The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP016926	Klebsiella pneumoniae isolate 23 chromosome, complete genome	5236925	171098	180512	5236925		Escherichia_phage(87.5%)	9	NA	NA
WP_160333886.1|171098_172733_+	DUF4981 domain-containing protein	NA	L0N6M2	Herpes_simplex_virus	55.8	3.1e-182
WP_004176258.1|172787_174053_+	MFS transporter	NA	NA	NA	NA	NA
WP_004179755.1|174083_175172_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	99.7	3.0e-210
WP_004176262.1|175258_175519_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
WP_004179754.1|175816_176677_+	class A beta-lactamase SHV-28	NA	A0A077SL40	Escherichia_phage	99.3	1.7e-155
WP_002210513.1|176697_177459_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_002903955.1|177719_178622_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_004179748.1|178633_179899_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.3	1.1e-232
WP_069012947.1|179891_180512_+	aldolase	NA	A0A077SK32	Escherichia_phage	99.5	3.0e-114
>prophage 2
NZ_CP016926	Klebsiella pneumoniae isolate 23 chromosome, complete genome	5236925	897461	906924	5236925	protease,tRNA	Brazilian_cedratvirus(16.67%)	8	NA	NA
WP_004179158.1|897461_899183_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
WP_004141853.1|899209_899929_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|900282_900501_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002896522.1|900620_902900_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_002896520.1|902930_903248_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|903573_903795_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_004150848.1|903871_905812_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896440.1|905808_906924_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
>prophage 3
NZ_CP016926	Klebsiella pneumoniae isolate 23 chromosome, complete genome	5236925	3862009	3953154	5236925	holin,transposase,integrase,protease,tRNA,portal,terminase,capsid,head,tail	Klebsiella_phage(44.0%)	99	3863362:3863378	3946696:3946712
WP_015586042.1|3862009_3862711_-|transposase	IS1-like element ISPa14 family transposase	transposase	A0A218MNG1	uncultured_virus	55.0	9.9e-37
WP_004180960.1|3863061_3866214_-	multidrug efflux RND transporter permease subunit OqxB	NA	NA	NA	NA	NA
3863362:3863378	attL	GATCAGAATGGCGTTTT	NA	NA	NA	NA
WP_002914189.1|3866237_3867413_-	multidrug efflux RND transporter periplasmic adaptor subunit OqxA	NA	NA	NA	NA	NA
WP_004193671.1|3867746_3868109_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004174789.1|3868119_3868692_-	flavin oxidoreductase	NA	NA	NA	NA	NA
WP_004180957.1|3868903_3869788_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004180956.1|3869912_3870713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032422783.1|3871173_3872085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032422782.1|3872089_3872416_+	STAS-like domain-containing protein	NA	NA	NA	NA	NA
WP_046622185.1|3872461_3873085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032422781.1|3873091_3874267_-|integrase	site-specific integrase	integrase	I6PDJ1	Cronobacter_phage	91.7	1.4e-205
WP_032422780.1|3874221_3874434_-	hypothetical protein	NA	I6PBM8	Cronobacter_phage	76.1	1.2e-25
WP_004218013.1|3874491_3874605_-	hypothetical protein	NA	A0A286S2B6	Klebsiella_phage	100.0	4.6e-13
WP_023317194.1|3874700_3874925_-	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	90.5	2.4e-29
WP_032415174.1|3874914_3875640_-	DNA-binding protein	NA	A0A286S260	Klebsiella_phage	99.6	1.4e-131
WP_021441619.1|3875645_3876164_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	99.4	1.3e-94
WP_032422777.1|3876204_3876636_-	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	99.3	1.2e-77
WP_004146412.1|3876632_3876755_-	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	100.0	1.3e-16
WP_004177206.1|3876822_3877077_-	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	92.9	2.5e-38
WP_072199346.1|3877069_3877231_-	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	94.3	5.6e-20
WP_004177202.1|3877435_3877660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004177197.1|3877842_3878256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004177195.1|3878418_3879093_-	LexA family transcriptional regulator	NA	A0A1B5FPF4	Escherichia_phage	79.2	3.3e-98
WP_071533764.1|3879233_3879467_+	Cro/Cl family transcriptional regulator	NA	A0A1B5FPK9	Escherichia_phage	63.9	2.2e-17
WP_004177192.1|3880185_3881844_+	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	96.0	0.0e+00
WP_004177191.1|3881845_3882808_+	DNA primase	NA	A0A286N2Q0	Klebsiella_phage	98.4	9.9e-181
WP_004177190.1|3882804_3883281_+	hypothetical protein	NA	A0A286N2Q1	Klebsiella_phage	98.1	2.9e-88
WP_032422771.1|3883277_3884060_+	antitermination protein	NA	F1C595	Cronobacter_phage	77.9	1.9e-113
WP_004177186.1|3884256_3884502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031280382.1|3884787_3885087_+|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	99.0	2.9e-46
WP_004177182.1|3885083_3885623_+	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	98.3	2.0e-101
WP_004177180.1|3885619_3885967_+	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	83.5	1.9e-41
WP_004177178.1|3885963_3886239_+	hypothetical protein	NA	A0A286N2Q8	Klebsiella_phage	96.7	8.4e-08
WP_004177174.1|3886474_3886759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004177172.1|3886891_3887164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004177168.1|3887474_3887675_+	hypothetical protein	NA	A0A1L6Z528	Klebsiella_phage	75.0	3.4e-19
WP_004177166.1|3888072_3888318_+	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	63.0	4.7e-18
WP_004177164.1|3888373_3888715_+	HNH endonuclease	NA	K7P7P4	Enterobacteria_phage	73.9	3.0e-47
WP_004177162.1|3888898_3889363_+|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	61.4	3.7e-48
WP_032422769.1|3889316_3891059_+|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	46.2	1.3e-141
WP_004177155.1|3891058_3892366_+|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	85.7	4.9e-215
WP_023317649.1|3892379_3893228_+|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	89.6	3.0e-136
WP_032422768.1|3893237_3894455_+|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	87.9	4.8e-196
WP_032415158.1|3894766_3895093_+|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	70.4	2.8e-42
WP_032415156.1|3895104_3895443_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	74.1	1.4e-41
WP_019705270.1|3895439_3895889_+	HK97 gp10 family phage protein	NA	Q9MCS9	Enterobacteria_phage	82.6	6.7e-63
WP_016530186.1|3895885_3896233_+	DUF3168 domain-containing protein	NA	K7PKL6	Enterobacterial_phage	63.7	2.8e-32
WP_032415154.1|3896289_3896994_+	immunoglobulin domain-containing protein	NA	K7PHL2	Enterobacterial_phage	66.9	1.5e-80
WP_032415153.1|3897024_3897429_+|tail	phage tail protein	tail	K7PKV6	Enterobacterial_phage	57.7	6.5e-33
WP_032415151.1|3897431_3897737_+	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	65.7	8.1e-28
WP_032415149.1|3897811_3898195_+	hypothetical protein	NA	A0A0M4QWT0	Salmonella_phage	53.9	3.1e-32
WP_032422764.1|3898261_3901672_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	43.2	2.5e-194
WP_004177132.1|3901692_3902166_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	62.1	1.4e-55
WP_004864228.1|3902152_3902629_+	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	65.8	4.8e-51
WP_032422763.1|3902641_3903022_+	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	79.4	6.1e-57
WP_032422762.1|3903018_3906096_+	kinase	NA	A0A286S259	Klebsiella_phage	61.5	0.0e+00
WP_022615520.1|3906168_3908322_+	hypothetical protein	NA	B5TAB2	Burkholderia_phage	42.2	6.2e-90
WP_022615521.1|3908334_3909069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022615522.1|3909124_3909769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004214894.1|3909936_3910236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077254726.1|3910238_3910727_+	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	94.2	9.8e-76
WP_020947224.1|3911491_3911740_-	DinI-like family protein	NA	S5MQI1	Escherichia_phage	69.1	1.4e-25
WP_002914164.1|3912516_3912999_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
WP_031281023.1|3913109_3913586_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_004145682.1|3913575_3913866_+	RnfH family protein	NA	NA	NA	NA	NA
WP_002914160.1|3913932_3914274_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_004145681.1|3914255_3914396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004180954.1|3914421_3916083_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_002914158.1|3916169_3917048_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_002914155.1|3917172_3917763_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_004149392.1|3917882_3919169_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_002914153.1|3919188_3919980_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_002914152.1|3920143_3921508_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_002914149.1|3921767_3922016_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_004180952.1|3922034_3922583_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_002914147.1|3922614_3923382_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_002914145.1|3923421_3923769_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_032408708.1|3923761_3923902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002914119.1|3923888_3924347_+	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_004180951.1|3924403_3925774_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_004145671.1|3925782_3926265_-	OmpA family protein	NA	NA	NA	NA	NA
WP_004180950.1|3926278_3927502_-	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_004174804.1|3927494_3928004_-	YfiR family protein	NA	NA	NA	NA	NA
WP_002914114.1|3928346_3929417_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.5	1.8e-90
WP_002914113.1|3929426_3930548_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_004174805.1|3930610_3931483_+	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_004150975.1|3931479_3932640_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_100250063.1|3932740_3932788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002914111.1|3932894_3933230_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_004145664.1|3933500_3934238_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_004180948.1|3935345_3936077_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_004150973.1|3936206_3938780_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.4	6.9e-128
WP_004144368.1|3944842_3946141_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	31.5	4.1e-44
WP_002914095.1|3946144_3946468_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_004180947.1|3946509_3947865_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
3946696:3946712	attR	GATCAGAATGGCGTTTT	NA	NA	NA	NA
WP_004144363.1|3947985_3950637_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_002914092.1|3950671_3951370_-	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_002914091.1|3951439_3951865_-	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	40.2	6.0e-13
WP_002914089.1|3952068_3953154_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
>prophage 4
NZ_CP016926	Klebsiella pneumoniae isolate 23 chromosome, complete genome	5236925	4117454	4177329	5236925	holin,integrase,protease,tRNA,portal,terminase,tail	Enterobacterial_phage(21.62%)	64	4140462:4140485	4181176:4181199
WP_004145598.1|4117454_4118873_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_002913435.1|4118924_4119317_-	putative DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_002913434.1|4119320_4119674_-	putative DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_004151096.1|4120295_4122467_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_002913423.1|4122515_4123718_-	nucleoside permease NupC	NA	NA	NA	NA	NA
WP_002913421.1|4124064_4125306_+	Mn(2+) uptake NRAMP transporter MntH	NA	NA	NA	NA	NA
WP_002913419.1|4125363_4125723_-	DUF2502 domain-containing protein	NA	NA	NA	NA	NA
WP_069012970.1|4125853_4126846_-	L-glyceraldehyde 3-phosphate reductase	NA	NA	NA	NA	NA
WP_004174935.1|4127026_4128688_+	indolepyruvate decarboxylase	NA	NA	NA	NA	NA
WP_004180794.1|4128684_4129920_-	ion channel protein	NA	NA	NA	NA	NA
WP_002913377.1|4130183_4131149_+	glucokinase	NA	NA	NA	NA	NA
WP_004145587.1|4131202_4131955_-	response regulator transcription factor	NA	A0A2R2ZGH8	Clostridioides_phage	26.3	1.5e-14
WP_004149230.1|4131951_4133649_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	28.5	6.7e-47
WP_020324249.1|4133647_4133761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032422755.1|4133757_4133943_-	phytanoyl-CoA dioxygenase	NA	NA	NA	NA	NA
WP_002913372.1|4134031_4135246_+	alanine transaminase	NA	NA	NA	NA	NA
WP_099119320.1|4135316_4135388_-	membrane protein YpdK	NA	NA	NA	NA	NA
WP_004180792.1|4135726_4136923_-	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_004180790.1|4136919_4137378_-	nucleoside deaminase	NA	A0A0B5J096	Pandoravirus	33.1	1.9e-12
WP_004180788.1|4137510_4138419_+	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	23.4	1.5e-08
WP_004180785.1|4138428_4139310_-	hypothetical protein	NA	A0A2H4JEC4	uncultured_Caudovirales_phage	56.8	1.5e-05
WP_004174945.1|4139678_4140161_-	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
4140462:4140485	attL	TATATCCATTTAACTAAGGGGACA	NA	NA	NA	NA
WP_032422754.1|4140679_4141864_+|integrase	site-specific integrase	integrase	A0A2R2Z2Y0	Escherichia_phage	82.7	5.5e-197
WP_117093970.1|4141888_4142818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032422886.1|4143521_4144385_-	DNA-binding protein	NA	A0A2H4J902	uncultured_Caudovirales_phage	58.2	2.0e-71
WP_032422751.1|4144466_4145279_-	DUF2303 family protein	NA	NA	NA	NA	NA
WP_032422750.1|4145322_4145682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032422749.1|4146117_4147053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071961345.1|4147027_4147288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032422885.1|4147870_4148545_-	LexA family transcriptional regulator	NA	U5P0T5	Shigella_phage	86.8	3.3e-114
WP_029497185.1|4148635_4148836_+	transcriptional regulator	NA	U5P445	Shigella_phage	76.9	2.8e-21
WP_032422748.1|4148879_4149395_+	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	63.4	2.6e-58
WP_032422747.1|4149873_4150149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032422746.1|4150141_4151671_+	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	66.9	6.6e-203
WP_032422744.1|4151667_4152639_+	DNA primase	NA	A0A286N2Q0	Klebsiella_phage	61.1	2.1e-109
WP_050486134.1|4152608_4153253_+	NinG family protein	NA	A0A1W6JNX3	Morganella_phage	54.3	1.9e-39
WP_032422743.1|4153249_4153891_+	DNA methyltransferase	NA	I6PDF5	Cronobacter_phage	68.9	1.3e-83
WP_032422742.1|4153887_4154466_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	57.2	1.7e-50
WP_050486133.1|4154539_4155136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017145563.1|4155265_4155661_+	membrane protein	NA	K7PHB9	Enterobacterial_phage	98.5	2.6e-63
WP_019705280.1|4155647_4155929_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	80.6	3.9e-37
WP_032422741.1|4155928_4156558_+	glycoside hydrolase family 19 protein	NA	F1C591	Cronobacter_phage	74.4	2.7e-86
WP_032408643.1|4156560_4156836_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	70.8	1.3e-24
WP_071961346.1|4157073_4157415_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_032422739.1|4157558_4157804_+	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	96.3	9.3e-35
WP_111273836.1|4158029_4158290_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032422738.1|4158863_4159355_+	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	83.4	1.4e-66
WP_032422737.1|4159354_4161463_+|terminase	phage terminase large subunit family protein	terminase	K7PH52	Enterobacterial_phage	83.6	0.0e+00
WP_032422736.1|4161459_4161675_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	78.6	1.5e-25
WP_032422735.1|4161671_4163171_+|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	83.4	4.3e-247
WP_032422733.1|4163115_4165131_+|protease	Clp protease ClpP	protease	K7PKX4	Enterobacterial_phage	84.1	0.0e+00
WP_032422732.1|4165211_4165538_+	DUF2190 family protein	NA	K7PJY3	Enterobacterial_phage	67.3	8.1e-34
WP_032422731.1|4165530_4165824_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_032422729.1|4165813_4166365_+|tail	phage tail protein	tail	K7P7A8	Enterobacteria_phage	67.3	4.5e-53
WP_020804325.1|4166361_4166760_+|tail	phage tail protein	tail	K7PHM6	Enterobacterial_phage	57.8	3.2e-40
WP_023304948.1|4166767_4167250_+	hypothetical protein	NA	M9NYX0	Enterobacteria_phage	68.6	5.7e-60
WP_032422728.1|4167292_4167688_+|tail	phage tail protein	tail	M9NZD7	Enterobacteria_phage	27.5	2.4e-08
WP_032420719.1|4167708_4168026_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	51.5	1.4e-19
WP_032422727.1|4168006_4170703_+|tail	phage tail tape measure protein	tail	K7PKR0	Enterobacteria_phage	62.6	1.3e-201
WP_071961347.1|4170702_4171176_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	60.9	1.7e-53
WP_032422726.1|4171162_4171645_+	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	97.5	2.1e-83
WP_032422725.1|4171654_4172035_+	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	95.2	4.0e-69
WP_032422724.1|4172031_4175100_+	kinase	NA	A0A286S259	Klebsiella_phage	97.5	0.0e+00
WP_069012971.1|4175175_4177329_+	hypothetical protein	NA	B5TAB2	Burkholderia_phage	42.2	3.6e-90
4181176:4181199	attR	TATATCCATTTAACTAAGGGGACA	NA	NA	NA	NA
>prophage 5
NZ_CP016926	Klebsiella pneumoniae isolate 23 chromosome, complete genome	5236925	4401809	4408714	5236925	tRNA	Planktothrix_phage(33.33%)	6	NA	NA
WP_004180551.1|4401809_4402673_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
WP_004180550.1|4402683_4403457_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
WP_004151134.1|4403697_4404594_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_004144192.1|4404836_4406198_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.8	1.8e-207
WP_004175198.1|4406516_4407239_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_004149058.1|4407235_4408714_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
>prophage 1
NZ_CP016924	Klebsiella pneumoniae isolate 23 plasmid pIncFIB_DHQP1400954, complete sequence	111539	27	111488	111539	integrase,portal,tail,terminase	Salmonella_phage(90.72%)	118	18640:18656	53723:53739
WP_014342134.1|27_456_+	Ig domain-containing protein	NA	J9Q6D6	Salmonella_phage	71.6	7.9e-29
WP_014342133.1|431_620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072196922.1|638_938_+	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	81.8	3.8e-38
WP_032439750.1|937_1771_+	hypothetical protein	NA	J9Q7R2	Salmonella_phage	84.1	2.2e-131
WP_004109848.1|1868_2213_+	hypothetical protein	NA	J9Q7F6	Salmonella_phage	92.1	7.4e-54
WP_004109845.1|2203_2677_+	hypothetical protein	NA	J9Q711	Salmonella_phage	93.6	1.9e-76
WP_014342130.1|2678_3071_+	hypothetical protein	NA	J9Q6D8	Salmonella_phage	69.0	5.3e-48
WP_004109839.1|3138_3885_+	Ig domain-containing protein	NA	J9Q7Y4	Salmonella_phage	83.0	3.7e-106
WP_004109835.1|3946_4264_+	hypothetical protein	NA	J9Q7R3	Salmonella_phage	93.3	1.8e-46
WP_014342129.1|4389_4614_+	hypothetical protein	NA	J9Q7F7	Salmonella_phage	93.2	2.0e-31
WP_048292502.1|4621_9157_+	tape measure protein	NA	J9Q712	Salmonella_phage	69.7	0.0e+00
WP_032439754.1|9200_9536_+|tail	tail protein	tail	J9Q6E1	Salmonella_phage	83.6	5.7e-51
WP_004109820.1|9622_10321_+|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	87.4	1.2e-122
WP_004109817.1|10313_11111_+|tail	tail protein	tail	J9Q7R4	Salmonella_phage	85.3	5.4e-140
WP_019704527.1|11098_11710_+|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	72.1	1.1e-76
WP_069012944.1|11726_23897_+	DUF1983 domain-containing protein	NA	J9Q713	Salmonella_phage	59.8	2.8e-30
18640:18656	attL	CTGATGACTCGCATGGC	NA	NA	NA	NA
WP_032439760.1|23949_25395_+|tail	tail fiber domain-containing protein	tail	A0A0H4TGH1	Klebsiella_phage	37.1	1.3e-38
WP_004109805.1|25490_25814_+	hypothetical protein	NA	J9Q6E7	Salmonella_phage	95.3	2.3e-49
WP_060613503.1|25827_26520_+	hypothetical protein	NA	J9Q7Y7	Salmonella_phage	88.7	1.3e-118
WP_032439763.1|26522_26774_+	hypothetical protein	NA	J9Q7R6	Salmonella_phage	74.7	1.2e-24
WP_072199353.1|26766_26922_+	hypothetical protein	NA	J9Q7G2	Salmonella_phage	62.7	4.8e-13
WP_072199352.1|26976_27498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014342116.1|27737_28403_+	P-loop NTPase	NA	J9Q7R7	Salmonella_phage	83.3	8.3e-102
WP_014342115.1|28408_28765_+	hypothetical protein	NA	J9Q7G3	Salmonella_phage	97.9	1.4e-44
WP_014342113.1|29170_29605_+	hypothetical protein	NA	J9Q719	Salmonella_phage	42.9	3.7e-18
WP_014342112.1|29846_30008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014342111.1|30190_30916_+	hypothetical protein	NA	J9Q7R8	Salmonella_phage	88.4	1.3e-127
WP_014342110.1|30980_32321_+	AAA family ATPase	NA	J9Q7G4	Salmonella_phage	95.7	7.0e-241
WP_072196452.1|32468_33593_+	DNA primase	NA	J9Q720	Salmonella_phage	91.6	6.3e-203
WP_032439771.1|33635_34802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032439773.1|35090_35879_+	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	51.1	6.9e-71
WP_050484893.1|35958_36426_+	hypothetical protein	NA	J9Q7R9	Salmonella_phage	63.9	7.5e-49
WP_014342105.1|36425_37748_+	putative DNA ligase	NA	J9Q7G5	Salmonella_phage	85.2	4.8e-226
WP_014342104.1|37759_37924_+	hypothetical protein	NA	J9Q729	Salmonella_phage	72.5	6.7e-13
WP_014342099.1|38297_38687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014342097.1|39982_41572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071571097.1|41776_42586_+	phosphate starvation-inducible protein PhoH	NA	W8D063	Erwinia_phage	65.0	6.8e-90
WP_014342095.1|42593_42962_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	47.4	1.0e-13
WP_014342094.1|43056_43662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014342093.1|43671_44082_+	toxin YafO	NA	NA	NA	NA	NA
WP_019704541.1|44146_44506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032439777.1|44855_45956_+|integrase	site-specific integrase	integrase	A0A1P8DTG6	Proteus_phage	30.0	9.4e-18
WP_014342091.1|45950_46331_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_014342090.1|46604_46817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032439779.1|46933_49213_+	porphyrin biosynthesis protein	NA	J9Q7G6	Salmonella_phage	63.2	1.7e-247
WP_032439780.1|49309_50542_+	AAA domain-containing protein	NA	J9Q733	Salmonella_phage	86.4	2.2e-212
WP_060613611.1|50722_54241_+	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	93.2	0.0e+00
53723:53739	attR	CTGATGACTCGCATGGC	NA	NA	NA	NA
WP_072199362.1|54255_54681_+	hypothetical protein	NA	J9Q7S4	Salmonella_phage	80.9	7.5e-56
WP_032439695.1|54780_55755_-	FRG domain-containing protein	NA	NA	NA	NA	NA
WP_032439697.1|55859_56507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032439785.1|56657_57089_+	hypothetical protein	NA	J9Q6I8	Salmonella_phage	91.4	3.4e-64
WP_032439699.1|57208_58216_+	hypothetical protein	NA	J9Q7Z3	Salmonella_phage	88.6	5.4e-145
WP_014342079.1|58276_59221_+	exonuclease	NA	J9Q7S6	Salmonella_phage	93.0	1.1e-171
WP_019704549.1|59220_59487_+	hypothetical protein	NA	J9Q7G8	Salmonella_phage	84.1	1.7e-34
WP_072196934.1|59516_60566_+	recombinase	NA	J9Q736	Salmonella_phage	96.3	5.5e-193
WP_014342076.1|60736_60913_+	hypothetical protein	NA	J9Q7G9	Salmonella_phage	68.8	4.7e-12
WP_014342075.1|60996_61611_+	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	67.6	2.3e-37
WP_014342074.1|61610_61823_+	hypothetical protein	NA	J9Q7S8	Salmonella_phage	80.0	4.3e-28
WP_014342073.1|62274_63492_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	47.3	1.3e-73
WP_014342193.1|63692_64337_+	hypothetical protein	NA	J9Q739	Salmonella_phage	80.7	8.3e-99
WP_019704555.1|64650_66210_-	DUF4041 domain-containing protein	NA	X5JAC1	Clostridium_phage	52.3	6.6e-57
WP_014342190.1|66208_66364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014342189.1|66747_66864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014342188.1|66862_67948_+	exonuclease	NA	J9Q7S9	Salmonella_phage	84.2	2.0e-182
WP_014342187.1|67947_68181_+	hypothetical protein	NA	J9Q7H1	Salmonella_phage	66.1	3.4e-18
WP_160333948.1|69734_70094_+	hypothetical protein	NA	J9Q741	Salmonella_phage	95.0	2.4e-55
WP_014342184.1|70119_70830_+	hypothetical protein	NA	J9Q6J5	Salmonella_phage	57.6	2.8e-71
WP_014342183.1|70839_71409_+	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	90.5	3.8e-95
WP_060613609.1|71484_73788_+	ribonucleoside-diphosphate reductase subunit alpha	NA	J9Q7T0	Salmonella_phage	90.8	0.0e+00
WP_014342181.1|73918_75061_+	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	95.8	9.0e-213
WP_014342180.1|75138_76014_+	nucleoside triphosphate pyrophosphohydrolase family protein	NA	J9Q742	Salmonella_phage	84.7	4.5e-140
WP_014342179.1|76207_77311_+	thymidylate synthase	NA	J9Q6J6	Salmonella_phage	79.8	2.5e-180
WP_014342178.1|77330_77726_+	hypothetical protein	NA	J9Q7Z8	Salmonella_phage	74.8	2.6e-50
WP_014342177.1|77728_78199_+	dihydrofolate reductase	NA	J9Q7T1	Salmonella_phage	78.7	2.0e-70
WP_014342176.1|78198_78843_+	AAA family ATPase	NA	J9Q7H4	Salmonella_phage	76.6	6.8e-93
WP_023279504.1|78906_79326_+	hypothetical protein	NA	J9Q743	Salmonella_phage	74.1	6.5e-52
WP_014342174.1|79335_79893_+	3'-5' exonuclease	NA	J9Q6J8	Salmonella_phage	84.2	1.4e-86
WP_019704562.1|80018_80852_+	hypothetical protein	NA	J9Q7Z9	Salmonella_phage	53.1	1.2e-62
WP_019704563.1|81036_81630_+	phage N-6-adenine-methyltransferase	NA	J9Q7T2	Salmonella_phage	84.3	6.5e-98
WP_019704564.1|81827_82061_+	hypothetical protein	NA	J9Q7H5	Salmonella_phage	84.2	2.7e-31
WP_019704565.1|82633_83221_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	80.2	3.4e-91
WP_019704567.1|84218_84644_+	tellurite/colicin resistance protein	NA	Q71TK7	Escherichia_phage	80.9	9.8e-56
WP_014342167.1|84643_84799_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	61.2	1.7e-05
WP_019704569.1|84926_85505_+	hypothetical protein	NA	J9Q7H6	Salmonella_phage	57.0	3.9e-55
WP_060613607.1|85633_87319_+	DUF4942 domain-containing protein	NA	J9Q747	Salmonella_phage	91.3	0.0e+00
WP_048292526.1|87407_88109_+	hypothetical protein	NA	J9Q6K2	Salmonella_phage	69.7	4.0e-78
WP_019704572.1|88260_88524_+	hypothetical protein	NA	J9Q7T5	Salmonella_phage	70.5	1.7e-29
WP_019704573.1|88770_89130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071786700.1|89403_89832_+	S-(hydroxymethyl)glutathione synthase	NA	NA	NA	NA	NA
WP_019704574.1|89976_90723_-	NYN domain-containing protein	NA	NA	NA	NA	NA
WP_019704575.1|91337_91655_+	hypothetical protein	NA	J9Q750	Salmonella_phage	74.3	9.2e-43
WP_019704576.1|91825_93052_+	hypothetical protein	NA	J9Q803	Salmonella_phage	54.2	1.6e-119
WP_072198667.1|93848_93971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019704577.1|94600_94819_+	hypothetical protein	NA	J9Q6K7	Salmonella_phage	81.9	2.9e-27
WP_023279445.1|94831_95044_+	hypothetical protein	NA	J9Q804	Salmonella_phage	77.9	4.4e-25
WP_072199357.1|95192_95492_+	hypothetical protein	NA	J9Q7T7	Salmonella_phage	68.7	5.0e-30
WP_072196390.1|95599_96019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072196389.1|96229_96427_+	hypothetical protein	NA	J9Q753	Salmonella_phage	80.0	6.4e-26
WP_032439735.1|96454_96643_-	hypothetical protein	NA	E5FFJ6	Burkholderia_phage	61.1	1.1e-11
WP_021313140.1|96868_97351_+	hypothetical protein	NA	J9Q805	Salmonella_phage	70.6	1.3e-64
WP_004109904.1|97942_98146_-	hypothetical protein	NA	J9Q7I3	Salmonella_phage	95.5	4.1e-28
WP_004109892.1|98196_98847_-	hypothetical protein	NA	J9Q754	Salmonella_phage	91.7	8.4e-107
WP_123827665.1|99171_99471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014342147.1|99480_100011_-	transcriptional regulator	NA	J9Q6L0	Salmonella_phage	84.5	3.5e-71
WP_014342146.1|100169_100604_+	hypothetical protein	NA	A0A1V0E7W1	Vibrio_phage	36.4	9.5e-14
WP_014342145.1|100654_100930_-	hypothetical protein	NA	J9Q7T9	Salmonella_phage	68.1	4.0e-26
WP_021313133.1|100932_102492_-	DEAD/DEAH box helicase	NA	J9Q7I4	Salmonella_phage	92.9	1.2e-279
WP_050484892.1|102551_103256_+	ParB N-terminal domain-containing protein	NA	J9Q756	Salmonella_phage	89.3	2.8e-108
WP_060613515.1|103255_103924_+	ParB N-terminal domain-containing protein	NA	J9Q6L1	Salmonella_phage	91.0	2.5e-106
WP_019704584.1|103920_104559_+	ATP-binding cassette domain-containing protein	NA	J9Q807	Salmonella_phage	97.6	1.4e-109
WP_019704585.1|104551_104806_+	hypothetical protein	NA	J9Q7U0	Salmonella_phage	96.4	2.0e-40
WP_004109872.1|104811_105702_+	hypothetical protein	NA	J9Q7I6	Salmonella_phage	97.0	5.4e-165
WP_004109869.1|105711_105978_+	hypothetical protein	NA	J9Q757	Salmonella_phage	90.9	1.3e-37
WP_004109866.1|106153_106795_+	DNA-binding protein	NA	J9Q6D4	Salmonella_phage	88.2	5.0e-96
WP_004109863.1|106797_108054_+|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	97.4	9.4e-248
WP_048292499.1|108086_109661_+|portal	phage portal protein	portal	J9Q7R1	Salmonella_phage	88.2	2.8e-273
WP_014342135.1|109683_110583_+	hypothetical protein	NA	J9Q7F4	Salmonella_phage	82.6	1.0e-123
WP_004109857.1|110609_111488_+	hypothetical protein	NA	J9Q710	Salmonella_phage	94.2	4.7e-153
>prophage 1
NZ_CP016927	Klebsiella pneumoniae isolate 23 plasmid pIncL_M_DHQP1400954, complete sequence	72093	23846	55654	72093	integrase,transposase	Salmonella_phage(13.33%)	44	18004:18022	41937:41955
18004:18022	attL	TGTTCAAATATGAACATTT	NA	NA	NA	NA
WP_015586042.1|23846_24548_+|transposase	IS1-like element ISPa14 family transposase	transposase	A0A218MNG1	uncultured_virus	55.0	9.9e-37
WP_015586041.1|25202_25982_-	APH(3')-VI family aminoglycoside O-phosphotransferase	NA	E4ZFP6	Streptococcus_phage	35.1	1.1e-31
WP_036970840.1|25994_26210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001082319.1|26209_27013_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_077270329.1|27078_27621_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	46.7	1.2e-29
WP_001067855.1|27656_28361_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004187345.1|28711_28942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004206912.1|29039_29378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000608644.1|29722_30985_+|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_014342101.1|31132_31255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001617865.1|31234_32110_+	class A extended-spectrum beta-lactamase CTX-M-14	NA	A0A1B0VBP7	Salmonella_phage	99.6	6.1e-153
WP_004206911.1|32667_33528_-	DUF4942 domain-containing protein	NA	I6RTT5	Marinomonas_phage	29.9	2.8e-17
WP_004187364.1|33600_33780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004187367.1|34456_34723_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_052170007.1|34767_35178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004206907.1|35326_35737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004206906.1|35765_36245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004206905.1|36237_36483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004187378.1|36861_37425_-	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	31.3	5.2e-20
WP_004206904.1|37434_37878_-	chromosome partitioning protein ParB	NA	NA	NA	NA	NA
WP_011091047.1|37880_38855_-	hypothetical protein	NA	A0A0A7NPX4	Enterobacteria_phage	52.0	6.1e-85
WP_004187383.1|39095_39836_-|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	51.6	9.5e-22
WP_020316874.1|39854_40058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004187390.1|40099_40585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004206901.1|40581_41169_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_004187394.1|41161_41410_-	helix-turn-helix transcriptional regulator	NA	A0A248SLB9	Klebsiella_phage	53.0	1.6e-10
WP_069012986.1|41406_41868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004206899.1|42008_42554_+	hypothetical protein	NA	NA	NA	NA	NA
41937:41955	attR	AAATGTTCATATTTGAACA	NA	NA	NA	NA
WP_004206898.1|42706_43114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015062853.1|43115_43694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015586034.1|43671_44028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015059996.1|44555_45743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015059995.1|45761_46034_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_015059994.1|46030_46714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004187411.1|46758_46977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004187413.1|46979_47189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015059993.1|47311_48616_-	translesion error-prone DNA polymerase V subunit UmuC	NA	A0A1W6JNT0	Morganella_phage	50.1	7.8e-112
WP_004187425.1|48564_48999_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	55.3	1.2e-29
WP_020277900.1|49091_49457_-	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_004187429.1|49425_49683_-	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_011790968.1|50014_51265_-|transposase	IS4-like element IS10A family transposase	transposase	Q9E8P4	Bluetongue_virus	71.4	4.2e-171
WP_015586033.1|51525_52437_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015059991.1|52738_53536_-	carbapenem-hydrolyzing class D beta-lactamase OXA-48	NA	NA	NA	NA	NA
WP_025987686.1|54448_55654_+|transposase	IS4 family transposase	transposase	Q9E8P4	Bluetongue_virus	72.0	9.9e-170
>prophage 1
NZ_CP016925	Klebsiella pneumoniae isolate 23 plasmid pCTXM15_DHQP1400954, complete sequence	63291	0	62042	63291	transposase,integrase	Escherichia_phage(33.33%)	65	13920:13979	36513:37332
WP_004197639.1|481_1498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004197641.1|1494_1818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072199347.1|1844_2246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004197633.1|2414_2720_-	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_004197642.1|2721_2940_-	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_019725036.1|3535_3784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015065504.1|3780_4353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009310053.1|4383_4878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015065502.1|4921_5290_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019725040.1|5323_5527_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_019725034.1|5540_5771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019725033.1|5814_6009_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019725650.1|6442_6766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019725651.1|6838_7834_-	hypothetical protein	NA	A0A2H4UVR4	Bodo_saltans_virus	34.9	2.1e-32
WP_015065500.1|8130_8781_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.6	1.8e-77
WP_001695382.1|8827_9169_-	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	50.0	3.4e-19
WP_001067855.1|9281_9986_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_011977766.1|11006_11342_-	C2H2-type zinc finger protein	NA	NA	NA	NA	NA
WP_001568067.1|11514_11796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000176305.1|11849_12461_+	DUF2913 family protein	NA	NA	NA	NA	NA
WP_011977825.1|12457_12619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001445937.1|12645_13602_-	hypothetical protein	NA	NA	NA	NA	NA
13920:13979	attL	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTG	NA	NA	NA	NA
WP_001067855.1|13982_14687_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000427619.1|16285_17290_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_000954592.1|17471_17648_-	DUF4102 domain-containing protein	NA	T1S9J3	Salmonella_phage	68.6	1.0e-06
WP_001043260.1|17977_18793_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_001082319.1|18853_19657_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_000480968.1|19656_20493_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001120891.1|20464_21004_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000027057.1|21213_22074_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001235713.1|22256_22814_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_000608644.1|23377_24640_+|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_000239590.1|24895_25771_+	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
WP_001393253.1|25817_26150_-	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
WP_001067855.1|29028_29733_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001288432.1|30051_31485_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	7.0e-106
WP_004098817.1|31518_32733_-	type II site-specific deoxyribonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
WP_069012945.1|32993_33758_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	5.6e-86
WP_001144737.1|33900_34167_-	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_004201280.1|34387_34861_-	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	8.4e-16
WP_000845048.1|35016_36030_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001067855.1|36575_37280_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_014386481.1|38152_38797_-	quinolone resistance pentapeptide repeat protein QnrB1	NA	NA	NA	NA	NA
36513:37332	attR	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTGCACATGAACCCATTCAAAGGCCGGCATTTTCAGCGTGACATCATTCTGTGGGCCGTACGCTGGTACTGCAAATACGGCATCAGTTACCGTGAGCTGCAGGAGATGCTGGCTGAACGCGGAGTGAATGTCGATCACTCCACGATTTACCGCTGGGTTCAGCGTTATGCGCCTGAAATGGAAAAACGGCTGCGCTGGTACTGGCGTAACCCTTCCGATCTTTGCCCGTGGCACATGGATGAAACCTACGTGAAGGTCAATGGCCGCTGGGCGTATCTGTACCGGGCCGTCGACAGCCGGGGCCGCACTGTCGATTTTTATCTCTCCTCCCGTCGTAACAGCAAAGCTGCATACCGGTTTCTGGGTAAAATCCTCAACAACGTGAAGAAGTGGCAGATCCCGCGATTCATCAACACGGATAAAGCGCCCGCCTATGGTCGCGCGCTTGCTCTGCTCAAACGCGAAGGCCGGTGCCCGTCTGACGTTGAACACCGACAGATTAAGTACCGGAACAACGTGATTGAATGCGATCATGGCAAACTGAAACGGATAATCGGCGCCACGCTGGGATTTAAATCCATGAAGACGGCTTACGCCACCATCAAAGGTATTGAGGTGATGCGTGCACTACGCAAAGGCCAGGCCTCAGCATTTTATTATGGTGATCCCCTGGGCGAAATGCGCCTGGTAAGCAGAGTTTTTGAAATGTAAGGCCTTTGAATAAGACAAAAGGCTGCCTCATCGCTAACTTTGCAACAGTGCC	NA	NA	NA	NA
WP_001553819.1|41204_44102_-|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	4.2e-182
WP_000509965.1|44196_44802_+	recombinase family protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	9.4e-20
WP_001351729.1|45578_45971_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_000058717.1|46108_46993_+	EamA family transporter	NA	NA	NA	NA	NA
WP_000804064.1|47024_48224_-	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_000164043.1|48329_48980_+	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_000844627.1|49011_49254_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001067855.1|50891_51596_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_015065509.1|51912_52578_-	DUF1472 domain-containing protein	NA	NA	NA	NA	NA
WP_015065508.1|52592_52949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013214013.1|53020_53788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001568043.1|53841_54261_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001568042.1|54270_54492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152355.1|54491_55193_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.7	7.1e-27
WP_014343518.1|55394_55511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001568040.1|55629_55860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032330269.1|55922_56594_-	Mediator of plasmid stability	NA	NA	NA	NA	NA
WP_004152353.1|56596_57568_-	mediator of plasmid stability	NA	A0A222YXF2	Escherichia_phage	46.8	1.1e-73
WP_001568036.1|57801_58233_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	2.1e-29
WP_004197646.1|58232_59504_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	64.0	5.2e-153
WP_004197644.1|59915_60791_+	RepB family plasmid replication initiator protein	NA	Q71TL8	Escherichia_phage	56.8	1.1e-82
WP_004197649.1|61415_62042_+	ParA family plasmid-partitioning AAA ATPase	NA	A0A222YXS3	Escherichia_phage	43.6	2.9e-40
