1.1e-17
>prophage 315
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	4445618	4450163	5096586		Streptococcus_phage(50.0%)	4	NA	NA
WP_046669894.1|4445618_4446527_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	31.1	3.5e-26
WP_046669893.1|4446649_4448671_-	excinuclease ABC subunit B	NA	NA	NA	NA	NA
WP_135702046.1|4449081_4449423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003035181.1|4449440_4450163_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.5	1.4e-09
>prophage 316
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	4453829	4457269	5096586		Klosneuvirus(50.0%)	3	NA	NA
WP_046669890.1|4453829_4455119_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.8	4.1e-20
WP_003845384.1|4455176_4455653_+	kinase inhibitor	NA	NA	NA	NA	NA
WP_069219710.1|4455748_4457269_-	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	39.9	4.9e-81
>prophage 317
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	4471619	4478185	5096586		Planktothrix_phage(33.33%)	7	NA	NA
WP_003837092.1|4471619_4472678_-	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	33.8	2.6e-20
WP_003023032.1|4472680_4473370_-	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_046669886.1|4473369_4474143_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003023026.1|4474342_4474492_-	multidrug efflux pump-associated protein, AcrZ family	NA	NA	NA	NA	NA
WP_003023018.1|4474622_4475411_+	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_032938578.1|4475478_4476951_+	molybdate ABC transporter ATP-binding protein ModF	NA	W5SAS9	Pithovirus	27.1	1.0e-11
WP_003837100.1|4477168_4478185_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	45.1	6.3e-77
>prophage 318
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	4482480	4485996	5096586		Pandoravirus(33.33%)	4	NA	NA
WP_046669885.1|4482480_4483533_-	3-deoxy-7-phosphoheptulonate synthase AroG	NA	S4VUY9	Pandoravirus	47.0	3.7e-80
WP_003022994.1|4483850_4484225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003022992.1|4484338_4485280_+	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	27.5	3.7e-23
WP_046669884.1|4485276_4485996_-	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	33.2	2.9e-23
>prophage 319
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	4528754	4529546	5096586		Kaumoebavirus(100.0%)	1	NA	NA
WP_046669875.1|4528754_4529546_-	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	29.8	1.7e-08
>prophage 320
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	4535337	4539363	5096586	transposase	Acinetobacter_phage(33.33%)	3	NA	NA
WP_003847348.1|4535337_4536819_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	27.5	1.3e-43
WP_016149795.1|4536869_4537784_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	48.0	4.1e-67
WP_046669872.1|4537944_4539363_-	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	33.8	3.9e-64
>prophage 321
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	4542730	4544779	5096586		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_046669870.1|4542730_4544779_+	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	24.5	1.1e-30
>prophage 322
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	4548045	4564946	5096586	tRNA	Bacillus_phage(16.67%)	15	NA	NA
WP_003022856.1|4548045_4548723_+	two-component system response regulator KdpE	NA	W8CYM9	Bacillus_phage	32.0	2.6e-26
WP_003022854.1|4548822_4550463_-	alpha-D-glucose phosphate-specific phosphoglucomutase	NA	NA	NA	NA	NA
WP_003022848.1|4550487_4551030_-	replication initiation negative regulator SeqA	NA	NA	NA	NA	NA
WP_044701063.1|4551224_4551998_+	esterase	NA	A0A1J0GVH7	Mycobacterium_phage	37.2	3.1e-07
WP_003022842.1|4552126_4552414_+	LexA regulated protein	NA	NA	NA	NA	NA
WP_006685496.1|4552524_4553100_+	flavodoxin FldA	NA	NA	NA	NA	NA
WP_049259739.1|4553310_4553397_+	ryhB-regulated fur leader peptide	NA	NA	NA	NA	NA
WP_003022836.1|4553389_4553836_+	ferric iron uptake transcriptional regulator	NA	NA	NA	NA	NA
WP_016149789.1|4553964_4554891_+	tricarballylate utilization LysR family transcriptional regulator TcuR	NA	NA	NA	NA	NA
WP_016149788.1|4554988_4556392_+	FAD-dependent tricarballylate dehydrogenase TcuA	NA	A0A2P0ZL82	Lactobacillus_phage	25.9	1.0e-08
WP_046669867.1|4556378_4557518_+	tricarballylate utilization 4Fe-4S protein TcuB	NA	NA	NA	NA	NA
WP_003835542.1|4557571_4558867_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	34.4	9.0e-60
WP_003835544.1|4559300_4560707_-	chitoporin	NA	NA	NA	NA	NA
WP_003022809.1|4561142_4562810_-|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	94.2	0.0e+00
WP_003835548.1|4562996_4564946_-	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	48.6	1.1e-08
>prophage 323
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	4569745	4571410	5096586		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_069219711.1|4569745_4571410_+	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.5	2.1e-85
>prophage 324
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	4575960	4577046	5096586		Pseudomonas_phage(100.0%)	1	NA	NA
WP_008784096.1|4575960_4577046_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	3.3e-47
>prophage 325
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	4583006	4588181	5096586	tRNA	Planktothrix_phage(50.0%)	4	NA	NA
WP_003022754.1|4583006_4583732_+	glutamate/aspartate ABC transporter ATP binding protein GltL	NA	G9BWD6	Planktothrix_phage	38.1	1.1e-30
WP_003847389.1|4583848_4584784_+	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
WP_003022748.1|4584880_4585363_-	zinc ribbon-containing protein	NA	NA	NA	NA	NA
WP_152659845.1|4585598_4588181_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.6	1.6e-185
>prophage 326
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	4596346	4598810	5096586		Synechococcus_phage(50.0%)	2	NA	NA
WP_046669860.1|4596346_4597456_+	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	54.8	6.2e-09
WP_003022711.1|4597598_4598810_+	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	47.9	9.8e-101
>prophage 327
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	4602417	4603063	5096586		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_016149775.1|4602417_4602801_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	52.6	5.8e-23
WP_000034825.1|4602853_4603063_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	2.7e-22
>prophage 328
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	4616893	4625023	5096586		Escherichia_phage(40.0%)	8	NA	NA
WP_046669856.1|4616893_4617724_-	alpha/beta hydrolase	NA	A0A291AV30	Mycobacterium_phage	30.8	4.2e-18
WP_003022104.1|4617999_4618410_+	nucleoside diphosphate kinase regulator	NA	NA	NA	NA	NA
WP_003022101.1|4618593_4619022_+	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	38.5	1.1e-17
WP_046669855.1|4619091_4619859_-	hydrogenase	NA	NA	NA	NA	NA
WP_003022094.1|4619858_4620416_-	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	37.7	6.2e-26
WP_069219713.1|4620412_4622683_-	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	24.9	4.2e-44
WP_069219714.1|4622679_4623234_-	dehydrogenase	NA	NA	NA	NA	NA
WP_003835619.1|4623457_4625023_-	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.0	1.1e-43
>prophage 329
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	4628135	4629961	5096586		Streptococcus_phage(50.0%)	2	NA	NA
WP_003835626.1|4628135_4629359_+	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	33.1	5.9e-61
WP_046669852.1|4629343_4629961_+	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	51.3	6.0e-54
>prophage 330
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	4642418	4650508	5096586		uncultured_Caudovirales_phage(33.33%)	5	NA	NA
WP_003835646.1|4642418_4643426_+	Fe(3+)-siderophore ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.0	2.2e-13
WP_085951538.1|4643425_4644415_+	iron-enterobactin ABC transporter permease	NA	NA	NA	NA	NA
WP_003022023.1|4644411_4645209_+	iron-enterobactin ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	23.0	6.4e-08
WP_003847441.1|4645255_4646389_-	LPS O-antigen length regulator	NA	NA	NA	NA	NA
WP_046669848.1|4646617_4650508_-	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	29.8	1.4e-63
>prophage 331
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	4663116	4673272	5096586	transposase	Escherichia_phage(100.0%)	2	NA	NA
WP_069219700.1|4663116_4664097_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	98.8	4.0e-185
WP_081328899.1|4664827_4673272_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	24.4	9.2e-12
>prophage 332
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	4677147	4682759	5096586		Erysipelothrix_phage(50.0%)	3	NA	NA
WP_003847475.1|4677147_4678473_-	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	46.0	2.9e-106
WP_003847476.1|4678709_4679564_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003835712.1|4679615_4682759_-	CusA/CzcA family heavy metal efflux RND transporter	NA	S5VTK5	Leptospira_phage	22.0	2.7e-57
>prophage 333
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	4686097	4688222	5096586		Bacillus_phage(50.0%)	2	NA	NA
WP_003021940.1|4686097_4686781_+	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	35.6	6.0e-31
WP_003847479.1|4686770_4688222_+	Cu(+)/Ag(+) sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	26.8	2.5e-10
>prophage 334
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	4694600	4704503	5096586		Morganella_phage(25.0%)	7	NA	NA
WP_003835732.1|4694600_4695029_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	49.3	7.4e-27
WP_046669834.1|4695507_4696122_-	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_046669833.1|4696118_4698659_-	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	30.2	1.1e-72
WP_003021915.1|4698648_4699827_-	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_003021912.1|4699958_4700651_+	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.9	4.9e-20
WP_046669832.1|4700623_4701655_-	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_071978001.1|4701737_4704503_+	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	31.3	4.0e-33
>prophage 335
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	4714479	4715346	5096586		Enterococcus_phage(100.0%)	1	NA	NA
WP_003021887.1|4714479_4715346_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	36.5	1.2e-28
>prophage 336
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	4719279	4720665	5096586	tRNA	Moumouvirus(100.0%)	1	NA	NA
WP_069219720.1|4719279_4720665_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	1.6e-46
>prophage 337
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	4725704	4726721	5096586		Planktothrix_phage(100.0%)	1	NA	NA
WP_003847503.1|4725704_4726721_-	virulence-associated ABC transporter ATP-binding protein SfbB	NA	G9BWD6	Planktothrix_phage	38.6	1.5e-33
>prophage 338
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	4731617	4732304	5096586		Planktothrix_phage(100.0%)	1	NA	NA
WP_003021853.1|4731617_4732304_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.2	7.9e-31
>prophage 339
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	4735454	4736132	5096586		Bacillus_virus(100.0%)	1	NA	NA
WP_003835797.1|4735454_4736132_-	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	35.2	3.1e-27
>prophage 340
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	4747683	4751103	5096586		Pithovirus(50.0%)	2	NA	NA
WP_003021801.1|4747683_4748454_+	heme ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	27.9	8.9e-15
WP_044712822.1|4748601_4751103_+	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.2	2.6e-116
>prophage 341
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	4759288	4767918	5096586		Powai_lake_megavirus(25.0%)	8	NA	NA
WP_046669819.1|4759288_4760248_+	acetyl esterase	NA	A0A167RJ59	Powai_lake_megavirus	29.0	1.9e-14
WP_003021775.1|4760244_4761207_-	ferrochelatase	NA	NA	NA	NA	NA
WP_003021773.1|4761370_4762015_-	adenylate kinase	NA	NA	NA	NA	NA
WP_046669818.1|4762247_4764122_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.4	2.7e-113
WP_003021767.1|4764232_4764838_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_003021764.1|4764837_4765167_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_046669817.1|4765224_4767156_-	DNA polymerase III subunit gamma/tau	NA	E7DN81	Pneumococcus_phage	41.5	1.3e-43
WP_003021759.1|4767366_4767918_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	46.6	7.0e-30
>prophage 342
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	4774837	4777987	5096586		Leptospira_phage(100.0%)	1	NA	NA
WP_003021736.1|4774837_4777987_+	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.7	9.5e-55
>prophage 343
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	4790311	4793855	5096586		Bacillus_phage(100.0%)	2	NA	NA
WP_046669814.1|4790311_4792090_-	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.8	8.9e-42
WP_016149705.1|4792082_4793855_-	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.7	3.1e-47
>prophage 344
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	4798265	4798961	5096586		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_003835948.1|4798265_4798961_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.4	6.5e-89
>prophage 345
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	4802242	4807287	5096586	protease	Bacillus_phage(25.0%)	4	NA	NA
WP_003021629.1|4802242_4802515_-	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.5e-20
WP_003021627.1|4802723_4805078_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.6	5.5e-225
WP_003831013.1|4805262_4806537_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	1.9e-131
WP_003021624.1|4806663_4807287_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
>prophage 346
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	4829926	4839534	5096586	tRNA	uncultured_Mediterranean_phage(50.0%)	11	NA	NA
WP_003021575.1|4829926_4830397_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	7.8e-30
WP_003021573.1|4830487_4831591_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.5	3.4e-52
WP_003021571.1|4831594_4832044_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_046669949.1|4832197_4832737_+	DUF3251 domain-containing protein	NA	NA	NA	NA	NA
WP_003021561.1|4833035_4833899_+	nucleoside-specific channel-forming protein Tsx	NA	NA	NA	NA	NA
WP_003835974.1|4833944_4834637_-	YafY family transcriptional regulator	NA	A0A1B0RXM1	Streptococcus_phage	30.1	4.5e-18
WP_044699354.1|4834660_4835026_-	VOC family protein	NA	NA	NA	NA	NA
WP_003021550.1|4835194_4836166_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.8	1.4e-44
WP_003021547.1|4836176_4838024_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_003021544.1|4838051_4838384_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
WP_003835982.1|4838406_4839534_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.3	1.6e-89
>prophage 347
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	4851780	4861633	5096586		Bacillus_phage(60.0%)	7	NA	NA
WP_003021498.1|4851780_4853076_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	30.3	2.4e-28
WP_003021496.1|4853126_4853816_-	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	38.9	2.0e-37
WP_046669808.1|4854006_4855209_+	exonuclease subunit SbcD	NA	A0A0A0PQ58	Bacillus_phage	25.6	1.1e-08
WP_069219724.1|4855205_4858349_+	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.4	1.7e-11
WP_069219769.1|4858541_4859714_+	MFS transporter AraJ	NA	NA	NA	NA	NA
WP_032936987.1|4859721_4860630_-	fructokinase	NA	NA	NA	NA	NA
WP_003021479.1|4860721_4861633_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	64.3	2.7e-103
>prophage 348
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	4865384	4866500	5096586		Bacillus_phage(100.0%)	1	NA	NA
WP_086538773.1|4865384_4866500_-	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	34.6	5.3e-16
>prophage 349
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	4883162	4883930	5096586		Planktothrix_phage(100.0%)	1	NA	NA
WP_003847641.1|4883162_4883930_-	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	38.6	5.6e-25
>prophage 350
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	4891990	4893037	5096586		Bacillus_virus(100.0%)	1	NA	NA
WP_046669801.1|4891990_4893037_+	ferric ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.2	4.0e-34
>prophage 351
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	4897028	4898989	5096586		Micromonas_sp._RCC1109_virus(100.0%)	2	NA	NA
WP_003021379.1|4897028_4898042_-	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.1	3.2e-44
WP_003838629.1|4898038_4898989_-	acetaldehyde dehydrogenase (acetylating)	NA	E5EQ71	Micromonas_sp._RCC1109_virus	36.3	6.2e-34
>prophage 352
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	4909748	4917697	5096586		Enterobacteria_phage(33.33%)	5	NA	NA
WP_046669794.1|4909748_4910831_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	81.7	5.4e-159
WP_046669793.1|4910952_4914036_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	81.3	0.0e+00
WP_003847667.1|4914087_4915341_+	MFS transporter	NA	NA	NA	NA	NA
WP_003838662.1|4915493_4915766_+	YceK/YidQ family lipoprotein	NA	NA	NA	NA	NA
WP_046669792.1|4915810_4917697_-	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	29.8	4.1e-53
>prophage 353
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	4931337	4932165	5096586		Planktothrix_phage(100.0%)	1	NA	NA
WP_046669788.1|4931337_4932165_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.0	2.1e-17
>prophage 354
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	4938898	4939804	5096586		Burkholderia_virus(100.0%)	1	NA	NA
WP_046669785.1|4938898_4939804_-	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	25.3	2.3e-14
>prophage 355
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	4947889	4949002	5096586		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_046669780.1|4947889_4949002_+	agmatine deiminase family protein	NA	M1H3B1	Paramecium_bursaria_Chlorella_virus	35.4	7.5e-55
>prophage 356
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	4953829	4958158	5096586		Phormidium_phage(100.0%)	1	NA	NA
WP_046669777.1|4953829_4958158_+	AAA family ATPase	NA	U5XJW0	Phormidium_phage	33.2	4.3e-66
>prophage 357
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	4967921	4970359	5096586	transposase	Escherichia_phage(100.0%)	3	NA	NA
WP_155761574.1|4967921_4968938_-|transposase	IS5 family transposase	transposase	Q38213	Escherichia_phage	98.8	1.2e-184
WP_155761575.1|4968936_4969077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069219700.1|4969378_4970359_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	98.8	4.0e-185
>prophage 358
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	4982126	4983131	5096586		Enterobacteria_phage(100.0%)	1	NA	NA
WP_016149641.1|4982126_4983131_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.3	1.8e-23
>prophage 359
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	4999729	5003443	5096586		Streptococcus_phage(66.67%)	3	NA	NA
WP_003031370.1|4999729_5000983_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	1.9e-99
WP_003031373.1|5000994_5002098_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.6	2.6e-60
WP_003031375.1|5002387_5003443_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	59.5	2.5e-116
>prophage 360
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	5031696	5037170	5096586		Catovirus(50.0%)	4	NA	NA
WP_046669750.1|5031696_5034258_+	glycosyltransferase	NA	A0A1V0SAN7	Catovirus	39.6	1.6e-31
WP_069219733.1|5034286_5035483_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046669748.1|5035535_5036705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016149604.1|5036777_5037170_-	adenylyltransferase/cytidyltransferase family protein	NA	A0A1V0SGE7	Hokovirus	47.0	4.7e-28
>prophage 361
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	5051374	5054656	5096586		Clostridioides_phage(50.0%)	4	NA	NA
WP_003838866.1|5051374_5052136_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.5	2.0e-19
WP_003830823.1|5052485_5053226_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_003031388.1|5053196_5053964_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_003031390.1|5054074_5054656_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	30.8	5.7e-14
>prophage 362
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	5070247	5074446	5096586		Bradyrhizobium_phage(33.33%)	5	NA	NA
WP_008324473.1|5070247_5070985_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	40.7	4.1e-41
WP_003838896.1|5071040_5071508_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	60.1	6.5e-53
WP_003031413.1|5071504_5072227_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_046669732.1|5072260_5073016_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_003031421.1|5073087_5074446_+	murein transglycosylase D	NA	A0A0A7NU10	Lactobacillus_phage	28.6	8.9e-10
>prophage 363
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	5078490	5079294	5096586		Indivirus(100.0%)	1	NA	NA
WP_003838911.1|5078490_5079294_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	35.4	1.7e-37
>prophage 364
NZ_CP016952	Citrobacter freundii strain SL151 chromosome, complete genome	5096586	5085752	5086784	5096586		Planktothrix_phage(100.0%)	1	NA	NA
WP_003018468.1|5085752_5086784_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	5.5e-36
>prophage 1
NZ_CP017058	Citrobacter freundii strain SL151 plasmid unnamed1, complete sequence	229406	5535	50236	229406	integrase,transposase	Enterobacteria_phage(26.32%)	54	1593:1608	52789:52804
1593:1608	attL	ACCACCATGAACGCCA	NA	NA	NA	NA
WP_000427614.1|5535_6540_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_000656305.1|6850_7228_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000412211.1|7428_8088_-	type A-1 chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
WP_004197526.1|9201_9528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004197540.1|9563_10841_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	44.2	6.7e-84
WP_004197551.1|10846_11275_-	peptidase S24	NA	A0A1W6JNS2	Morganella_phage	39.5	1.3e-15
WP_004197545.1|11370_11643_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_085947932.1|11767_12527_+|transposase	IS5-like element ISKpn12 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	38.8	2.0e-11
WP_004197549.1|13419_13605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085956516.1|13670_14830_-|transposase	IS3-like element ISKpn11 family transposase	transposase	A0A2P1JR32	Mycobacterium_phage	32.3	1.5e-18
WP_000587836.1|14861_15155_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000557452.1|15167_16028_-	aminoglycoside N-acetyltransferase AAC(3)-IIa	NA	NA	NA	NA	NA
WP_000027057.1|16169_17030_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001235713.1|17212_17770_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_000608644.1|18333_19596_+|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_000239590.1|19851_20727_+	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
WP_001393253.1|20773_21106_-	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
WP_081328900.1|23838_24834_-|transposase	ISKra4 family transposase	transposase	Q1MVP6	Enterobacteria_phage	100.0	7.0e-12
WP_001493762.1|24870_25443_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	39.4	3.4e-19
WP_012477564.1|25579_26170_-	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_000427614.1|26905_27910_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_010981353.1|27988_28423_-	mercury resistance transcriptional regulator MerR	NA	NA	NA	NA	NA
WP_077269372.1|28352_28706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000761850.1|28720_29359_+	organomercurial lyase MerB	NA	NA	NA	NA	NA
WP_031942307.1|29470_29836_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_005413392.1|29832_30069_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_010981356.1|30084_30405_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_010981357.1|30443_31058_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	51.0	5.1e-37
WP_011405615.1|31118_32336_-	TniQ family protein	NA	NA	NA	NA	NA
WP_000393453.1|32332_33241_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_010791757.1|33243_34926_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	M4T586	Rhodobacter_phage	24.7	3.7e-05
WP_014839983.1|35113_35728_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	47.4	8.1e-35
WP_001516695.1|36046_36703_-	quinolone resistance pentapeptide repeat protein QnrS1	NA	NA	NA	NA	NA
WP_001067855.1|37130_37835_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000062185.1|38100_38598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000286591.1|38600_39062_-	DUF1643 domain-containing protein	NA	B5WZV8	Pseudomonas_phage	60.5	1.5e-46
WP_001326176.1|39179_39521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001281821.1|39535_40006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000516916.1|39998_40370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000343597.1|40380_40575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001061574.1|40915_41464_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000270043.1|41626_41977_+	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_000124640.1|41981_42284_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001239997.1|42310_42604_-	chromosome segregation protein ParM	NA	NA	NA	NA	NA
WP_001043047.1|42691_42964_-	HU family DNA-binding protein	NA	A3E2K9	Sodalis_phage	59.6	4.2e-20
WP_001236377.1|43021_43549_-	thermonuclease family protein	NA	O64020	Bacillus_phage	37.0	1.3e-09
WP_001270411.1|43565_43754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069219771.1|43980_45189_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_069219772.1|45227_45587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069219773.1|45590_45911_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_069219774.1|45945_46926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069219775.1|46894_47143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069219776.1|47129_48926_+	DUF2326 domain-containing protein	NA	NA	NA	NA	NA
WP_069219777.1|49009_50236_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	49.2	2.1e-50
52789:52804	attR	ACCACCATGAACGCCA	NA	NA	NA	NA
>prophage 2
NZ_CP017058	Citrobacter freundii strain SL151 plasmid unnamed1, complete sequence	229406	205752	225508	229406	integrase,transposase	Salmonella_phage(25.0%)	19	208025:208038	222750:222763
WP_001120888.1|205752_207246_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000743213.1|207456_207681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001366550.1|207677_208415_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
208025:208038	attL	GCACGGCTTCCAGC	NA	NA	NA	NA
WP_000480968.1|209116_209953_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001082319.1|209952_210756_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_000845039.1|210913_211927_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_000454193.1|212129_212480_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000147567.1|212605_213166_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_001138064.1|213168_216135_+|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
WP_000427614.1|216213_217218_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_000656305.1|217528_217906_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000412211.1|218106_218766_-	type A-1 chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
WP_004197526.1|219879_220206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004197540.1|220241_221519_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	44.2	6.7e-84
WP_004197551.1|221524_221953_-	peptidase S24	NA	A0A1W6JNS2	Morganella_phage	39.5	1.3e-15
WP_004197545.1|222048_222321_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_085947932.1|222445_223205_+|transposase	IS5-like element ISKpn12 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	38.8	2.0e-11
222750:222763	attR	GCACGGCTTCCAGC	NA	NA	NA	NA
WP_004197549.1|224097_224283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085956516.1|224348_225508_-|transposase	IS3-like element ISKpn11 family transposase	transposase	A0A2P1JR32	Mycobacterium_phage	32.3	1.5e-18
>prophage 1
NZ_CP017059	Citrobacter freundii strain SL151 plasmid unnamed2, complete sequence	171233	11336	64165	171233	transposase,integrase	Escherichia_phage(47.06%)	54	26305:26364	46075:47432
WP_000427614.1|11336_12341_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_000184001.1|12568_13774_+	chromate efflux transporter	NA	NA	NA	NA	NA
WP_000130000.1|13784_14090_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001389365.1|14316_15081_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001137892.1|15573_16158_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000004159.1|16157_17396_-	MFS transporter	NA	NA	NA	NA	NA
WP_000219391.1|17392_18298_-	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_001067855.1|18419_19124_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000557454.1|19356_20217_+	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
WP_000587837.1|20229_20772_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000951934.1|21253_21445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001330846.1|21450_21696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000080861.1|21746_22883_+	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
WP_000971921.1|22997_24368_+|transposase	IS1182-like element ISCfr1 family transposase	transposase	NA	NA	NA	NA
WP_000027057.1|25188_26049_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
26305:26364	attL	CCTCAGAAAACGGAATCTATGGTCACTCCCGTTTTTGCAACACCGATTTTGACGACAAGT	NA	NA	NA	NA
WP_000427619.1|26574_27579_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_000429836.1|27657_28092_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001294663.1|28163_28514_+	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_000732292.1|28527_28803_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001447540.1|28838_29261_+	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000105636.1|29312_31007_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
WP_001277456.1|31024_31387_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000993386.1|31383_31620_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_000204520.1|31616_32324_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000935452.1|32362_33667_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_001067855.1|33713_34418_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000842134.1|34907_36017_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	30.2	2.8e-33
WP_001039466.1|36111_37296_-	tetracycline efflux MFS transporter Tet(D)	NA	NA	NA	NA	NA
WP_000113282.1|37391_38048_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001067855.1|38059_38764_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001011939.1|38907_39549_-	type A-2 chloramphenicol O-acetyltransferase CatII	NA	G3CFL0	Escherichia_phage	45.9	7.3e-55
WP_001239317.1|39698_40199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|40278_40983_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001044210.1|40988_41129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001446887.1|41614_42352_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000743213.1|42348_42573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001120888.1|42783_44277_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001445143.1|44307_44559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000251875.1|44452_44755_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_001043260.1|44841_45657_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_000954592.1|45986_46163_+	DUF4102 domain-containing protein	NA	T1S9J3	Salmonella_phage	68.6	1.0e-06
WP_000427619.1|46344_47349_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_001138070.1|47427_50394_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	72.9	0.0e+00
46075:47432	attR	CCTCAGAAAACGGAATCTATGGTCACTCCCGTTTTTGCAACACCGATTTTGACGACAAGTTGGCTTGCTTGAATCTATCCGGCGTCTGAATGGGATTTTATTCCCGCGCCTCGATGAGTTCCGCGCCTGATGAACCTCCAGAAAATATACGGCTTCAATGAGCCTTTCCGTTTTACAGGTTCCTCAACAGGCCGGTGGGCCGTTAGTATCATCAATATCAGTATTCGCAAAACCAGATGAATGATTGTTTAAACTGGTGTATTTCTGCCTTTATGCTTCGTAAGTTTGCTGTCGCGCCGTCAGTGCCCAGGCTATTCTGGCCAGCTTGTTTGCCAGAGCACAGGTGACGACAAAGTTGCTTTTCCGACACAACAACTCCCTGACCCAGTCGGCCAACTTGCCAGACTGGTGTTCCAGTTTTTGTATGAATACCCTGGCACACTGAACCAACAAAGTTCGGATCTTTTTGTTGCCCCGCTTGCTAATCCCTAACAATGTCGTCCGACCTCCCGTGCTGTACTGTCGGGGTACCAGCCCTGTTGCCGCCGCAAAGTCACGGCTGCTGGCGTACTGCTTCCCGTCGCCAATCTCAGTTGAAATAGTACTGGCAGTCAGCGTTCCAACGCAGGGAATACTCAGCAAGCGCTGTCCAACCTCATCTTCGTCCAACTTTCGTTTCAACTGAGATTCCAGATCTTTAATCTGCTCAACAAGATAGTGATAATGCTGTTGTAATTTCAGCAGTAACTGGCTGAGATAAAGAGGCAAACTACTGTCCTCAAGAAGGGTACTCAGTCGACTAATAACGGCAGCACCTCGCGGAACGCTGATACCAAATTCCAGCAGAAAAGCATGCATCTGATTAGTTGTTTTCACCTTATCCTGAACCAGGGATTCACGGACACGATGCAGAGCTCGCATTGCCTGCTGAGATTCGGTTCTGGGCTGCACGAAACGCATAGATGGACGTGATGCTGCTTCACAGATAGCTTCAGCATCAACGAAGTCATTTTTGTTGCTTTTAACGAATGGGCGGACAAATTGCGGTGATATCAGCTTTGGAAAATGCCCTAACTCTTCCAGCTTGCGTGCCATAAAGTGAGAACCGCCACAGGCTTCCATCGCGATGGTTGTTGCCGGGCATGTCGCCAGAAATTCGATTAGCTTTGGTCGGGTGAATTTTTTACGGTAAACGGCCTTCCCACGATGATCCTGACAATGAATATGGAAAGAGTTCTTACCCAGATCGATACCAATAAGCGCAATGTTTTCCATGATGGTTCTCCGAATGAAAGCCTGTCCTCAGCATAGTACTGGGAAGGAGGGAGTGACCATCTCATTAAATAAAGCACGCTAAG	NA	NA	NA	NA
WP_003124096.1|50396_50957_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	88.6	2.1e-50
WP_001067855.1|51011_51716_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_032430963.1|51863_52652_-	Uxu operon transcriptional regulator	NA	NA	NA	NA	NA
WP_022652293.1|52869_54300_-	glucuronate isomerase	NA	NA	NA	NA	NA
WP_022652294.1|54319_55789_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	29.8	6.9e-48
WP_022652295.1|55895_57080_-	mannonate dehydratase	NA	NA	NA	NA	NA
WP_022652296.1|57381_58647_-	glucuronide uptake porin UidC	NA	NA	NA	NA	NA
WP_022652297.1|58695_60069_-	glucuronide transporter	NA	NA	NA	NA	NA
WP_022652298.1|60065_61877_-	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	79.8	1.1e-302
WP_022652299.1|62253_62862_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016947617.1|63184_64165_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	6.8e-185
>prophage 2
NZ_CP017059	Citrobacter freundii strain SL151 plasmid unnamed2, complete sequence	171233	80050	125627	171233	integrase,transposase	Stx2-converting_phage(20.83%)	38	98995:99011	104716:104732
WP_022652239.1|80050_82177_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_022652238.1|82325_83540_+	type II site-specific deoxyribonuclease	NA	E5E3X4	Burkholderia_phage	42.9	9.4e-35
WP_022652237.1|83573_85007_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	7.0e-106
WP_022652236.1|85310_87449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022652235.1|87708_88161_+	protein samB	NA	I6RSM4	Salmonella_phage	56.1	2.3e-34
WP_022652234.1|88175_88745_+	DUF4113 domain-containing protein	NA	F1C5A5	Cronobacter_phage	62.6	1.8e-65
WP_022652318.1|89477_90443_-	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	77.5	8.8e-137
WP_022652317.1|90442_91609_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	94.3	1.1e-218
WP_032430835.1|92434_93793_+|transposase	IS110 family transposase	transposase	Q9JMN8	Wolbachia_phage	47.5	1.3e-117
WP_001000409.1|93849_95385_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	87.7	2.0e-260
WP_000609174.1|95434_95782_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	95.7	2.7e-59
WP_001201739.1|95778_96162_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	36.3	4.1e-13
WP_022652315.1|96270_97422_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.3	9.8e-42
WP_077873527.1|98523_99417_-|transposase	IS5 family transposase	transposase	Q38213	Escherichia_phage	86.8	4.3e-154
98995:99011	attL	CAGCCAGCGATTGATGG	NA	NA	NA	NA
WP_022652313.1|99548_100079_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_022652312.1|100082_100352_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_022652311.1|101207_102197_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	61.2	5.0e-103
WP_022652310.1|102522_103263_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	58.6	5.4e-25
WP_032430957.1|104338_105361_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
104716:104732	attR	CCATCAATCGCTGGCTG	NA	NA	NA	NA
WP_022652309.1|105867_107346_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	73.2	1.9e-194
WP_032430841.1|107363_108191_+	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	40.3	4.9e-51
WP_022652307.1|108272_108476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021314637.1|108753_108984_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_050483874.1|110155_110665_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_022652300.1|111255_112209_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_022652302.1|112829_113540_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.7	3.7e-31
WP_022652303.1|113541_114747_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_022652304.1|114743_115895_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004393990.1|115891_116500_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_022652300.1|116687_117641_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_000493286.1|118059_118389_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	44.2	2.4e-09
WP_000780222.1|118369_118651_+	helix-turn-helix transcriptional regulator	NA	A0A2I6TC97	Escherichia_phage	38.0	1.3e-08
WP_016947617.1|118928_119909_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	6.8e-185
WP_004902302.1|121301_122894_-|transposase	IS66-like element ISKox1 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.8	3.2e-176
WP_004189161.1|122924_123275_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	63.8	5.2e-39
WP_004189163.1|123271_123712_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	60.3	2.6e-19
WP_001752509.1|124095_124596_-	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_001067855.1|124922_125627_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
