The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP016944	Yersinia enterocolitica strain YE3 chromosome, complete genome	4664930	93962	174963	4664930	protease,transposase,bacteriocin	Enterobacterial_phage(33.33%)	53	NA	NA
WP_057618920.1|93962_94214_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_005162673.1|94496_94751_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_005162670.1|95063_95423_+	antitermination protein	NA	K7PGW2	Enterobacterial_phage	47.5	1.7e-21
WP_032904442.1|95525_96284_-	molecular chaperone	NA	NA	NA	NA	NA
WP_069008913.1|100398_101127_-	molecular chaperone	NA	NA	NA	NA	NA
WP_049525161.1|101271_102303_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_005165289.1|103245_104208_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_049528679.1|104241_104715_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_049528676.1|105963_106818_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_005165296.1|107046_107415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129019424.1|107478_107631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005166182.1|109077_110541_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_069008916.1|110773_112180_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_016266334.1|114143_114608_-	Large exoprotein involved in heme utilization or adhesion	NA	NA	NA	NA	NA
WP_005166173.1|117276_118809_-	signal transduction histidine-protein kinase/phosphatase UhpB	NA	NA	NA	NA	NA
WP_049528662.1|118805_119396_-	transcriptional regulator UhpA	NA	NA	NA	NA	NA
WP_050127428.1|119507_121199_-	kdo(2)-lipid A phosphoethanolamine 7''-transferase	NA	NA	NA	NA	NA
WP_048618714.1|121458_121884_-	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_023160836.1|122354_123374_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_069008919.1|124185_125793_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005157323.1|126075_127095_+	dipeptide ABC transporter permease DppB	NA	NA	NA	NA	NA
WP_049525223.1|127105_128008_+	dipeptide ABC transporter permease DppC	NA	NA	NA	NA	NA
WP_049525224.1|128023_129004_+	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.9	2.5e-14
WP_005157326.1|129018_130023_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.7	1.7e-18
WP_049525225.1|130365_132018_-	cellulose biosynthesis protein BcsG	NA	NA	NA	NA	NA
WP_005157335.1|132020_132209_-	cellulose biosynthesis protein BcsF	NA	NA	NA	NA	NA
WP_049525226.1|132205_133765_-	cellulose biosynthesis protein BcsE	NA	NA	NA	NA	NA
WP_005157340.1|133962_134154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013650602.1|134157_134895_+	cellulose synthase operon protein YhjQ	NA	NA	NA	NA	NA
WP_049525228.1|134891_137519_+	UDP-forming cellulose synthase catalytic subunit	NA	NA	NA	NA	NA
WP_049528808.1|137529_139833_+	cellulose biosynthesis cyclic di-GMP-binding regulatory protein BcsB	NA	NA	NA	NA	NA
WP_057618858.1|139838_140966_+	cellulase	NA	NA	NA	NA	NA
WP_069008921.1|140947_144322_+	cellulose biosynthesis protein BcsC	NA	NA	NA	NA	NA
WP_069008922.1|144585_146082_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_005157352.1|146806_147511_+	porin	NA	NA	NA	NA	NA
WP_005157353.1|147587_149306_+	pectate lyase	NA	NA	NA	NA	NA
WP_069008923.1|149430_149910_+	discoidin domain-containing protein	NA	NA	NA	NA	NA
WP_005157357.1|150287_151580_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_005157359.1|151994_153485_+	insulinase family protein	NA	NA	NA	NA	NA
WP_005157362.1|153644_154589_-	sugar kinase	NA	NA	NA	NA	NA
WP_004388926.1|154733_154934_-	4-oxalocrotonate tautomerase family protein	NA	NA	NA	NA	NA
WP_049525232.1|155172_155964_+	cyclic-guanylate-specific phosphodiesterase	NA	NA	NA	NA	NA
WP_049525233.1|158238_159003_-	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_049525234.1|159026_160016_-	inner membrane protein YhjD	NA	NA	NA	NA	NA
WP_069008925.1|160432_163675_+	autotransporter adhesin YapE	NA	NA	NA	NA	NA
WP_005157379.1|164033_165386_-	glutathione-disulfide reductase	NA	NA	NA	NA	NA
WP_049525236.1|165629_166472_-	23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ	NA	NA	NA	NA	NA
WP_023160901.1|166808_168851_+	oligopeptidase A	NA	NA	NA	NA	NA
WP_020283527.1|168854_169613_+	16S rRNA (guanine(1516)-N(2))-methyltransferase RsmJ	NA	NA	NA	NA	NA
WP_013650589.1|169679_170921_-|protease	metalloprotease	protease	NA	NA	NA	NA
WP_049525237.1|171143_172487_-	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_005157389.1|172750_173197_-	universal stress protein UspA	NA	NA	NA	NA	NA
WP_023160836.1|173943_174963_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP016944	Yersinia enterocolitica strain YE3 chromosome, complete genome	4664930	451493	583503	4664930	protease,tail,terminase,holin,integrase,tRNA,head,capsid,transposase	Cronobacter_phage(39.47%)	113	451189:451217	538955:538983
451189:451217	attL	CGCCATATATGGACGCTCCCAATAAACCA	NA	NA	NA	NA
WP_042663659.1|451493_452513_-|transposase	IS110-like element ISYen1 family transposase	transposase	NA	NA	NA	NA
WP_005174358.1|452710_453631_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	53.5	8.0e-79
WP_049525329.1|453989_455402_-	anion permease	NA	NA	NA	NA	NA
WP_005163087.1|455911_456124_-	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	80.0	4.4e-25
WP_005163090.1|456395_456608_-	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	80.0	1.7e-24
WP_005163093.1|456989_457460_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_002210061.1|459333_459630_-	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
WP_005163099.1|459650_460616_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_005163101.1|461058_461940_-	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_049525330.1|462031_463486_-	sodium/pantothenate symporter	NA	NA	NA	NA	NA
WP_005163104.1|463475_463718_-	YhdT family protein	NA	NA	NA	NA	NA
WP_005163110.1|463856_465206_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_005163113.1|465217_465682_-	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_049525331.1|465714_466167_-	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_049525332.1|466375_466975_-	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_005163122.1|466974_468009_-	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_005163130.1|468162_469140_-	oxidoreductase	NA	NA	NA	NA	NA
WP_069008954.1|469424_471344_+	RNase E specificity factor CsrD	NA	NA	NA	NA	NA
WP_002228205.1|471678_472722_+	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.0e-06
WP_005163136.1|472821_473808_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_005163138.1|473804_474293_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_005180107.1|474306_474900_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_049525335.1|474889_476359_+	ribonuclease G	NA	NA	NA	NA	NA
WP_069008956.1|476560_480436_+	AsmA2 domain-containing protein	NA	NA	NA	NA	NA
WP_005163159.1|480432_481293_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_049525337.1|481304_482750_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_069008958.1|482803_484090_-	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_013650506.1|484086_484365_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_005163183.1|487934_488294_-	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_020282680.1|488290_488692_-	M15 family metallopeptidase	NA	A9DET4	Yersinia_phage	58.4	1.4e-40
WP_005163187.1|488700_489012_-|holin	holin	holin	R9W0A1	Serratia_phage	51.2	3.1e-19
WP_069008960.1|489088_493591_-	toxin	NA	NA	NA	NA	NA
WP_050127097.1|493647_497178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005163194.1|500847_501759_-	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
WP_005163197.1|502084_502288_+	AaeX family protein	NA	NA	NA	NA	NA
WP_050127093.1|502295_503231_+	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
WP_069008961.1|503232_505188_+	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
WP_049525342.1|505309_506803_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_049525343.1|506900_507374_+	ribonuclease	NA	NA	NA	NA	NA
WP_004392366.1|507378_507645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005163212.1|507676_508222_-	ribosome-associated protein	NA	NA	NA	NA	NA
WP_049525344.1|508359_509352_-|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	60.4	2.8e-109
WP_049525345.1|509418_509718_-	helix-turn-helix transcriptional regulator	NA	Q1JS29	Enterobacteria_phage	74.7	4.6e-36
WP_129019376.1|509827_510160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049525347.1|510286_510508_+	DUF2724 domain-containing protein	NA	NA	NA	NA	NA
WP_049525348.1|510522_510879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049525349.1|510951_511218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049525350.1|511217_512114_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	E5G6L8	Salmonella_phage	51.0	2.8e-76
WP_049525351.1|512110_513148_+	phosphoadenosine phosphosulfate reductase family protein	NA	B7SYG0	Stenotrophomonas_phage	42.6	7.7e-62
WP_069008964.1|513144_515550_+	replication endonuclease	NA	F1BUS0	Erwinia_phage	49.9	1.2e-203
WP_049525352.1|515595_515856_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	64.3	1.3e-26
WP_069008967.1|516933_518721_-|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	66.6	4.8e-237
WP_049525354.1|518890_519748_+|capsid	phage capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	48.1	2.7e-44
WP_049525355.1|519813_520845_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	76.4	3.6e-144
WP_049525356.1|520854_521553_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	53.9	4.5e-66
WP_046050145.1|521612_522101_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	56.0	1.1e-39
WP_049525357.1|522097_522586_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	44.8	4.2e-34
WP_049525359.1|524077_524533_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	60.9	9.8e-46
WP_049525360.1|524542_524833_+|holin	holin	holin	C7BGD7	Burkholderia_phage	50.6	6.7e-16
WP_049525361.1|524829_525171_+	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	82.2	1.4e-44
WP_049525362.1|525170_525512_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	41.8	4.4e-14
WP_004389570.1|525661_525928_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	53.7	5.1e-18
WP_057618720.1|526115_528092_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	48.5	1.9e-170
WP_049525364.1|528091_528424_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	67.3	1.7e-34
WP_049525365.1|528416_529601_+	phage protein	NA	F1BUK6	Cronobacter_phage	67.0	1.3e-153
WP_049525366.1|529593_530202_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	63.6	9.4e-68
WP_049525367.1|532056_532530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049525368.1|532519_533251_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	47.1	3.9e-44
WP_049525369.1|535632_535839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049525370.1|535973_536810_-	abortive infection family protein	NA	NA	NA	NA	NA
WP_069008969.1|537345_538686_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_042663659.1|539235_540255_-|transposase	IS110-like element ISYen1 family transposase	transposase	NA	NA	NA	NA
538955:538983	attR	CGCCATATATGGACGCTCCCAATAAACCA	NA	NA	NA	NA
WP_005162547.1|540786_541173_+	cytochrome b562	NA	NA	NA	NA	NA
WP_005162545.1|541220_541631_-	nucleoside diphosphate kinase regulator	NA	NA	NA	NA	NA
WP_005174305.1|542162_542507_+	glycine dehydrogenase	NA	NA	NA	NA	NA
WP_004392359.1|542530_542896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005162543.1|542895_543192_+	DUF4312 family protein	NA	NA	NA	NA	NA
WP_005162542.1|543204_543981_+	DUF4311 domain-containing protein	NA	NA	NA	NA	NA
WP_013650492.1|544002_544653_+	DUF4310 family protein	NA	NA	NA	NA	NA
WP_049525373.1|544736_545906_+	amidohydrolase/deacetylase family metallohydrolase	NA	NA	NA	NA	NA
WP_013650491.1|545889_547002_+	DgaE family pyridoxal phosphate-dependent ammonia lyase	NA	NA	NA	NA	NA
WP_049525374.1|547005_547746_+	KDGP aldolase family protein	NA	NA	NA	NA	NA
WP_049525375.1|549219_551118_+	BglG family transcription antiterminator	NA	NA	NA	NA	NA
WP_049525376.1|551189_551495_-	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	66.3	1.5e-29
WP_005162526.1|551494_551773_-	plasmid maintenance system killer protein	NA	A0A2L1IV28	Escherichia_phage	77.2	6.0e-38
WP_049525377.1|555076_556024_+	HTH-type transcriptional regulator TreR	NA	NA	NA	NA	NA
WP_049525378.1|557722_559384_+	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_049525379.1|559725_560460_-|protease	proteasome-type protease	protease	NA	NA	NA	NA
WP_005162507.1|560483_561305_-	transglutaminase family protein	NA	NA	NA	NA	NA
WP_005162503.1|561301_562231_-	alpha-E domain-containing protein	NA	NA	NA	NA	NA
WP_011817265.1|562224_563661_-	circularly permuted type 2 ATP-grasp protein	NA	NA	NA	NA	NA
WP_005162498.1|563928_564315_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_005162495.1|564808_565273_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_049525380.1|565284_566220_-	aspartate carbamoyltransferase	NA	A7RB08	Paramecium_bursaria_Chlorella_virus	40.2	2.7e-50
WP_005162489.1|567346_567619_-	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_005162486.1|567619_568471_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	29.3	1.9e-05
WP_005162484.1|568549_569032_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_005162480.1|569202_569490_-	ribosome hibernation promoting factor	NA	NA	NA	NA	NA
WP_049525381.1|569513_570947_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_004392029.1|571150_571876_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.4	1.6e-21
WP_049525382.1|571882_572428_-	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_049525383.1|572411_572975_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_049525384.1|572971_573535_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	79.3	6.9e-57
WP_019080048.1|573548_574553_-	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	29.5	7.5e-38
WP_005162453.1|575723_576527_+	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	31.7	1.3e-19
WP_069008970.1|576541_577324_+	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
WP_005162449.1|577328_577889_+	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_005162447.1|577901_578528_+	phospholipid-binding protein MlaC	NA	NA	NA	NA	NA
WP_005180174.1|578530_578872_+	lipid asymmetry maintenance protein MlaB	NA	NA	NA	NA	NA
WP_005162441.1|579046_579301_+	BolA family iron metabolism protein IbaG	NA	NA	NA	NA	NA
WP_005162439.1|579422_580691_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_069009633.1|580952_582041_-	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	33.8	1.4e-10
WP_050127209.1|582129_583503_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	29.0	6.0e-22
>prophage 3
NZ_CP016944	Yersinia enterocolitica strain YE3 chromosome, complete genome	4664930	1056225	1103211	4664930	protease,terminase,lysis,integrase,plate,capsid	Edwardsiella_phage(26.42%)	75	1054830:1054843	1073216:1073229
1054830:1054843	attL	TCAGCGGCATTCAT	NA	NA	NA	NA
WP_050294021.1|1056225_1057497_-|integrase	site-specific integrase	integrase	Q8W658	Enterobacteria_phage	52.7	1.4e-126
WP_049525557.1|1057529_1057781_-	DUF1233 family excisionase	NA	A0A286S2A4	Klebsiella_phage	50.0	5.8e-16
WP_049525558.1|1058138_1058774_-	DNA methyltransferase	NA	I6PDF5	Cronobacter_phage	73.0	7.2e-87
WP_049525559.1|1058770_1058989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164971240.1|1058988_1059165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129019389.1|1059398_1059785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050128071.1|1059774_1059996_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049525779.1|1060020_1060290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049525781.1|1060291_1060720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057619046.1|1060716_1061124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049526811.1|1061165_1061348_-	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	59.6	1.3e-09
WP_057619042.1|1061344_1062280_-	recombinase RecT	NA	A0A193GYL3	Enterobacter_phage	62.5	2.4e-107
WP_069009644.1|1062272_1063091_-	exodeoxyribonuclease VIII	NA	E5AGE0	Erwinia_phage	74.1	2.6e-121
WP_049526808.1|1063090_1063384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129019391.1|1063487_1063619_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	NA	NA	NA	NA
WP_069009030.1|1063636_1064656_-	hypothetical protein	NA	K7P6J9	Enterobacteria_phage	64.4	1.2e-30
WP_049525794.1|1064744_1065038_-	hypothetical protein	NA	A0A0B4SK56	Proteus_phage	31.3	7.6e-07
WP_049525796.1|1065583_1065925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071828178.1|1066083_1066263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154236085.1|1066467_1066626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050344824.1|1066628_1066925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049528945.1|1067417_1067627_+	DUF2767 family protein	NA	I6R0R9	Salmonella_phage	47.5	5.9e-06
WP_049525800.1|1067671_1068115_-	hypothetical protein	NA	M1FPN8	Enterobacteria_phage	50.4	4.3e-30
WP_049525803.1|1068132_1068978_-	hypothetical protein	NA	M1FPD4	Enterobacteria_phage	44.3	4.6e-57
WP_012304433.1|1069107_1069830_-	LexA family transcriptional regulator	NA	A0A2R2X2B0	Escherichia_phage	55.5	2.3e-65
WP_042562436.1|1069934_1070129_+	Cro/Cl family transcriptional regulator	NA	K7PLQ6	Enterobacteria_phage	85.5	4.2e-22
WP_050296274.1|1070240_1070534_+	hypothetical protein	NA	A2SY75	Escherichia_phage	63.9	6.1e-25
WP_049526793.1|1070558_1071161_+	hypothetical protein	NA	M1F3E2	Salmonella_phage	41.6	1.6e-35
WP_069009033.1|1071157_1071997_+	replication protein	NA	A0A075B8J2	Enterobacteria_phage	61.9	3.2e-34
WP_050344860.1|1071993_1072848_+	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	57.5	2.2e-86
WP_129019429.1|1072988_1073186_+	hypothetical protein	NA	K7PHN9	Enterobacterial_phage	61.9	9.2e-17
WP_069009034.1|1073182_1073485_+	hypothetical protein	NA	NA	NA	NA	NA
1073216:1073229	attR	ATGAATGCCGCTGA	NA	NA	NA	NA
WP_049526787.1|1073481_1073976_+	DUF551 domain-containing protein	NA	E7C9P2	Salmonella_phage	32.5	4.5e-12
WP_049525574.1|1073975_1074173_+	hypothetical protein	NA	A0A2H4FUS3	Salmonella_phage	42.2	5.1e-07
WP_164971241.1|1074162_1074324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049525575.1|1074316_1074787_+	recombination protein NinB	NA	I6R9D0	Salmonella_phage	53.9	2.6e-41
WP_049526784.1|1075408_1075699_+	DUF1364 domain-containing protein	NA	A0A220NQY2	Salmonella_phage	75.8	1.3e-38
WP_049526782.1|1075695_1076058_+	RusA family crossover junction endodeoxyribonuclease	NA	E5AGG1	Erwinia_phage	65.8	8.7e-37
WP_049526779.1|1076266_1077091_+	antitermination protein	NA	M9NZB0	Enterobacteria_phage	53.6	1.3e-75
WP_049525816.1|1077564_1078098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049528949.1|1078315_1078597_+	hypothetical protein	NA	H6WRZ3	Salmonella_phage	54.3	1.1e-18
WP_049526777.1|1078596_1079109_+	lysozyme	NA	I6PBN2	Cronobacter_phage	59.9	2.4e-48
WP_049525819.1|1079093_1079555_+|lysis	lysis protein	lysis	A5LH84	Enterobacteria_phage	43.0	1.7e-21
WP_069009038.1|1079872_1080559_+	Rha family transcriptional regulator	NA	A0A192Y918	Salmonella_phage	86.0	6.5e-110
WP_155296413.1|1080561_1080735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069009040.1|1080801_1081026_+	hypothetical protein	NA	A0A127KNL9	Pseudomonas_phage	64.7	7.0e-05
WP_069009041.1|1081085_1081286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069009044.1|1081289_1081481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069009046.1|1081491_1081968_+|terminase	terminase	terminase	C7U0V7	Enterobacteria_phage	74.1	3.2e-55
WP_069009047.1|1081969_1083646_+|terminase	phage terminase large subunit	terminase	H9C191	Pectobacterium_phage	72.6	7.9e-242
WP_069009050.1|1083646_1085182_+	DUF1073 domain-containing protein	NA	A0A2R3UAL5	Myoviridae_environmental_samples	44.2	1.0e-102
WP_069009051.1|1085234_1085930_+|capsid	minor capsid protein	capsid	H9C0V1	Aeromonas_phage	54.9	1.3e-65
WP_069009052.1|1085926_1086115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069009054.1|1086160_1087348_+	DUF2213 domain-containing protein	NA	A0A219YCD3	Aeromonas_phage	36.3	2.9e-57
WP_069009056.1|1087349_1087832_+	hypothetical protein	NA	A0A219YBF2	Aeromonas_phage	51.0	1.4e-34
WP_069009059.1|1087831_1088875_+	DUF2184 domain-containing protein	NA	A0A219YBB0	Aeromonas_phage	49.4	7.9e-83
WP_057627536.1|1088878_1089205_+	hypothetical protein	NA	H9C0V9	Aeromonas_phage	41.1	2.1e-10
WP_069009061.1|1089207_1089651_+	DUF4054 domain-containing protein	NA	Q2NPC6	Xanthomonas_phage	50.0	3.1e-20
WP_069009062.1|1089653_1090184_+	hypothetical protein	NA	A0A077KC03	Edwardsiella_phage	43.6	1.4e-27
WP_069009064.1|1090161_1090533_+	hypothetical protein	NA	A0A077KAW7	Edwardsiella_phage	61.0	5.0e-40
WP_049528954.1|1090730_1091048_+	hypothetical protein	NA	A0A077KC88	Edwardsiella_phage	67.3	9.6e-32
WP_049525848.1|1091044_1092532_+	DUF3383 domain-containing protein	NA	A0A077KGV4	Edwardsiella_phage	61.9	4.5e-164
WP_049525852.1|1092541_1092976_+	hypothetical protein	NA	A0A077K9T0	Edwardsiella_phage	67.1	1.6e-53
WP_049525854.1|1092975_1093383_+	hypothetical protein	NA	A0A077KC08	Edwardsiella_phage	60.7	8.3e-36
WP_049525857.1|1093597_1095358_+	lytic transglycosylase domain-containing protein	NA	A0A077KC92	Edwardsiella_phage	38.6	2.4e-100
WP_049525859.1|1095362_1095764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049525861.1|1095840_1096299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049525864.1|1096411_1097230_+	hypothetical protein	NA	A0A077KGW3	Edwardsiella_phage	57.9	4.8e-75
WP_049525866.1|1097226_1097532_+	hypothetical protein	NA	A0A077K9U4	Edwardsiella_phage	63.0	9.2e-32
WP_049525867.1|1097521_1098379_+	hypothetical protein	NA	A0A077KC17	Edwardsiella_phage	53.6	3.0e-80
WP_049525869.1|1098375_1099086_+|plate	phage baseplate assembly protein	plate	A0A077KAY0	Edwardsiella_phage	52.9	1.4e-59
WP_049525871.1|1099082_1099442_+	hypothetical protein	NA	A0A077KCA1	Edwardsiella_phage	73.7	1.2e-43
WP_069009065.1|1099438_1100680_+	hypothetical protein	NA	A0A077KGW9	Edwardsiella_phage	67.8	1.7e-156
WP_049525876.1|1100676_1101318_+	DUF2612 domain-containing protein	NA	A0A077K9U8	Edwardsiella_phage	73.6	1.1e-87
WP_129019393.1|1101495_1103211_+	hypothetical protein	NA	A9YX14	Burkholderia_phage	39.8	7.0e-52
>prophage 4
NZ_CP016944	Yersinia enterocolitica strain YE3 chromosome, complete genome	4664930	1303021	1424834	4664930	protease,tail,terminase,portal,holin,lysis,coat,integrase,plate,tRNA,head,capsid,transposase	Enterobacteria_phage(19.05%)	172	1309272:1309286	1359772:1359787
WP_005158258.1|1303021_1303657_-|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_005158259.1|1303627_1304314_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.2	2.7e-31
WP_049525769.1|1304310_1306737_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_005158266.1|1306876_1307941_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_049525771.1|1307937_1308462_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	38.5	5.3e-19
WP_049525773.1|1308637_1309360_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
1309272:1309286	attL	GCTTCACGCTGGATA	NA	NA	NA	NA
WP_005158275.1|1309370_1309865_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
1309272:1309286	attL	GCTTCACGCTGGATA	NA	NA	NA	NA
WP_020283435.1|1310077_1311463_+|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	32.0	5.5e-39
WP_004390634.1|1311631_1311844_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_005158281.1|1311858_1312725_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	35.0	3.7e-33
WP_050344586.1|1313047_1314202_-|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	71.1	6.2e-161
WP_049525558.1|1314802_1315438_-	DNA methyltransferase	NA	I6PDF5	Cronobacter_phage	73.0	7.2e-87
WP_049525559.1|1315434_1315653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164971240.1|1315652_1315829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129019389.1|1316062_1316449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050128071.1|1316438_1316660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049525779.1|1316684_1316954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049525781.1|1316955_1317384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057619046.1|1317380_1317788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049526811.1|1317829_1318012_-	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	59.6	1.3e-09
WP_057619042.1|1318008_1318944_-	recombinase RecT	NA	A0A193GYL3	Enterobacter_phage	62.5	2.4e-107
WP_069009644.1|1318936_1319755_-	exodeoxyribonuclease VIII	NA	E5AGE0	Erwinia_phage	74.1	2.6e-121
WP_049526808.1|1319754_1320048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129019391.1|1320151_1320283_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	NA	NA	NA	NA
WP_050293951.1|1320300_1321320_-	hypothetical protein	NA	K7P6J9	Enterobacteria_phage	65.3	1.8e-31
1320512:1320526	attR	GCTTCACGCTGGATA	NA	NA	NA	NA
WP_049525794.1|1321408_1321702_-	hypothetical protein	NA	A0A0B4SK56	Proteus_phage	31.3	7.6e-07
1320512:1320526	attR	GCTTCACGCTGGATA	NA	NA	NA	NA
WP_049525796.1|1322217_1322559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071828178.1|1322717_1322897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154236085.1|1323101_1323260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049525565.1|1323262_1323547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049611538.1|1324044_1324797_-	helix-turn-helix transcriptional regulator	NA	G8C7L8	Escherichia_phage	41.2	7.3e-30
WP_049611541.1|1324914_1325148_+	antirepressor	NA	A0A0P0ZDD7	Stx2-converting_phage	58.4	6.4e-17
WP_057619037.1|1325259_1325553_+	hypothetical protein	NA	A2SY75	Escherichia_phage	62.9	8.0e-25
WP_057619038.1|1325577_1326282_+	hypothetical protein	NA	Q71T76	Escherichia_phage	54.0	2.1e-63
WP_071890465.1|1326278_1327100_+	replication protein	NA	K7PL20	Enterobacteria_phage	64.3	5.5e-55
WP_069009079.1|1327096_1327951_+	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	57.3	8.2e-86
WP_129019430.1|1328091_1328289_+	hypothetical protein	NA	K7PHN9	Enterobacterial_phage	61.9	9.2e-17
WP_049525572.1|1328285_1328588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050128082.1|1328584_1329085_+	DUF551 domain-containing protein	NA	NA	NA	NA	NA
WP_049525574.1|1329084_1329282_+	hypothetical protein	NA	A0A2H4FUS3	Salmonella_phage	42.2	5.1e-07
WP_164971241.1|1329271_1329433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049525575.1|1329425_1329896_+	recombination protein NinB	NA	I6R9D0	Salmonella_phage	53.9	2.6e-41
WP_049526784.1|1330517_1330808_+	DUF1364 domain-containing protein	NA	A0A220NQY2	Salmonella_phage	75.8	1.3e-38
WP_049526782.1|1330804_1331167_+	RusA family crossover junction endodeoxyribonuclease	NA	E5AGG1	Erwinia_phage	65.8	8.7e-37
WP_049526779.1|1331375_1332200_+	antitermination protein	NA	M9NZB0	Enterobacteria_phage	53.6	1.3e-75
WP_050344746.1|1332673_1333207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049525581.1|1333398_1333716_+|holin	holin	holin	E7C9S8	Salmonella_phage	57.6	8.4e-28
WP_049525582.1|1333702_1334101_+	M15 family metallopeptidase	NA	E7C9S9	Salmonella_phage	61.7	1.0e-38
WP_069009658.1|1334118_1334619_+	DUF2514 family protein	NA	Q7Y3V2	Yersinia_phage	86.7	1.8e-72
WP_049525583.1|1334629_1335040_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129019398.1|1335070_1335337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049525585.1|1335547_1335781_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.1e-16
WP_049525586.1|1335857_1336502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049525588.1|1336967_1337567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_102970453.1|1337535_1339515_+|terminase	phage terminase large subunit family protein	terminase	G8EXZ6	Synechococcus_phage	46.0	3.1e-136
WP_005278866.1|1339523_1339787_+|head,tail	phage head-tail adapter protein	head,tail	NA	NA	NA	NA
WP_049525589.1|1339855_1341439_+|portal	phage portal protein	portal	A0A291AUL8	Sinorhizobium_phage	38.5	1.2e-98
WP_049525590.1|1341435_1342296_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	39.9	1.1e-50
WP_049525591.1|1342288_1342882_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049525592.1|1342881_1343283_+|head	head decoration protein	head	NA	NA	NA	NA
WP_049525593.1|1343392_1344439_+|capsid	major capsid protein	capsid	Q6UYI3	Burkholderia_phage	30.7	4.9e-40
WP_049525594.1|1344440_1344935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049525596.1|1344934_1345279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049525598.1|1345275_1345821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049525600.1|1345826_1346018_+	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_050156942.1|1346017_1347508_+|tail	phage tail protein	tail	B5TK67	Pseudomonas_phage	44.2	2.6e-103
WP_050319427.1|1347520_1347895_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_069009080.1|1348315_1350118_+	lytic transglycosylase domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	49.2	1.1e-23
WP_050879847.1|1350175_1351582_+	hypothetical protein	NA	Q8W619	Enterobacteria_phage	27.6	6.8e-21
WP_049525612.1|1351578_1352652_+|tail	tail protein	tail	M1PVV2	Vibrio_phage	30.1	5.5e-39
WP_049525614.1|1352648_1353242_+|plate	phage baseplate assembly protein	plate	NA	NA	NA	NA
WP_049525616.1|1353238_1353676_+	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	45.4	3.4e-19
WP_050156966.1|1353679_1354816_+|plate	baseplate J/gp47 family protein	plate	A0A1E1GE19	Vibrio_phage	28.0	1.7e-09
WP_050107865.1|1354812_1355409_+	YmfQ family protein	NA	A0A2P9JZK7	Alteromonadaceae_phage	39.8	4.6e-35
WP_069009081.1|1356915_1357098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057619001.1|1357204_1358305_+	acyltransferase	NA	A0A2H4JA46	uncultured_Caudovirales_phage	28.0	4.4e-23
WP_071890467.1|1358523_1359546_-|integrase	site-specific integrase	integrase	F1C5B2	Cronobacter_phage	67.1	2.8e-141
WP_046051422.1|1359563_1359911_-	helix-turn-helix domain-containing protein	NA	M1FJ59	Enterobacteria_phage	58.3	2.4e-28
WP_049525558.1|1360268_1360904_-	DNA methyltransferase	NA	I6PDF5	Cronobacter_phage	73.0	7.2e-87
WP_049525559.1|1360900_1361119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164971240.1|1361118_1361295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129019389.1|1361528_1361915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050128071.1|1361904_1362126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049525779.1|1362150_1362420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049525781.1|1362421_1362850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069009084.1|1362846_1363254_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154236079.1|1363297_1363471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049525787.1|1363704_1364301_-	hypothetical protein	NA	K7PHD7	Enterobacteria_phage	51.6	3.0e-42
WP_049525790.1|1364297_1364978_-	AAA family ATPase	NA	A0A2D1GLT5	Escherichia_phage	69.0	2.6e-90
WP_049525792.1|1364949_1365198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154236080.1|1365194_1365368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049525794.1|1365633_1365927_-	hypothetical protein	NA	A0A0B4SK56	Proteus_phage	31.3	7.6e-07
WP_069009085.1|1365948_1366317_-	hypothetical protein	NA	B9UDG8	Salmonella_phage	50.0	2.1e-38
WP_049525796.1|1366426_1366768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071828178.1|1366926_1367106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154236085.1|1367310_1367469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049525798.1|1367471_1367756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049528945.1|1368254_1368464_+	DUF2767 family protein	NA	I6R0R9	Salmonella_phage	47.5	5.9e-06
WP_049525800.1|1368508_1368952_-	hypothetical protein	NA	M1FPN8	Enterobacteria_phage	50.4	4.3e-30
WP_049525803.1|1368969_1369815_-	hypothetical protein	NA	M1FPD4	Enterobacteria_phage	44.3	4.6e-57
WP_080347400.1|1369955_1370654_-	helix-turn-helix transcriptional regulator	NA	A0A2D1GM27	Escherichia_phage	63.9	2.6e-82
WP_049525807.1|1370812_1371043_+	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	47.1	5.0e-06
WP_049525808.1|1371158_1371452_+	hypothetical protein	NA	A2SY75	Escherichia_phage	62.9	1.2e-23
WP_049525811.1|1371461_1371998_+	hypothetical protein	NA	A0A291AXH9	Shigella_phage	53.6	1.2e-50
WP_049525571.1|1372244_1373147_+	replication protein	NA	C6ZR51	Salmonella_phage	56.0	2.2e-36
WP_049525813.1|1373146_1374484_+	AAA family ATPase	NA	A0A2I7REC3	Vibrio_phage	38.7	1.5e-81
WP_050128081.1|1374496_1374721_+	hypothetical protein	NA	A0A192Y6R5	Salmonella_phage	63.8	2.5e-18
WP_129019429.1|1374861_1375059_+	hypothetical protein	NA	K7PHN9	Enterobacterial_phage	61.9	9.2e-17
WP_049525572.1|1375055_1375358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050294067.1|1375354_1375753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050294069.1|1375749_1375989_+	DUF4752 family protein	NA	T1S9K2	Salmonella_phage	58.7	4.5e-18
WP_050294071.1|1375992_1376442_+	DUF1367 family protein	NA	A0A0P0ZFW0	Escherichia_phage	70.5	5.3e-60
WP_050294074.1|1376661_1377045_+	HNH endonuclease	NA	A0A2R2Z2X9	Escherichia_phage	75.2	8.5e-51
WP_050294075.1|1377184_1377514_+	DUF2591 family protein	NA	R9VYJ6	Serratia_phage	52.8	3.3e-19
WP_050294079.1|1377515_1378166_+	serine/threonine protein phosphatase	NA	Q716B9	Shigella_phage	61.1	8.5e-75
WP_155295585.1|1378341_1378506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050156987.1|1378620_1379256_+	hypothetical protein	NA	H6WRY9	Salmonella_phage	44.9	1.9e-42
WP_050156985.1|1379252_1379444_+	protein ninH	NA	Q777W6	Enterobacteria_phage	59.3	1.1e-09
WP_050156984.1|1379440_1379929_+	antiterminator	NA	M1FPN0	Enterobacteria_phage	67.9	2.4e-58
WP_050344746.1|1380232_1380766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042570178.1|1380963_1381278_+|holin	holin	holin	NA	NA	NA	NA
WP_050294008.1|1381280_1381724_+	lysozyme	NA	R9TMH8	Aeromonas_phage	57.3	2.1e-40
WP_050294009.1|1381720_1382179_+|lysis	lysis protein	lysis	A5LH84	Enterobacteria_phage	46.4	2.1e-24
WP_050127912.1|1382704_1383232_+	KilA-N domain-containing protein	NA	A0A1V0E5P7	Salmonella_phage	55.4	3.0e-46
WP_050127911.1|1383228_1383612_+	hypothetical protein	NA	A0A192Y658	Salmonella_phage	41.6	5.6e-18
WP_050127910.1|1383687_1383927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050127908.1|1384050_1384686_+	hypothetical protein	NA	H9C189	Pectobacterium_phage	71.0	4.7e-86
WP_050127906.1|1384719_1385169_+	DUF2280 domain-containing protein	NA	I6S1P9	Salmonella_phage	72.9	5.1e-47
WP_050127904.1|1385178_1386666_+	hypothetical protein	NA	A0A1W6JNY3	Morganella_phage	76.5	7.0e-226
WP_050156791.1|1386740_1388078_+	DUF4055 domain-containing protein	NA	A0A0S2SYJ5	Pseudomonas_phage	43.7	7.5e-94
WP_050156790.1|1388196_1388949_+	hypothetical protein	NA	G8C7P6	Escherichia_phage	47.6	3.2e-57
WP_050127902.1|1388964_1390089_+|coat	P22 coat - protein 5 family protein	coat	W6EBZ8	Rhizobium_phage	56.7	9.1e-101
WP_154236072.1|1390139_1390310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050156786.1|1390309_1390702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050127901.1|1390704_1391343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050127899.1|1391344_1392148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050127897.1|1392164_1392359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050294010.1|1392419_1393973_+|tail	phage tail protein	tail	B3GAJ6	uncultured_virus	44.8	2.1e-95
WP_050127893.1|1394022_1394454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050127891.1|1394474_1394852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050127914.1|1395027_1395513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050127890.1|1395571_1395907_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_071890470.1|1396014_1396179_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_050294012.1|1397052_1397829_+	hypothetical protein	NA	A0A077SL47	Escherichia_phage	44.3	2.4e-39
WP_050127887.1|1397948_1398296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050127885.1|1398366_1400505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154236071.1|1400588_1400948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050294015.1|1401329_1402319_+	hypothetical protein	NA	S5MNM1	Brevibacillus_phage	35.0	1.3e-13
WP_050127882.1|1402321_1403437_+	type IV secretion protein Rhs	NA	NA	NA	NA	NA
WP_050127881.1|1403433_1404060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050127880.1|1404067_1404433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080357946.1|1404494_1405565_+|plate	baseplate protein	plate	B3GAJ9	uncultured_virus	40.4	2.6e-52
WP_050127878.1|1405565_1406228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129019401.1|1406300_1408475_+	hypothetical protein	NA	A9YX14	Burkholderia_phage	40.0	5.2e-52
WP_049525621.1|1408471_1408687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005158292.1|1410351_1410537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069009664.1|1411252_1412350_+	Fic family protein	NA	NA	NA	NA	NA
WP_080478647.1|1412790_1413357_-	potassium-transporting ATPase subunit A	NA	Q7M2A8	Enterobacteria_phage	44.8	9.4e-38
WP_080478635.1|1413586_1414984_-	hypothetical protein	NA	Q8LTT9	Enterobacteria_phage	47.4	4.8e-59
WP_049525217.1|1415283_1415607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164971237.1|1415599_1415752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049525216.1|1415765_1415966_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_005158310.1|1416180_1416513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005158312.1|1416873_1417239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020283429.1|1417463_1418111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005158316.1|1418095_1418434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049525882.1|1418927_1419158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049525883.1|1419560_1420043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038892054.1|1420149_1420530_+	DNA polymerase V	NA	K7P6F7	Enterobacteria_phage	68.0	6.9e-45
WP_049528964.1|1421680_1422370_-	heavy metal response regulator transcription factor	NA	W8CYM9	Bacillus_phage	34.7	8.8e-30
WP_049525886.1|1422605_1423655_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_023160836.1|1423814_1424834_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP016944	Yersinia enterocolitica strain YE3 chromosome, complete genome	4664930	1893391	1906054	4664930		Vaccinia_virus(16.67%)	8	NA	NA
WP_049526354.1|1893391_1896544_-	beta-galactosidase	NA	B9U1H7	Vaccinia_virus	62.9	0.0e+00
WP_005164513.1|1896722_1897757_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	50.3	1.4e-84
WP_002210893.1|1898238_1898451_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	80.0	2.0e-25
WP_071530598.1|1898659_1898896_+	protein DsrB	NA	NA	NA	NA	NA
WP_013649692.1|1899029_1900769_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.4	1.1e-09
WP_005177868.1|1901633_1901873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049526360.1|1902436_1903135_+	MgtC family protein	NA	G3MA03	Bacillus_virus	41.8	3.6e-15
WP_069009161.1|1903351_1906054_+	magnesium-translocating P-type ATPase	NA	M1HM40	Paramecium_bursaria_Chlorella_virus	25.2	9.4e-43
>prophage 6
NZ_CP016944	Yersinia enterocolitica strain YE3 chromosome, complete genome	4664930	2010481	2076103	4664930	tail,holin,lysis,tRNA,transposase	Salmonella_phage(17.65%)	59	NA	NA
WP_049526451.1|2010481_2010928_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	47.3	9.4e-33
WP_049526452.1|2010924_2011392_-|tail	phage tail protein	tail	F1BUP9	Erwinia_phage	56.6	1.3e-40
WP_069009185.1|2011493_2011910_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	40.6	8.8e-17
WP_013649751.1|2011922_2012318_-	M15 family metallopeptidase	NA	A9DET4	Yersinia_phage	71.0	5.9e-47
WP_013649752.1|2012304_2012484_-|holin	holin	holin	NA	NA	NA	NA
WP_071598556.1|2012477_2012780_-	hypothetical protein	NA	A0A077KEQ8	Ralstonia_phage	68.7	2.6e-26
WP_049526453.1|2013581_2015018_-|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	39.1	2.9e-83
WP_069009186.1|2016634_2017552_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013649756.1|2018157_2018577_-	helix-turn-helix domain-containing protein	NA	A0A0M4REM4	Salmonella_phage	31.1	9.8e-16
WP_049526459.1|2018977_2019622_+	CatB-related O-acetyltransferase	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	31.3	8.0e-17
WP_005161392.1|2019764_2019947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049529016.1|2020371_2020788_+	antitermination protein Q	NA	K7PGW2	Enterobacterial_phage	63.0	8.1e-39
WP_005161372.1|2020964_2021141_-	GhoT/OrtT family toxin	NA	NA	NA	NA	NA
WP_005161370.1|2021367_2021544_+	hypothetical protein	NA	B6SD15	Bacteriophage	60.7	2.2e-14
WP_049526462.1|2021545_2022028_+	lysozyme	NA	A0A2H4JCH1	uncultured_Caudovirales_phage	63.1	2.7e-54
WP_049526464.1|2022399_2023284_+	triacylglycerol lipase	NA	NA	NA	NA	NA
WP_005161358.1|2023585_2024242_+	DUF533 domain-containing protein	NA	NA	NA	NA	NA
WP_013649759.1|2024348_2025233_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_049529017.1|2025367_2026534_+	class C beta-lactamase	NA	NA	NA	NA	NA
WP_049526465.1|2026680_2027772_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_005161346.1|2028039_2028498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049526468.1|2028552_2029146_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_005161340.1|2029477_2029750_+	stress-induced protein YchH	NA	NA	NA	NA	NA
WP_004390739.1|2030235_2031183_-	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	38.2	2.7e-45
WP_049526470.1|2031380_2032262_-	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_049526472.1|2032263_2032887_-	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_005161325.1|2033192_2034455_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_005161322.1|2034486_2035569_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	42.1	5.6e-07
WP_005161319.1|2035568_2036423_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_013649766.1|2036440_2036842_+	SirB2 family protein	NA	NA	NA	NA	NA
WP_049526475.1|2036838_2037648_+	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_049526477.1|2037792_2038647_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.3	2.2e-46
WP_049526479.1|2038720_2040421_-	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	24.3	4.0e-23
WP_005161308.1|2040976_2042095_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.4	1.5e-18
WP_049526481.1|2045082_2045820_+	phosphatase	NA	NA	NA	NA	NA
WP_005161295.1|2045883_2046444_+	molecular chaperone	NA	NA	NA	NA	NA
WP_005161292.1|2046481_2047045_-	lipoprotein	NA	NA	NA	NA	NA
WP_005161289.1|2047261_2048467_-	multidrug efflux MFS transporter MdtH	NA	NA	NA	NA	NA
WP_005161286.1|2049141_2049459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050293987.1|2049470_2050205_-	DUF4225 domain-containing protein	NA	NA	NA	NA	NA
WP_049526484.1|2050881_2051466_+	ribosomal protein S5-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_014608990.1|2051473_2052115_+	YceH family protein	NA	NA	NA	NA	NA
WP_112999213.1|2052125_2053067_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_049526486.1|2053205_2054741_+	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_005178667.1|2055060_2056170_-	sodium-potassium/proton antiporter ChaA	NA	NA	NA	NA	NA
WP_049526488.1|2056390_2057227_-	siderophore-interacting protein	NA	NA	NA	NA	NA
WP_049526492.1|2057415_2058582_-	MFS transporter	NA	NA	NA	NA	NA
WP_069017988.1|2059077_2060097_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_049526495.1|2061500_2063282_-	nitrate/nitrite two-component system sensor histidine kinase NarX	NA	NA	NA	NA	NA
WP_005178681.1|2063346_2063508_-	DUF2474 domain-containing protein	NA	NA	NA	NA	NA
WP_005161249.1|2063508_2064516_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_005161246.1|2064518_2065967_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_005161245.1|2066151_2067585_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_049526497.1|2068177_2069422_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	28.0	1.2e-24
WP_005161241.1|2069464_2070502_+	arginine N-succinyltransferase	NA	NA	NA	NA	NA
WP_049526499.1|2070498_2071980_+	succinylglutamate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_049526500.1|2072022_2073366_+	N-succinylarginine dihydrolase	NA	NA	NA	NA	NA
WP_005161236.1|2073430_2074423_+	succinylglutamate desuccinylase	NA	NA	NA	NA	NA
WP_023160836.1|2075083_2076103_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP016944	Yersinia enterocolitica strain YE3 chromosome, complete genome	4664930	2203475	2211181	4664930	tRNA	Tupanvirus(33.33%)	9	NA	NA
WP_049526612.1|2203475_2205404_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.2	8.8e-128
WP_011816226.1|2205407_2205959_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.7	3.4e-16
WP_004713020.1|2206055_2206253_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_004393357.1|2206290_2206647_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_152414234.1|2206715_2206763_+	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_005161570.1|2207111_2208095_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	5.8e-35
WP_049526614.1|2208109_2210497_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	27.8	1.1e-07
WP_002211830.1|2210501_2210798_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	4.2e-13
WP_071828211.1|2211010_2211181_-	NINE protein	NA	M4ZS56	Bacillus_phage	62.5	1.0e-08
>prophage 8
NZ_CP016944	Yersinia enterocolitica strain YE3 chromosome, complete genome	4664930	2419443	2450146	4664930	terminase,lysis	Escherichia_phage(34.48%)	43	NA	NA
WP_049526752.1|2419443_2420169_-	hypothetical protein	NA	A0A0U2JGI7	Escherichia_phage	35.9	5.1e-28
WP_069009220.1|2420168_2421989_-	hypothetical protein	NA	A0A2R3UAN6	Myoviridae_environmental_samples	42.7	1.7e-19
WP_049526756.1|2422112_2422688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069009223.1|2422691_2423129_-	hypothetical protein	NA	A0A0U2S616	Escherichia_phage	39.6	2.0e-24
WP_049526761.1|2423132_2424527_-	hypothetical protein	NA	A0A0U2KD19	Escherichia_phage	36.4	2.6e-65
WP_049526763.1|2424531_2425473_-	hypothetical protein	NA	A0A0U2SH76	Escherichia_phage	37.3	1.3e-52
WP_049526765.1|2425456_2425891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049526766.1|2425887_2426316_-	hypothetical protein	NA	A0A0U2S646	Escherichia_phage	39.1	7.1e-22
WP_049526768.1|2426316_2426796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057619021.1|2426864_2427896_-	hypothetical protein	NA	A0A0U2QQI2	Escherichia_phage	46.6	5.1e-74
WP_057619022.1|2427912_2428779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069009681.1|2428794_2430396_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_049526771.1|2430430_2431252_-	hypothetical protein	NA	A0A0U2I1R8	Escherichia_phage	41.4	4.0e-53
WP_050293991.1|2431248_2432664_-	DUF1073 domain-containing protein	NA	A0A0U2S5X9	Escherichia_phage	37.3	1.4e-85
WP_049526775.1|2432676_2433999_-|terminase	terminase	terminase	A0A0U2JTW9	Escherichia_phage	59.7	4.9e-154
WP_049529053.1|2434000_2434723_-	hypothetical protein	NA	A0A1I9KFG9	Aeromonas_phage	29.3	2.6e-16
WP_049525819.1|2434868_2435330_-|lysis	lysis protein	lysis	A5LH84	Enterobacteria_phage	43.0	1.7e-21
WP_049526777.1|2435314_2435827_-	lysozyme	NA	I6PBN2	Cronobacter_phage	59.9	2.4e-48
WP_049528949.1|2435826_2436108_-	hypothetical protein	NA	H6WRZ3	Salmonella_phage	54.3	1.1e-18
WP_049525816.1|2436325_2436859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049525578.1|2437267_2437873_-	hypothetical protein	NA	Q8HA89	Salmonella_phage	40.7	1.4e-39
WP_049525577.1|2437869_2438478_-	protein ninG	NA	K7PHP1	Enterobacterial_phage	60.9	1.0e-53
WP_049525575.1|2439099_2439570_-	recombination protein NinB	NA	I6R9D0	Salmonella_phage	53.9	2.6e-41
WP_164971241.1|2439562_2439724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049525574.1|2439713_2439911_-	hypothetical protein	NA	A0A2H4FUS3	Salmonella_phage	42.2	5.1e-07
WP_049526787.1|2439910_2440405_-	DUF551 domain-containing protein	NA	E7C9P2	Salmonella_phage	32.5	4.5e-12
WP_069009034.1|2440401_2440704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129019429.1|2440700_2440898_-	hypothetical protein	NA	K7PHN9	Enterobacterial_phage	61.9	9.2e-17
WP_049526791.1|2441038_2441893_-	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	57.3	2.2e-86
WP_069009228.1|2441889_2442714_-	replication protein	NA	A0A075B8J2	Enterobacteria_phage	52.7	7.5e-36
WP_050156967.1|2442710_2443313_-	hypothetical protein	NA	M1F3E2	Salmonella_phage	42.1	5.5e-36
WP_049526795.1|2443337_2443631_-	hypothetical protein	NA	A2SY75	Escherichia_phage	62.9	1.4e-24
WP_049526797.1|2443745_2443964_-	helix-turn-helix transcriptional regulator	NA	I6S1U2	Salmonella_phage	62.7	3.7e-19
WP_049526799.1|2444070_2444736_+	LexA family transcriptional regulator	NA	A0A286S2B2	Klebsiella_phage	61.5	1.6e-73
WP_049526801.1|2444823_2445387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049526803.1|2445383_2446136_+	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
WP_049529057.1|2446191_2446401_-	DUF2767 family protein	NA	I6R0R9	Salmonella_phage	47.5	1.3e-05
WP_049525565.1|2446899_2447184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154236085.1|2447186_2447345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071828178.1|2447549_2447729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049525796.1|2447887_2448229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049525794.1|2448744_2449038_+	hypothetical protein	NA	A0A0B4SK56	Proteus_phage	31.3	7.6e-07
WP_050293951.1|2449126_2450146_+	hypothetical protein	NA	K7P6J9	Enterobacteria_phage	65.3	1.8e-31
>prophage 9
NZ_CP016944	Yersinia enterocolitica strain YE3 chromosome, complete genome	4664930	2569224	2645391	4664930	integrase,tail,transposase	Escherichia_phage(23.53%)	60	2616846:2616863	2646097:2646114
WP_069009268.1|2569224_2570661_+|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.8	4.9e-83
WP_049526892.1|2570796_2571585_-	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	73.8	1.2e-88
WP_032904241.1|2571638_2571842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005164388.1|2572113_2572821_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_049526894.1|2573036_2573504_-	poly-beta-1,6-N-acetyl-D-glucosamine biosynthesis protein PgaD	NA	NA	NA	NA	NA
WP_049526896.1|2573500_2574835_-	poly-beta-1,6 N-acetyl-D-glucosamine synthase	NA	NA	NA	NA	NA
WP_069009273.1|2580009_2581227_-	M24 family metallopeptidase	NA	NA	NA	NA	NA
WP_049526898.1|2581277_2582048_-	siderophore-iron reductase FhuF	NA	NA	NA	NA	NA
WP_005164398.1|2582205_2582832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049526901.1|2583902_2584772_-	SAM-dependent methyltransferase TehB	NA	NA	NA	NA	NA
WP_005164402.1|2584916_2585231_-	cytochrome c	NA	NA	NA	NA	NA
WP_069009280.1|2585230_2585719_-	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_049526903.1|2585708_2586422_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	31.7	1.4e-17
WP_005179185.1|2587571_2588864_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_049526908.1|2588866_2590270_-	DUF2318 domain-containing protein	NA	NA	NA	NA	NA
WP_004390794.1|2590405_2590933_-	iron transporter	NA	NA	NA	NA	NA
WP_014608895.1|2591013_2592951_-	FTR1 family iron permease	NA	NA	NA	NA	NA
WP_020283107.1|2593124_2593643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049526912.1|2595512_2596520_-	glutaminase A	NA	NA	NA	NA	NA
WP_023160703.1|2597085_2597865_-	hydroxypyruvate isomerase family protein	NA	NA	NA	NA	NA
WP_049526915.1|2597867_2598491_-	aldolase	NA	A0A077SK32	Escherichia_phage	77.7	2.0e-89
WP_069009288.1|2598487_2599750_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	60.3	1.5e-136
WP_005164436.1|2600272_2601052_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	63.9	1.7e-82
WP_005164439.1|2601296_2602973_+	two-component system sensor histidine kinase DcuS	NA	NA	NA	NA	NA
WP_005164442.1|2602965_2603685_+	two-component system response regulator DcuR	NA	NA	NA	NA	NA
WP_050156560.1|2604100_2605459_-	2-hydroxycarboxylate transporter family protein	NA	A0A140XAH4	Dickeya_phage	68.8	5.6e-28
WP_049526922.1|2606512_2608027_+	L-asparagine permease	NA	NA	NA	NA	NA
WP_005164450.1|2608175_2608529_-	DUF488 family protein	NA	NA	NA	NA	NA
WP_049526924.1|2608814_2609840_+	ROK family protein	NA	NA	NA	NA	NA
WP_049526926.1|2610076_2611249_+	MFS transporter	NA	NA	NA	NA	NA
WP_020283100.1|2611429_2612248_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_005177551.1|2613305_2614508_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	72.0	1.5e-77
WP_013649992.1|2614700_2615222_-	ricin-type beta-trefoil lectin domain protein	NA	NA	NA	NA	NA
WP_005166647.1|2615359_2616016_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
2616846:2616863	attL	TTTAAAAAATCATTACAA	NA	NA	NA	NA
WP_049526932.1|2616857_2618069_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	71.4	9.9e-77
WP_013649995.1|2619060_2620374_-	cytosine permease	NA	NA	NA	NA	NA
WP_005163571.1|2620577_2621342_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_005163578.1|2623476_2623929_+|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	63.2	2.7e-48
WP_020283095.1|2623925_2625068_+	phage late control D family protein	NA	A0A218M4J7	Erwinia_phage	67.9	6.5e-147
WP_005163580.1|2625160_2625382_+	DNA-binding transcriptional regulator	NA	Q37973	Salmonella_virus	67.6	4.3e-23
WP_005163581.1|2625466_2626282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164971242.1|2626522_2627593_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4S6G4	Salmonella_phage	58.6	1.7e-120
WP_005163587.1|2627919_2628261_-	YebY family protein	NA	NA	NA	NA	NA
WP_005163602.1|2628357_2629242_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_005170441.1|2629243_2629630_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_013650000.1|2630022_2630532_-	non-heme ferritin	NA	NA	NA	NA	NA
WP_004389928.1|2630915_2631149_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	58.8	1.7e-14
WP_020283091.1|2631198_2632155_-	prolyl aminopeptidase	NA	NA	NA	NA	NA
WP_013650001.1|2632664_2633327_+	exodeoxyribonuclease X	NA	A0A1W5PTR6	Pseudoalteromonas_phage	30.7	2.2e-17
WP_049526938.1|2633338_2635393_-	prolyl oligopeptidase family serine peptidase	NA	NA	NA	NA	NA
WP_049526939.1|2635582_2635939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005163608.1|2636044_2636353_-	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_005163610.1|2636392_2636713_-	YebG family protein	NA	NA	NA	NA	NA
WP_049526941.1|2636808_2638191_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	30.6	1.1e-52
WP_049526943.1|2638444_2639626_+	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_005163637.1|2639693_2639951_-	YoaH family protein	NA	NA	NA	NA	NA
WP_049526945.1|2640133_2641504_+	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	37.9	1.5e-36
WP_032904251.1|2641504_2642104_+	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_005163643.1|2642556_2643921_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_023160836.1|2644371_2645391_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
2646097:2646114	attR	TTGTAATGATTTTTTAAA	NA	NA	NA	NA
>prophage 10
NZ_CP016944	Yersinia enterocolitica strain YE3 chromosome, complete genome	4664930	3011675	3055733	4664930	protease,transposase	Shigella_phage(16.67%)	32	NA	NA
WP_049527252.1|3011675_3012878_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	72.0	1.5e-77
WP_013650139.1|3012945_3013596_-	DUF1120 domain-containing protein	NA	NA	NA	NA	NA
WP_023160793.1|3013974_3014286_+|transposase	IS3 family transposase	transposase	Q716C1	Shigella_phage	72.2	3.0e-30
WP_023160794.1|3014330_3014735_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	62.7	2.2e-36
WP_049527255.1|3016200_3017232_+	methyltransferase	NA	NA	NA	NA	NA
WP_069009350.1|3017542_3018277_-	carbonic anhydrase	NA	NA	NA	NA	NA
WP_049527261.1|3018552_3019989_-	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_049527265.1|3020092_3021619_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_049527267.1|3021784_3022525_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_049527270.1|3022616_3022988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164971243.1|3023074_3023242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013650148.1|3023294_3023624_-	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_049527272.1|3023624_3023939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013650150.1|3024049_3024529_-	antitermination protein Q	NA	K7PGW2	Enterobacterial_phage	59.2	1.4e-34
WP_005159354.1|3024802_3025426_+	helix-turn-helix domain-containing protein	NA	F1C599	Cronobacter_phage	53.2	1.6e-51
WP_005159352.1|3025772_3026015_+	DinI family protein	NA	K7PKM2	Enterobacterial_phage	70.9	5.1e-25
WP_049527276.1|3026179_3027115_+|protease	omptin family outer membrane protease	protease	NA	NA	NA	NA
WP_049527278.1|3027440_3029228_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	48.9	6.2e-11
WP_049527280.1|3029297_3030287_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_049527284.1|3030700_3032227_+	MFS transporter	NA	NA	NA	NA	NA
WP_005171542.1|3032406_3033549_+	D-alanyl-D-alanine- carboxypeptidase/endopeptidase AmpH	NA	NA	NA	NA	NA
WP_049527286.1|3034063_3035167_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	58.3	3.0e-112
WP_013650153.1|3037615_3038770_+	MFS transporter	NA	NA	NA	NA	NA
WP_013650154.1|3038792_3041486_+	phosphotransferase RcsD	NA	NA	NA	NA	NA
WP_005159308.1|3041488_3042136_+	transcriptional regulator RcsB	NA	NA	NA	NA	NA
WP_069009695.1|3042397_3045265_-	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	28.4	9.9e-43
WP_013650157.1|3045382_3048040_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	A0A172JHV7	Bacillus_phage	30.9	1.0e-102
WP_049527294.1|3048243_3048972_+	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
WP_013650159.1|3049488_3051774_+	ribonucleoside-diphosphate reductase subunit alpha	NA	I3UMG3	Colwellia_phage	65.1	9.3e-286
WP_005159298.1|3051859_3052990_+	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	79.4	4.0e-173
WP_020283002.1|3053634_3054141_+|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_158506293.1|3054227_3055733_-|protease	calcium-dependent protease	protease	NA	NA	NA	NA
>prophage 11
NZ_CP016944	Yersinia enterocolitica strain YE3 chromosome, complete genome	4664930	3677622	3742752	4664930	tRNA,integrase,transposase,protease	Bacillus_phage(13.33%)	56	3687279:3687332	3701320:3701373
WP_042663659.1|3677622_3678642_+|transposase	IS110-like element ISYen1 family transposase	transposase	NA	NA	NA	NA
WP_049527926.1|3679060_3680305_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	33.9	3.1e-17
WP_005166615.1|3680387_3680783_-	SgcJ/EcaC family oxidoreductase	NA	NA	NA	NA	NA
WP_049527931.1|3682119_3682320_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_049527934.1|3682462_3683665_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	72.0	1.5e-77
WP_049527936.1|3683741_3684170_-	type II toxin-antitoxin system MqsA family antitoxin	NA	NA	NA	NA	NA
WP_005166025.1|3684169_3684466_-	type II toxin-antitoxin system MqsR family toxin	NA	NA	NA	NA	NA
WP_005166026.1|3684622_3684985_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005166028.1|3685050_3685311_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A1S5NR91	Burkholderia_phage	36.0	2.5e-06
3687279:3687332	attL	TGGAGCGGGTGAAGGGAATCGAACCCTCGTATAGAGCTTGGGAAGCTCTCGTTC	NA	NA	NA	NA
WP_049527941.1|3687394_3688615_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_049527943.1|3688690_3689065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049527946.1|3689061_3689271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069009460.1|3690894_3691287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084738254.1|3691695_3692748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049527955.1|3692797_3693070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049527956.1|3694303_3694546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049527959.1|3695188_3695512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049527961.1|3695873_3696074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049527964.1|3696100_3697624_-	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_154295071.1|3697644_3697797_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069009462.1|3698917_3699178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049527969.1|3699181_3699412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049527972.1|3700028_3700577_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A141E0P1	Streptococcus_phage	34.4	1.2e-21
WP_013649344.1|3701563_3703081_-|tRNA	lysine--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	37.6	2.3e-86
3701320:3701373	attR	TGGAGCGGGTGAAGGGAATCGAACCCTCGTATAGAGCTTGGGAAGCTCTCGTTC	NA	NA	NA	NA
WP_020282590.1|3703090_3704189_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	5.4e-05
WP_005166036.1|3704634_3706368_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.7	1.6e-64
WP_013649342.1|3706374_3707091_-	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_005166040.1|3707139_3708039_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	30.2	2.1e-31
WP_005166042.1|3708145_3708664_+	flavodoxin FldB	NA	NA	NA	NA	NA
WP_049527976.1|3708722_3710144_-	cell envelope integrity protein CreD	NA	NA	NA	NA	NA
WP_049527980.1|3710235_3711663_-	two-component system sensor histidine kinase CreC	NA	NA	NA	NA	NA
WP_005166045.1|3711673_3712372_-	two-component system response regulator CreB	NA	NA	NA	NA	NA
WP_005166047.1|3712371_3712797_-	membrane protein	NA	NA	NA	NA	NA
WP_004390965.1|3712777_3713044_-	FAD assembly factor SdhE	NA	NA	NA	NA	NA
WP_049527983.1|3713310_3714303_+|tRNA	tRNA-modifying protein YgfZ	tRNA	NA	NA	NA	NA
WP_084738255.1|3714498_3715518_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_050155820.1|3715928_3716612_-	hemolysin III family protein	NA	NA	NA	NA	NA
WP_069009466.1|3716842_3717445_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_013649334.1|3717457_3718207_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.5	2.6e-27
WP_049527993.1|3718222_3718660_-	lipocalin-like domain-containing protein	NA	NA	NA	NA	NA
WP_049527996.1|3718993_3721882_-	aminomethyl-transferring glycine dehydrogenase	NA	M4QFZ1	Prochlorococcus_phage	52.7	4.2e-267
WP_005164125.1|3721981_3722368_-	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_013649331.1|3722434_3723532_-	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_023160249.1|3723924_3725139_-	FAD-dependent 2-octaprenylphenol hydroxylase	NA	NA	NA	NA	NA
WP_050126799.1|3725226_3726396_-	2-octaprenyl-6-methoxyphenyl hydroxylase	NA	NA	NA	NA	NA
WP_069009468.1|3726399_3727713_-	Xaa-Pro aminopeptidase	NA	NA	NA	NA	NA
WP_005164114.1|3727767_3728346_-	YecA family protein	NA	NA	NA	NA	NA
WP_004706812.1|3728801_3729131_+	cell division protein ZapA	NA	NA	NA	NA	NA
WP_005164106.1|3729634_3730231_+	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_005164105.1|3730376_3731672_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	58.0	2.2e-130
WP_013649329.1|3731751_3733389_-	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.7	1.6e-154
WP_013649328.1|3733600_3734437_-	nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_005164102.1|3734724_3736959_-	GTP diphosphokinase	NA	NA	NA	NA	NA
WP_049528014.1|3736968_3738300_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	27.4	5.1e-34
WP_049528017.1|3738356_3741221_+	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	29.2	2.7e-48
WP_013649325.1|3741315_3742752_-|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	31.0	5.0e-27
>prophage 1
NZ_CP016942	Yersinia enterocolitica strain YE3 plasmid unnamed1, complete sequence	100788	17158	64174	100788	transposase,integrase	Escherichia_phage(35.71%)	33	16843:16860	78892:78909
16843:16860	attL	TTTTGTGCATGCACAAAA	NA	NA	NA	NA
WP_057618936.1|17158_17929_-|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	52.0	8.9e-23
WP_069009811.1|19313_20042_+	DUF4145 domain-containing protein	NA	NA	NA	NA	NA
WP_129019439.1|20643_21341_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	43.6	1.0e-41
WP_069009821.1|21699_22203_-	Dabb family protein	NA	NA	NA	NA	NA
WP_129019440.1|22400_23093_+|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	36.4	1.4e-35
WP_069009823.1|23526_24366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069027915.1|24368_25187_+	inverse autotransporter beta domain-containing protein	NA	NA	NA	NA	NA
WP_071932345.1|25153_26332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129019439.1|26568_27266_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	43.6	1.0e-41
WP_071891488.1|27405_28296_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_164971250.1|29025_29346_+	CaiF/GrlA family transcriptional regulator	NA	NA	NA	NA	NA
WP_129019438.1|29819_30517_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	43.6	2.9e-41
WP_069009830.1|30782_31577_+	hypothetical protein	NA	B6SD27	Bacteriophage	34.6	1.1e-23
WP_057619010.1|31653_34614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050128036.1|34662_35331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050128037.1|35397_36819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057619012.1|36834_38442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129019437.1|38527_39224_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	5.5e-40
WP_164971249.1|39676_40213_-	CaiF/GrlA family transcriptional regulator	NA	NA	NA	NA	NA
WP_129028057.1|42177_42801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069027917.1|42790_44899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069027918.1|45456_49971_-	RHS repeat-associated core domain-containing protein	NA	A0A1W5K0N1	Bacteriophage	33.8	2.0e-178
WP_050128033.1|50227_50470_+|transposase	IS3 family transposase	transposase	Q716C1	Shigella_phage	64.7	3.3e-16
WP_129019436.1|50483_51181_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	1.9e-40
WP_050128092.1|52634_52928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050128091.1|52990_53626_-	ParA family protein	NA	NA	NA	NA	NA
WP_069009764.1|53906_54554_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.0	7.3e-10
WP_071891490.1|54752_55127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050127682.1|57296_58016_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	43.7	2.5e-35
WP_164971253.1|58052_59750_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	A0A0R6PI85	Moraxella_phage	28.3	9.7e-38
WP_057618893.1|59995_61942_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_050127681.1|62578_63217_-	recombinase family protein	NA	NA	NA	NA	NA
WP_129019443.1|63400_64174_-|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	81.4	6.1e-48
78892:78909	attR	TTTTGTGCATGCACAAAA	NA	NA	NA	NA
>prophage 1
NZ_CP016943	Yersinia enterocolitica strain YE3 plasmid unnamed2, complete sequence	73026	25535	33317	73026	transposase	uncultured_Caudovirales_phage(57.14%)	9	NA	NA
WP_050294038.1|25535_26234_-	arsenic resistance NADPH-dependent reductase ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	68.1	4.2e-88
WP_013749489.1|26319_26640_+	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	46.7	1.7e-20
WP_057618950.1|26685_27975_+	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	70.4	7.1e-166
WP_010891244.1|27987_28413_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	5.6e-51
WP_050294040.1|28430_29012_-	recombinase family protein	NA	A0A219YA40	Aeromonas_phage	35.5	3.3e-22
WP_071890451.1|29187_30024_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.5	4.2e-18
WP_010891241.1|30179_30632_+	PprA	NA	NA	NA	NA	NA
WP_013749484.1|30953_31829_-	DMT family transporter	NA	NA	NA	NA	NA
WP_050294042.1|31898_33317_-	trimeric autotransporter adhesin YadA	NA	Q9MCI8	Enterobacteria_phage	55.6	2.6e-12
