The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP017039	Anaerolineaceae bacterium oral taxon 439 strain W11661 chromosome, complete genome	2945494	133301	152519	2945494	portal,tail,capsid,terminase,head,protease	Bacillus_phage(25.0%)	22	NA	NA
WP_069177532.1|133301_135266_-|tail	phage tail protein	tail	A0A0U4B063	Bacillus_phage	37.2	1.3e-70
WP_069177533.1|135262_135985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069177534.1|136004_136781_-	hypothetical protein	NA	H6BJ44	Methylophilales_phage	37.2	2.1e-11
WP_069177535.1|136938_137487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069177536.1|137490_140205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069177537.1|140305_140515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069177538.1|140768_141233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069177539.1|141294_141867_-	hypothetical protein	NA	A0A0U4JWV5	Exiguobacterium_phage	31.9	2.4e-20
WP_159060101.1|141903_142284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069177541.1|142295_142640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069177542.1|142675_143002_-|head	phage head closure protein	head	NA	NA	NA	NA
WP_069177543.1|143004_143301_-	hypothetical protein	NA	A0A290FZN8	Caldibacillus_phage	44.2	1.9e-13
WP_069177544.1|143464_144718_-|capsid	phage major capsid protein	capsid	NA	NA	NA	NA
WP_069177545.1|144717_145392_-|head,protease	HK97 family phage prohead protease	head,protease	Q8LTC1	Lactobacillus_phage	33.6	1.9e-13
WP_069177546.1|145483_145894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069177547.1|146236_147406_-|portal	phage portal protein	portal	A0A290G4I4	Caldibacillus_phage	32.8	1.4e-43
WP_069177548.1|147481_148186_-	M23 family metallopeptidase	NA	A0A142F145	Bacillus_phage	42.9	2.2e-12
WP_069177549.1|148157_148601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069177550.1|148581_148950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069177551.1|148957_149338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069177552.1|149422_150577_-	Abi family protein	NA	NA	NA	NA	NA
WP_069177553.1|150851_152519_-|terminase	terminase large subunit	terminase	H7BUQ3	unidentified_phage	60.1	5.9e-197
>prophage 2
NZ_CP017039	Anaerolineaceae bacterium oral taxon 439 strain W11661 chromosome, complete genome	2945494	2112918	2171905	2945494	integrase,transposase,protease	Leptospira_phage(15.38%)	52	2170840:2170864	2171927:2171951
WP_159060207.1|2112918_2113290_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	55.8	1.0e-24
WP_083222143.1|2113195_2113705_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_022849212.1|2114140_2114926_+	glucose 1-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.2	6.7e-18
WP_069178783.1|2114977_2115901_+	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_083222144.1|2115999_2117541_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	33.2	1.7e-09
WP_022849484.1|2117527_2118508_+	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_022849399.1|2118647_2119550_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_083222143.1|2119822_2120332_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_159060208.1|2120390_2120609_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	60.9	1.3e-16
WP_022848063.1|2120979_2121687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022848064.1|2122776_2123610_-	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	29.7	1.1e-21
WP_022848065.1|2123611_2124532_-	stage 0 sporulation protein	NA	NA	NA	NA	NA
WP_022848066.1|2124579_2125221_-	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_069178786.1|2125460_2126453_+	P1 family peptidase	NA	L7XZF8	Megavirus	29.7	1.6e-11
WP_022848070.1|2126735_2127944_+	sigma-70 family RNA polymerase sigma factor	NA	G8CLC7	Synechococcus_phage	35.4	4.0e-38
WP_069178787.1|2128075_2129779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022848072.1|2129805_2130264_+	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	51.9	5.8e-30
WP_022848073.1|2130260_2130686_-	deoxyuridine 5'-triphosphate nucleotidohydrolase	NA	Q4ZC04	Staphylococcus_virus	31.4	2.6e-16
WP_069178788.1|2131115_2132555_+	trigger factor	NA	NA	NA	NA	NA
WP_022848075.1|2132775_2133378_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	50.3	8.7e-50
WP_022848076.1|2133565_2134375_+	HAD-IIA family hydrolase	NA	NA	NA	NA	NA
WP_069178789.1|2134408_2135449_+	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_022848078.1|2135481_2136399_+	signal recognition particle-docking protein FtsY	NA	D6PHS7	uncultured_phage	35.5	6.0e-18
WP_022848079.1|2136419_2137508_+	peptide chain release factor 2	NA	W8EDB3	Pseudomonas_phage	36.6	1.4e-05
WP_069178790.1|2137596_2138034_+	large conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_069178792.1|2138518_2140558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069178793.1|2140730_2141777_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_069178794.1|2141876_2144300_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_069178795.1|2144309_2145398_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	34.6	4.6e-25
WP_069178796.1|2145454_2146729_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_069178797.1|2146760_2148074_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_069179408.1|2148350_2149766_+	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_069178798.1|2149762_2150017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069178799.1|2150030_2150339_+	AtpZ/AtpI family protein	NA	NA	NA	NA	NA
WP_159060209.1|2150335_2150689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069178800.1|2150672_2151371_+	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_069178801.1|2151363_2151648_+	ATP synthase F0 subunit C	NA	NA	NA	NA	NA
WP_069178802.1|2151651_2152446_+	F0F1 ATP synthase subunit delta	NA	NA	NA	NA	NA
WP_107528695.1|2152426_2154124_+	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_069178803.1|2154120_2154447_+	cyclic-di-AMP receptor	NA	NA	NA	NA	NA
WP_069178804.1|2154532_2155510_+	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_069178805.1|2155540_2156863_-	citrate (Si)-synthase	NA	NA	NA	NA	NA
WP_069178806.1|2156852_2157647_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_069178807.1|2157807_2159019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069178808.1|2159068_2160130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069178809.1|2160155_2160974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083222150.1|2161181_2162465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069178811.1|2162461_2163199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069178812.1|2163254_2163782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069178813.1|2163903_2164680_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_069178814.1|2164812_2170755_-	hypothetical protein	NA	NA	NA	NA	NA
2170840:2170864	attL	ATTCGTGGAATGAAATTTAAACTTT	NA	NA	NA	NA
WP_069178815.1|2170975_2171905_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_069178815.1|2170975_2171905_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
2171927:2171951	attR	ATTCGTGGAATGAAATTTAAACTTT	NA	NA	NA	NA
>prophage 3
NZ_CP017039	Anaerolineaceae bacterium oral taxon 439 strain W11661 chromosome, complete genome	2945494	2408118	2417354	2945494		Sinorhizobium_phage(16.67%)	6	NA	NA
WP_022848855.1|2408118_2409486_+	FkbM family methyltransferase	NA	S5M6G6	Sinorhizobium_phage	31.5	5.8e-09
WP_022848854.1|2409500_2410568_+	CDP-glucose 4,6-dehydratase	NA	A0A291LAD7	Escherichia_phage	22.4	4.7e-14
WP_022848853.1|2410564_2411488_+	NAD(P)-dependent oxidoreductase	NA	A0A1V0SAI6	Catovirus	24.8	3.8e-12
WP_069178962.1|2411490_2412066_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A218MN57	uncultured_virus	35.2	3.9e-23
WP_022849363.1|2412080_2413235_+	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	32.9	1.5e-50
WP_083222177.1|2413352_2417354_+	DNA polymerase III subunit alpha	NA	A0A2L1IZ23	Streptomyces_phage	37.2	3.5e-195
