The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP016940	Yersinia enterocolitica strain YE5 chromosome, complete genome	4593248	93963	174964	4593248	protease,transposase,bacteriocin	Enterobacterial_phage(33.33%)	53	NA	NA
WP_057618920.1|93963_94215_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_005162673.1|94497_94752_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_005162670.1|95064_95424_+	antitermination protein	NA	K7PGW2	Enterobacterial_phage	47.5	1.7e-21
WP_032904442.1|95526_96285_-	molecular chaperone	NA	NA	NA	NA	NA
WP_084738262.1|100399_101077_-	molecular chaperone	NA	NA	NA	NA	NA
WP_049525161.1|101272_102304_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_005165289.1|103246_104209_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_072087397.1|104242_104704_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_049528676.1|105964_106819_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_005165296.1|107047_107416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129019424.1|107479_107632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005166182.1|109078_110542_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_069008916.1|110774_112181_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_016266334.1|114144_114609_-	Large exoprotein involved in heme utilization or adhesion	NA	NA	NA	NA	NA
WP_005166173.1|117277_118810_-	signal transduction histidine-protein kinase/phosphatase UhpB	NA	NA	NA	NA	NA
WP_049528662.1|118806_119397_-	transcriptional regulator UhpA	NA	NA	NA	NA	NA
WP_050127428.1|119508_121200_-	kdo(2)-lipid A phosphoethanolamine 7''-transferase	NA	NA	NA	NA	NA
WP_048618714.1|121459_121885_-	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_023160836.1|122355_123375_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_069008919.1|124186_125794_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005157323.1|126076_127096_+	dipeptide ABC transporter permease DppB	NA	NA	NA	NA	NA
WP_049525223.1|127106_128009_+	dipeptide ABC transporter permease DppC	NA	NA	NA	NA	NA
WP_049525224.1|128024_129005_+	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.9	2.5e-14
WP_005157326.1|129019_130024_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.7	1.7e-18
WP_049525225.1|130366_132019_-	cellulose biosynthesis protein BcsG	NA	NA	NA	NA	NA
WP_005157335.1|132021_132210_-	cellulose biosynthesis protein BcsF	NA	NA	NA	NA	NA
WP_049525226.1|132206_133766_-	cellulose biosynthesis protein BcsE	NA	NA	NA	NA	NA
WP_005157340.1|133963_134155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013650602.1|134158_134896_+	cellulose synthase operon protein YhjQ	NA	NA	NA	NA	NA
WP_049525228.1|134892_137520_+	UDP-forming cellulose synthase catalytic subunit	NA	NA	NA	NA	NA
WP_072087275.1|137527_139834_+	cellulose biosynthesis cyclic di-GMP-binding regulatory protein BcsB	NA	NA	NA	NA	NA
WP_057618858.1|139839_140967_+	cellulase	NA	NA	NA	NA	NA
WP_069008921.1|140948_144323_+	cellulose biosynthesis protein BcsC	NA	NA	NA	NA	NA
WP_084738263.1|144553_146083_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_005157352.1|146807_147512_+	porin	NA	NA	NA	NA	NA
WP_005157353.1|147588_149307_+	pectate lyase	NA	NA	NA	NA	NA
WP_069008923.1|149431_149911_+	discoidin domain-containing protein	NA	NA	NA	NA	NA
WP_005157357.1|150288_151581_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_005157359.1|151995_153486_+	insulinase family protein	NA	NA	NA	NA	NA
WP_005157362.1|153645_154590_-	sugar kinase	NA	NA	NA	NA	NA
WP_004388926.1|154734_154935_-	4-oxalocrotonate tautomerase family protein	NA	NA	NA	NA	NA
WP_072079324.1|155188_155965_+	cyclic-guanylate-specific phosphodiesterase	NA	NA	NA	NA	NA
WP_049525233.1|158239_159004_-	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_049525234.1|159027_160017_-	inner membrane protein YhjD	NA	NA	NA	NA	NA
WP_069008925.1|160433_163676_+	autotransporter adhesin YapE	NA	NA	NA	NA	NA
WP_005157379.1|164034_165387_-	glutathione-disulfide reductase	NA	NA	NA	NA	NA
WP_049525236.1|165630_166473_-	23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ	NA	NA	NA	NA	NA
WP_023160901.1|166809_168852_+	oligopeptidase A	NA	NA	NA	NA	NA
WP_020283527.1|168855_169614_+	16S rRNA (guanine(1516)-N(2))-methyltransferase RsmJ	NA	NA	NA	NA	NA
WP_013650589.1|169680_170922_-|protease	metalloprotease	protease	NA	NA	NA	NA
WP_049525237.1|171144_172488_-	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_005157389.1|172751_173198_-	universal stress protein UspA	NA	NA	NA	NA	NA
WP_023160836.1|173944_174964_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP016940	Yersinia enterocolitica strain YE5 chromosome, complete genome	4593248	451498	583509	4593248	holin,protease,capsid,tail,integrase,tRNA,head,transposase,terminase	Cronobacter_phage(39.47%)	114	451194:451222	538961:538989
451194:451222	attL	CGCCATATATGGACGCTCCCAATAAACCA	NA	NA	NA	NA
WP_042663659.1|451498_452518_-|transposase	IS110-like element ISYen1 family transposase	transposase	NA	NA	NA	NA
WP_005174358.1|452715_453636_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	53.5	8.0e-79
WP_049525329.1|453994_455407_-	anion permease	NA	NA	NA	NA	NA
WP_005163087.1|455916_456129_-	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	80.0	4.4e-25
WP_005163090.1|456400_456613_-	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	80.0	1.7e-24
WP_005163093.1|456994_457465_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_002210061.1|459338_459635_-	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
WP_005163099.1|459655_460621_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_005163101.1|461063_461945_-	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_049525330.1|462036_463491_-	sodium/pantothenate symporter	NA	NA	NA	NA	NA
WP_005163104.1|463480_463723_-	YhdT family protein	NA	NA	NA	NA	NA
WP_005163110.1|463861_465211_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_005163113.1|465222_465687_-	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_049525331.1|465719_466172_-	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_049525332.1|466380_466980_-	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_005163122.1|466979_468014_-	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_005163130.1|468167_469145_-	oxidoreductase	NA	NA	NA	NA	NA
WP_069008954.1|469429_471349_+	RNase E specificity factor CsrD	NA	NA	NA	NA	NA
WP_002228205.1|471683_472727_+	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.0e-06
WP_005163136.1|472826_473813_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_005163138.1|473809_474298_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_005180107.1|474311_474905_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_049525335.1|474894_476364_+	ribonuclease G	NA	NA	NA	NA	NA
WP_069008956.1|476565_480441_+	AsmA2 domain-containing protein	NA	NA	NA	NA	NA
WP_005163159.1|480437_481298_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_049525337.1|481309_482755_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_069008958.1|482808_484095_-	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_013650506.1|484091_484370_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129019373.1|487770_488007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005163183.1|487939_488299_-	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_020282680.1|488295_488697_-	M15 family metallopeptidase	NA	A9DET4	Yersinia_phage	58.4	1.4e-40
WP_005163187.1|488705_489017_-|holin	holin	holin	R9W0A1	Serratia_phage	51.2	3.1e-19
WP_069008960.1|489093_493596_-	toxin	NA	NA	NA	NA	NA
WP_050127097.1|493652_497183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005163194.1|500853_501765_-	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
WP_005163197.1|502090_502294_+	AaeX family protein	NA	NA	NA	NA	NA
WP_050127093.1|502301_503237_+	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
WP_069008961.1|503238_505194_+	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
WP_049525342.1|505315_506809_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_020282687.1|506921_507380_+	ribonuclease	NA	NA	NA	NA	NA
WP_004392366.1|507384_507651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005163212.1|507682_508228_-	ribosome-associated protein	NA	NA	NA	NA	NA
WP_049525344.1|508365_509358_-|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	60.4	2.8e-109
WP_049525345.1|509424_509724_-	helix-turn-helix transcriptional regulator	NA	Q1JS29	Enterobacteria_phage	74.7	4.6e-36
WP_129019376.1|509833_510166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049525347.1|510292_510514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049525348.1|510528_510885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049525349.1|510957_511224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049525350.1|511223_512120_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	E5G6L8	Salmonella_phage	51.0	2.8e-76
WP_049525351.1|512116_513154_+	phosphoadenosine phosphosulfate reductase family protein	NA	B7SYG0	Stenotrophomonas_phage	42.6	7.7e-62
WP_069008964.1|513150_515556_+	replication endonuclease	NA	F1BUS0	Erwinia_phage	49.9	1.2e-203
WP_049525352.1|515601_515862_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	64.3	1.3e-26
WP_069008967.1|516939_518727_-|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	66.6	4.8e-237
WP_049525354.1|518896_519754_+|capsid	phage capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	48.1	2.7e-44
WP_049525355.1|519819_520851_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	76.4	3.6e-144
WP_049525356.1|520860_521559_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	53.9	4.5e-66
WP_072087891.1|521654_522107_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	56.0	1.4e-39
WP_049525357.1|522103_522592_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	44.8	4.2e-34
WP_049525359.1|524083_524539_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	60.9	9.8e-46
WP_049525360.1|524548_524839_+|holin	holin	holin	C7BGD7	Burkholderia_phage	50.6	6.7e-16
WP_049525361.1|524835_525177_+	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	82.2	1.4e-44
WP_049525362.1|525176_525518_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	41.8	4.4e-14
WP_004389570.1|525667_525934_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	53.7	5.1e-18
WP_057618720.1|526121_528098_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	48.5	1.9e-170
WP_049525364.1|528097_528430_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	67.3	1.7e-34
WP_049525365.1|528422_529607_+	phage protein	NA	F1BUK6	Cronobacter_phage	67.0	1.3e-153
WP_049525366.1|529599_530208_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	63.6	9.4e-68
WP_049525367.1|532062_532536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049525368.1|532525_533257_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	47.1	3.9e-44
WP_049525369.1|535638_535845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049525370.1|535979_536816_-	abortive infection family protein	NA	NA	NA	NA	NA
WP_069008969.1|537351_538692_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_042663659.1|539241_540261_-|transposase	IS110-like element ISYen1 family transposase	transposase	NA	NA	NA	NA
538961:538989	attR	CGCCATATATGGACGCTCCCAATAAACCA	NA	NA	NA	NA
WP_005162547.1|540792_541179_+	cytochrome b562	NA	NA	NA	NA	NA
WP_005162545.1|541226_541637_-	nucleoside diphosphate kinase regulator	NA	NA	NA	NA	NA
WP_005174305.1|542168_542513_+	glycine dehydrogenase	NA	NA	NA	NA	NA
WP_004392359.1|542536_542902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005162543.1|542901_543198_+	DUF4312 family protein	NA	NA	NA	NA	NA
WP_005162542.1|543210_543987_+	DUF4311 domain-containing protein	NA	NA	NA	NA	NA
WP_020282728.1|544005_544659_+	DUF4310 family protein	NA	NA	NA	NA	NA
WP_049525373.1|544742_545912_+	amidohydrolase/deacetylase family metallohydrolase	NA	NA	NA	NA	NA
WP_013650491.1|545895_547008_+	DgaE family pyridoxal phosphate-dependent ammonia lyase	NA	NA	NA	NA	NA
WP_049525374.1|547011_547752_+	KDGP aldolase family protein	NA	NA	NA	NA	NA
WP_072079298.1|549195_551124_+	BglG family transcription antiterminator	NA	NA	NA	NA	NA
WP_049525376.1|551195_551501_-	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	66.3	1.5e-29
WP_005162526.1|551500_551779_-	plasmid maintenance system killer protein	NA	A0A2L1IV28	Escherichia_phage	77.2	6.0e-38
WP_049525377.1|555082_556030_+	HTH-type transcriptional regulator TreR	NA	NA	NA	NA	NA
WP_049525378.1|557728_559390_+	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_049525379.1|559731_560466_-|protease	proteasome-type protease	protease	NA	NA	NA	NA
WP_005162507.1|560489_561311_-	transglutaminase family protein	NA	NA	NA	NA	NA
WP_005162503.1|561307_562237_-	alpha-E domain-containing protein	NA	NA	NA	NA	NA
WP_011817265.1|562230_563667_-	circularly permuted type 2 ATP-grasp protein	NA	NA	NA	NA	NA
WP_005162498.1|563934_564321_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_005162495.1|564814_565279_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_049525380.1|565290_566226_-	aspartate carbamoyltransferase	NA	A7RB08	Paramecium_bursaria_Chlorella_virus	40.2	2.7e-50
WP_005162489.1|567352_567625_-	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_005162486.1|567625_568477_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	29.3	1.9e-05
WP_005162484.1|568555_569038_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_005162480.1|569208_569496_-	ribosome hibernation promoting factor	NA	NA	NA	NA	NA
WP_049525381.1|569519_570953_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_004392029.1|571156_571882_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.4	1.6e-21
WP_049525382.1|571888_572434_-	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_049525383.1|572417_572981_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_049525384.1|572977_573541_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	79.3	6.9e-57
WP_020282736.1|573554_574532_-	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	29.5	7.3e-38
WP_005162453.1|575729_576533_+	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	31.7	1.3e-19
WP_069008970.1|576547_577330_+	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
WP_005162449.1|577334_577895_+	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_005162447.1|577907_578534_+	phospholipid-binding protein MlaC	NA	NA	NA	NA	NA
WP_005180174.1|578536_578878_+	lipid asymmetry maintenance protein MlaB	NA	NA	NA	NA	NA
WP_005162441.1|579052_579307_+	BolA family iron metabolism protein IbaG	NA	NA	NA	NA	NA
WP_005162439.1|579428_580697_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_069009633.1|580958_582047_-	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	33.8	1.4e-10
WP_050127209.1|582135_583509_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	29.0	6.0e-22
>prophage 3
NZ_CP016940	Yersinia enterocolitica strain YE5 chromosome, complete genome	4593248	1056226	1103212	4593248	protease,plate,integrase,head,lysis,terminase	Edwardsiella_phage(26.92%)	72	1054831:1054844	1073217:1073230
1054831:1054844	attL	TCAGCGGCATTCAT	NA	NA	NA	NA
WP_050294021.1|1056226_1057498_-|integrase	site-specific integrase	integrase	Q8W658	Enterobacteria_phage	52.7	1.4e-126
WP_049525557.1|1057530_1057782_-	DNA-binding protein	NA	A0A286S2A4	Klebsiella_phage	50.0	5.8e-16
WP_049525558.1|1058139_1058775_-	DNA methyltransferase	NA	I6PDF5	Cronobacter_phage	73.0	7.2e-87
WP_049525559.1|1058771_1058990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129019389.1|1059399_1059786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050128071.1|1059775_1059997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049525779.1|1060021_1060291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049525781.1|1060292_1060721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057619046.1|1060717_1061125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049526811.1|1061166_1061349_-	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	59.6	1.3e-09
WP_057619042.1|1061345_1062281_-	recombinase RecT	NA	A0A193GYL3	Enterobacter_phage	62.5	2.4e-107
WP_069009644.1|1062273_1063092_-	exodeoxyribonuclease VIII	NA	E5AGE0	Erwinia_phage	74.1	2.6e-121
WP_049526808.1|1063091_1063385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129019391.1|1063488_1063620_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	NA	NA	NA	NA
WP_069009030.1|1063637_1064657_-	hypothetical protein	NA	K7P6J9	Enterobacteria_phage	64.4	1.2e-30
WP_049525794.1|1064745_1065039_-	hypothetical protein	NA	A0A0B4SK56	Proteus_phage	31.3	7.6e-07
WP_049525796.1|1065584_1065926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071828178.1|1066084_1066264_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154236085.1|1066468_1066627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050344824.1|1066629_1066926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049528945.1|1067418_1067628_+	DUF2767 family protein	NA	I6R0R9	Salmonella_phage	47.5	5.9e-06
WP_049525800.1|1067672_1068116_-	hypothetical protein	NA	M1FPN8	Enterobacteria_phage	50.4	4.3e-30
WP_049525803.1|1068133_1068979_-	hypothetical protein	NA	M1FPD4	Enterobacteria_phage	44.3	4.6e-57
WP_012304433.1|1069108_1069831_-	LexA family transcriptional regulator	NA	A0A2R2X2B0	Escherichia_phage	55.5	2.3e-65
WP_042562436.1|1069935_1070130_+	Cro/Cl family transcriptional regulator	NA	K7PLQ6	Enterobacteria_phage	85.5	4.2e-22
WP_050296274.1|1070241_1070535_+	hypothetical protein	NA	A2SY75	Escherichia_phage	63.9	6.1e-25
WP_049526793.1|1070559_1071162_+	hypothetical protein	NA	M1F3E2	Salmonella_phage	41.6	1.6e-35
WP_069009033.1|1071158_1071998_+	replication protein	NA	A0A075B8J2	Enterobacteria_phage	61.9	3.2e-34
WP_050344860.1|1071994_1072849_+	AAA family ATPase	NA	K7PLU3	Enterobacteria_phage	57.5	2.2e-86
WP_129019429.1|1072989_1073187_+	hypothetical protein	NA	K7PHN9	Enterobacterial_phage	61.9	9.2e-17
WP_069009034.1|1073183_1073486_+	hypothetical protein	NA	NA	NA	NA	NA
1073217:1073230	attR	ATGAATGCCGCTGA	NA	NA	NA	NA
WP_049525574.1|1073976_1074174_+	hypothetical protein	NA	A0A2H4FUS3	Salmonella_phage	42.2	5.1e-07
WP_049525575.1|1074317_1074788_+	recombination protein NinB	NA	I6R9D0	Salmonella_phage	53.9	2.6e-41
WP_049526784.1|1075409_1075700_+	DUF1364 domain-containing protein	NA	A0A220NQY2	Salmonella_phage	75.8	1.3e-38
WP_049526782.1|1075696_1076059_+	RusA family crossover junction endodeoxyribonuclease	NA	E5AGG1	Erwinia_phage	65.8	8.7e-37
WP_049526779.1|1076267_1077092_+	antitermination protein	NA	M9NZB0	Enterobacteria_phage	53.6	1.3e-75
WP_049525816.1|1077565_1078099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049528949.1|1078316_1078598_+	hypothetical protein	NA	H6WRZ3	Salmonella_phage	54.3	1.1e-18
WP_049526777.1|1078597_1079110_+	lysozyme	NA	I6PBN2	Cronobacter_phage	59.9	2.4e-48
WP_049525819.1|1079094_1079556_+|lysis	lysis protein	lysis	A5LH84	Enterobacteria_phage	43.0	1.7e-21
WP_069009038.1|1079873_1080560_+	Rha family transcriptional regulator	NA	A0A192Y918	Salmonella_phage	86.0	6.5e-110
WP_155296413.1|1080562_1080736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069009040.1|1080802_1081027_+	hypothetical protein	NA	A0A127KNL9	Pseudomonas_phage	64.7	7.0e-05
WP_069009041.1|1081086_1081287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069009044.1|1081290_1081482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069009046.1|1081492_1081969_+|terminase	terminase	terminase	C7U0V7	Enterobacteria_phage	74.1	3.2e-55
WP_069009047.1|1081970_1083647_+|terminase	phage terminase large subunit	terminase	H9C191	Pectobacterium_phage	72.6	7.9e-242
WP_069009050.1|1083647_1085183_+	DUF1073 domain-containing protein	NA	A0A2R3UAL5	Myoviridae_environmental_samples	44.2	1.0e-102
WP_069009051.1|1085235_1085931_+|head	phage head morphogenesis protein	head	H9C0V1	Aeromonas_phage	54.9	1.3e-65
WP_069009052.1|1085927_1086116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069009054.1|1086161_1087349_+	DUF2213 domain-containing protein	NA	A0A219YCD3	Aeromonas_phage	36.3	2.9e-57
WP_069009056.1|1087350_1087833_+	hypothetical protein	NA	A0A219YBF2	Aeromonas_phage	51.0	1.4e-34
WP_069009059.1|1087832_1088876_+	DUF2184 domain-containing protein	NA	A0A219YBB0	Aeromonas_phage	49.4	7.9e-83
WP_057627536.1|1088879_1089206_+	hypothetical protein	NA	H9C0V9	Aeromonas_phage	41.1	2.1e-10
WP_069009061.1|1089208_1089652_+	DUF4054 domain-containing protein	NA	Q2NPC6	Xanthomonas_phage	50.0	3.1e-20
WP_069009062.1|1089654_1090185_+	hypothetical protein	NA	A0A077KC03	Edwardsiella_phage	43.6	1.4e-27
WP_069009064.1|1090162_1090534_+	hypothetical protein	NA	A0A077KAW7	Edwardsiella_phage	61.0	5.0e-40
WP_084738241.1|1090530_1091049_+	hypothetical protein	NA	A0A077KC88	Edwardsiella_phage	68.5	2.1e-60
WP_049525848.1|1091045_1092533_+	DUF3383 domain-containing protein	NA	A0A077KGV4	Edwardsiella_phage	61.9	4.5e-164
WP_049525852.1|1092542_1092977_+	hypothetical protein	NA	A0A077K9T0	Edwardsiella_phage	67.1	1.6e-53
WP_049525854.1|1092976_1093384_+	hypothetical protein	NA	A0A077KC08	Edwardsiella_phage	60.7	8.3e-36
WP_049525857.1|1093598_1095359_+	lytic transglycosylase domain-containing protein	NA	A0A077KC92	Edwardsiella_phage	38.6	2.4e-100
WP_049525859.1|1095363_1095765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049525861.1|1095841_1096300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049525864.1|1096412_1097231_+	hypothetical protein	NA	A0A077KGW3	Edwardsiella_phage	57.9	4.8e-75
WP_049525866.1|1097227_1097533_+	hypothetical protein	NA	A0A077K9U4	Edwardsiella_phage	63.0	9.2e-32
WP_049525867.1|1097522_1098380_+	hypothetical protein	NA	A0A077KC17	Edwardsiella_phage	53.6	3.0e-80
WP_049525869.1|1098376_1099087_+|plate	phage baseplate assembly protein	plate	A0A077KAY0	Edwardsiella_phage	52.9	1.4e-59
WP_049525871.1|1099083_1099443_+	hypothetical protein	NA	A0A077KCA1	Edwardsiella_phage	73.7	1.2e-43
WP_069009065.1|1099439_1100681_+	hypothetical protein	NA	A0A077KGW9	Edwardsiella_phage	67.8	1.7e-156
WP_049525876.1|1100677_1101319_+	DUF2612 domain-containing protein	NA	A0A077K9U8	Edwardsiella_phage	73.6	1.1e-87
WP_129019393.1|1101496_1103212_+	hypothetical protein	NA	A9YX14	Burkholderia_phage	39.8	7.0e-52
>prophage 4
NZ_CP016940	Yersinia enterocolitica strain YE5 chromosome, complete genome	4593248	1303022	1424837	4593248	holin,protease,portal,plate,tail,capsid,integrase,coat,tRNA,head,transposase,lysis,terminase	Enterobacteria_phage(18.82%)	169	1309273:1309287	1359774:1359789
WP_023160990.1|1303022_1303661_-|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_005158259.1|1303628_1304315_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.2	2.7e-31
WP_049525769.1|1304311_1306738_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_005158266.1|1306877_1307942_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_049525771.1|1307938_1308463_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	38.5	5.3e-19
WP_049525773.1|1308638_1309361_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
1309273:1309287	attL	GCTTCACGCTGGATA	NA	NA	NA	NA
WP_005158275.1|1309371_1309866_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
1309273:1309287	attL	GCTTCACGCTGGATA	NA	NA	NA	NA
WP_020283435.1|1310078_1311464_+|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	32.0	5.5e-39
WP_004390634.1|1311632_1311845_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_005158281.1|1311859_1312726_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	35.0	3.7e-33
WP_050344586.1|1313048_1314203_-|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	71.1	6.2e-161
WP_049525558.1|1314803_1315439_-	DNA methyltransferase	NA	I6PDF5	Cronobacter_phage	73.0	7.2e-87
WP_049525559.1|1315435_1315654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129019389.1|1316063_1316450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050128071.1|1316439_1316661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049525779.1|1316685_1316955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049525781.1|1316956_1317385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057619046.1|1317381_1317789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049526811.1|1317830_1318013_-	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	59.6	1.3e-09
WP_057619042.1|1318009_1318945_-	recombinase RecT	NA	A0A193GYL3	Enterobacter_phage	62.5	2.4e-107
WP_069009644.1|1318937_1319756_-	exodeoxyribonuclease VIII	NA	E5AGE0	Erwinia_phage	74.1	2.6e-121
WP_049526808.1|1319755_1320049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129019391.1|1320152_1320284_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	NA	NA	NA	NA
WP_050293951.1|1320301_1321321_-	hypothetical protein	NA	K7P6J9	Enterobacteria_phage	65.3	1.8e-31
1320513:1320527	attR	GCTTCACGCTGGATA	NA	NA	NA	NA
WP_049525794.1|1321409_1321703_-	hypothetical protein	NA	A0A0B4SK56	Proteus_phage	31.3	7.6e-07
1320513:1320527	attR	GCTTCACGCTGGATA	NA	NA	NA	NA
WP_049525796.1|1322218_1322560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071828178.1|1322718_1322898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154236085.1|1323102_1323261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049525565.1|1323263_1323548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049611538.1|1324045_1324798_-	helix-turn-helix transcriptional regulator	NA	G8C7L8	Escherichia_phage	41.2	7.3e-30
WP_049611541.1|1324915_1325149_+	antirepressor	NA	A0A0P0ZDD7	Stx2-converting_phage	58.4	6.4e-17
WP_057619037.1|1325260_1325554_+	hypothetical protein	NA	A2SY75	Escherichia_phage	62.9	8.0e-25
WP_057619038.1|1325578_1326283_+	hypothetical protein	NA	Q71T76	Escherichia_phage	54.0	2.1e-63
WP_071890465.1|1326279_1327101_+	replication protein	NA	K7PL20	Enterobacteria_phage	64.3	5.5e-55
WP_069009079.1|1327097_1327952_+	AAA family ATPase	NA	K7PLU3	Enterobacteria_phage	57.3	8.2e-86
WP_129019430.1|1328092_1328290_+	hypothetical protein	NA	K7PHN9	Enterobacterial_phage	61.9	9.2e-17
WP_049525572.1|1328286_1328589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050128082.1|1328585_1329086_+	DUF551 domain-containing protein	NA	NA	NA	NA	NA
WP_049525574.1|1329085_1329283_+	hypothetical protein	NA	A0A2H4FUS3	Salmonella_phage	42.2	5.1e-07
WP_049525575.1|1329426_1329897_+	recombination protein NinB	NA	I6R9D0	Salmonella_phage	53.9	2.6e-41
WP_049526784.1|1330518_1330809_+	DUF1364 domain-containing protein	NA	A0A220NQY2	Salmonella_phage	75.8	1.3e-38
WP_049526782.1|1330805_1331168_+	RusA family crossover junction endodeoxyribonuclease	NA	E5AGG1	Erwinia_phage	65.8	8.7e-37
WP_049526779.1|1331376_1332201_+	antitermination protein	NA	M9NZB0	Enterobacteria_phage	53.6	1.3e-75
WP_050344746.1|1332674_1333208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049525581.1|1333399_1333717_+|holin	holin	holin	E7C9S8	Salmonella_phage	57.6	8.4e-28
WP_049525582.1|1333703_1334102_+	M15 family metallopeptidase	NA	E7C9S9	Salmonella_phage	61.7	1.0e-38
WP_069009658.1|1334119_1334620_+	DUF2514 family protein	NA	Q7Y3V2	Yersinia_phage	86.7	1.8e-72
WP_049525583.1|1334630_1335041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129019398.1|1335071_1335338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049525585.1|1335548_1335782_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.1e-16
WP_049525586.1|1335858_1336503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049525588.1|1336968_1337568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_102970453.1|1337536_1339516_+|terminase	phage terminase large subunit family protein	terminase	G8EXZ6	Synechococcus_phage	46.0	3.1e-136
WP_005278866.1|1339524_1339788_+|head,tail	phage head-tail adapter protein	head,tail	NA	NA	NA	NA
WP_049525589.1|1339856_1341440_+|portal	phage portal protein	portal	A0A291AUL8	Sinorhizobium_phage	38.5	1.2e-98
WP_049525590.1|1341436_1342297_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	39.9	1.1e-50
WP_049525591.1|1342289_1342883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049525592.1|1342882_1343284_+|head	head decoration protein	head	NA	NA	NA	NA
WP_049525593.1|1343393_1344440_+|capsid	major capsid protein	capsid	Q6UYI3	Burkholderia_phage	30.7	4.9e-40
WP_049525594.1|1344441_1344936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049525596.1|1344935_1345280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049525598.1|1345276_1345822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049525600.1|1345827_1346019_+	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_050156942.1|1346018_1347509_+|tail	phage tail protein	tail	B5TK67	Pseudomonas_phage	44.2	2.6e-103
WP_050319427.1|1347521_1347896_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_049525606.1|1347897_1348200_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_069009080.1|1348317_1350120_+	lytic transglycosylase domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	49.2	1.1e-23
WP_050879847.1|1350177_1351584_+	hypothetical protein	NA	Q8W619	Enterobacteria_phage	27.6	6.8e-21
WP_049525612.1|1351580_1352654_+|tail	tail protein	tail	M1PVV2	Vibrio_phage	30.1	5.5e-39
WP_049525614.1|1352650_1353244_+|plate	phage baseplate assembly protein	plate	NA	NA	NA	NA
WP_049525616.1|1353240_1353678_+	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	45.4	3.4e-19
WP_050156966.1|1353681_1354818_+|plate	baseplate J/gp47 family protein	plate	A0A1E1GE19	Vibrio_phage	28.0	1.7e-09
WP_050107865.1|1354814_1355411_+	YmfQ family protein	NA	A0A2P9JZK7	Alteromonadaceae_phage	39.8	4.6e-35
WP_069009081.1|1356917_1357100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080382458.1|1357191_1358307_+	acyltransferase	NA	A0A2H4JA46	uncultured_Caudovirales_phage	28.0	5.8e-23
WP_071890467.1|1358525_1359548_-|integrase	site-specific integrase	integrase	F1C5B2	Cronobacter_phage	67.1	2.8e-141
WP_046051422.1|1359565_1359913_-	helix-turn-helix domain-containing protein	NA	M1FJ59	Enterobacteria_phage	58.3	2.4e-28
WP_049525558.1|1360270_1360906_-	DNA methyltransferase	NA	I6PDF5	Cronobacter_phage	73.0	7.2e-87
WP_049525559.1|1360902_1361121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129019389.1|1361530_1361917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050128071.1|1361906_1362128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049525779.1|1362152_1362422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049525781.1|1362423_1362852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069009084.1|1362848_1363256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154236079.1|1363299_1363473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049525787.1|1363706_1364303_-	hypothetical protein	NA	K7PHD7	Enterobacteria_phage	51.6	3.0e-42
WP_049525790.1|1364299_1364980_-	AAA family ATPase	NA	A0A2D1GLT5	Escherichia_phage	69.0	2.6e-90
WP_049525792.1|1364951_1365200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154236080.1|1365196_1365370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049525794.1|1365635_1365929_-	hypothetical protein	NA	A0A0B4SK56	Proteus_phage	31.3	7.6e-07
WP_069009085.1|1365950_1366319_-	hypothetical protein	NA	B9UDG8	Salmonella_phage	50.0	2.1e-38
WP_049525796.1|1366428_1366770_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071828178.1|1366928_1367108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154236085.1|1367312_1367471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049525798.1|1367473_1367758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049528945.1|1368256_1368466_+	DUF2767 family protein	NA	I6R0R9	Salmonella_phage	47.5	5.9e-06
WP_049525800.1|1368510_1368954_-	hypothetical protein	NA	M1FPN8	Enterobacteria_phage	50.4	4.3e-30
WP_049525803.1|1368971_1369817_-	hypothetical protein	NA	M1FPD4	Enterobacteria_phage	44.3	4.6e-57
WP_080347400.1|1369957_1370656_-	helix-turn-helix transcriptional regulator	NA	A0A2D1GM27	Escherichia_phage	63.9	2.6e-82
WP_049525807.1|1370814_1371045_+	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	47.1	5.0e-06
WP_049525808.1|1371160_1371454_+	hypothetical protein	NA	A2SY75	Escherichia_phage	62.9	1.2e-23
WP_049525811.1|1371463_1372000_+	hypothetical protein	NA	A0A291AXH9	Shigella_phage	53.6	1.2e-50
WP_049525571.1|1372246_1373149_+	replication protein	NA	C6ZR51	Salmonella_phage	56.0	2.2e-36
WP_049525813.1|1373148_1374486_+	AAA family ATPase	NA	A0A2I7REC3	Vibrio_phage	38.7	1.5e-81
WP_050128081.1|1374498_1374723_+	hypothetical protein	NA	A0A192Y6R5	Salmonella_phage	63.8	2.5e-18
WP_129019429.1|1374863_1375061_+	hypothetical protein	NA	K7PHN9	Enterobacterial_phage	61.9	9.2e-17
WP_049525572.1|1375057_1375360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050294067.1|1375356_1375755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050294069.1|1375751_1375991_+	DUF4752 family protein	NA	T1S9K2	Salmonella_phage	58.7	4.5e-18
WP_050294071.1|1375994_1376444_+	DUF1367 family protein	NA	A0A0P0ZFW0	Escherichia_phage	70.5	5.3e-60
WP_050294074.1|1376663_1377047_+	HNH endonuclease	NA	A0A2R2Z2X9	Escherichia_phage	75.2	8.5e-51
WP_050294075.1|1377186_1377516_+	DUF2591 domain-containing protein	NA	R9VYJ6	Serratia_phage	52.8	3.3e-19
WP_050294079.1|1377517_1378168_+	serine/threonine protein phosphatase	NA	Q716B9	Shigella_phage	61.1	8.5e-75
WP_155295585.1|1378343_1378508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050156987.1|1378622_1379258_+	hypothetical protein	NA	H6WRY9	Salmonella_phage	44.9	1.9e-42
WP_050156985.1|1379254_1379446_+	protein ninH	NA	Q777W6	Enterobacteria_phage	59.3	1.1e-09
WP_050156984.1|1379442_1379931_+	antiterminator	NA	M1FPN0	Enterobacteria_phage	67.9	2.4e-58
WP_050344746.1|1380234_1380768_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042570178.1|1380965_1381280_+|holin	holin	holin	NA	NA	NA	NA
WP_050294008.1|1381282_1381726_+	lysozyme	NA	R9TMH8	Aeromonas_phage	57.3	2.1e-40
WP_050294009.1|1381722_1382181_+|lysis	lysis protein	lysis	A5LH84	Enterobacteria_phage	46.4	2.1e-24
WP_050127912.1|1382706_1383234_+	KilA-N domain-containing protein	NA	A0A1V0E5P7	Salmonella_phage	55.4	3.0e-46
WP_050127911.1|1383230_1383614_+	hypothetical protein	NA	A0A192Y658	Salmonella_phage	41.6	5.6e-18
WP_050127910.1|1383689_1383929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050127908.1|1384052_1384688_+	hypothetical protein	NA	H9C189	Pectobacterium_phage	71.0	4.7e-86
WP_050127906.1|1384721_1385171_+	DUF2280 domain-containing protein	NA	I6S1P9	Salmonella_phage	72.9	5.1e-47
WP_050127904.1|1385180_1386668_+	hypothetical protein	NA	A0A1W6JNY3	Morganella_phage	76.5	7.0e-226
WP_050156791.1|1386742_1388080_+	DUF4055 domain-containing protein	NA	A0A0S2SYJ5	Pseudomonas_phage	43.7	7.5e-94
WP_050156790.1|1388198_1388951_+	hypothetical protein	NA	G8C7P6	Escherichia_phage	47.6	3.2e-57
WP_050127902.1|1388966_1390091_+|coat	P22 coat - protein 5 family protein	coat	W6EBZ8	Rhizobium_phage	56.7	9.1e-101
WP_154236072.1|1390141_1390312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050156786.1|1390311_1390704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050127901.1|1390706_1391345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050127899.1|1391346_1392150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050127897.1|1392166_1392361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050294010.1|1392421_1393975_+|tail	phage tail protein	tail	B3GAJ6	uncultured_virus	44.8	2.1e-95
WP_050127893.1|1394024_1394456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050127891.1|1394476_1394854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050127914.1|1395029_1395515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050127890.1|1395573_1395909_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_071890470.1|1396016_1396181_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_080357944.1|1397027_1397831_+	hypothetical protein	NA	A0A077SL47	Escherichia_phage	44.3	2.4e-39
WP_050127887.1|1397950_1398298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050127885.1|1398368_1400507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154236071.1|1400590_1400950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050294015.1|1401331_1402321_+	hypothetical protein	NA	S5MNM1	Brevibacillus_phage	35.0	1.3e-13
WP_050127882.1|1402323_1403439_+	type IV secretion protein Rhs	NA	NA	NA	NA	NA
WP_050127881.1|1403435_1404062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050127880.1|1404069_1404435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080357946.1|1404496_1405567_+|plate	baseplate protein	plate	B3GAJ9	uncultured_virus	40.4	2.6e-52
WP_050127878.1|1405567_1406230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129019401.1|1406302_1408477_+	hypothetical protein	NA	A9YX14	Burkholderia_phage	40.0	5.2e-52
WP_049525621.1|1408473_1408689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080357952.1|1409043_1409325_+	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	57.3	6.1e-22
WP_020283552.1|1410353_1410635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084738242.1|1411248_1412352_+	Fic family protein	NA	NA	NA	NA	NA
WP_080478647.1|1412793_1413360_-	potassium-transporting ATPase subunit A	NA	Q7M2A8	Enterobacteria_phage	44.8	9.4e-38
WP_080478635.1|1413589_1414987_-	hypothetical protein	NA	Q8LTT9	Enterobacteria_phage	47.4	4.8e-59
WP_049525217.1|1415286_1415610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049525216.1|1415768_1415969_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_005158312.1|1416876_1417242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020283429.1|1417466_1418114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005158316.1|1418098_1418437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049525882.1|1418930_1419161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049525883.1|1419563_1420046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038892054.1|1420152_1420533_+	DNA polymerase V	NA	K7P6F7	Enterobacteria_phage	68.0	6.9e-45
WP_049528964.1|1421683_1422373_-	heavy metal response regulator transcription factor	NA	W8CYM9	Bacillus_phage	34.7	8.8e-30
WP_072079380.1|1422701_1423658_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_023160836.1|1423817_1424837_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP016940	Yersinia enterocolitica strain YE5 chromosome, complete genome	4593248	1882997	1943313	4593248	holin,transposase,tail,lysis	Salmonella_phage(21.05%)	44	NA	NA
WP_069009159.1|1882997_1884017_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_049526346.1|1884628_1885906_-	glucose-1-phosphate adenylyltransferase	NA	NA	NA	NA	NA
WP_011816631.1|1887815_1888028_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	46.2	2.7e-06
WP_049526349.1|1889215_1889674_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_005164518.1|1889926_1890460_-	membrane protein	NA	NA	NA	NA	NA
WP_049526350.1|1890697_1891708_-	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_049526352.1|1892093_1893296_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	71.5	2.2e-76
WP_049526354.1|1893395_1896548_-	beta-galactosidase	NA	B9U1H7	Vaccinia_virus	62.9	0.0e+00
WP_005164513.1|1896726_1897761_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	50.3	1.4e-84
WP_002210893.1|1898242_1898455_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	80.0	2.0e-25
WP_071530598.1|1898663_1898900_+	protein DsrB	NA	NA	NA	NA	NA
WP_013649692.1|1899033_1900773_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.4	1.1e-09
WP_005177868.1|1901637_1901877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072087318.1|1902428_1903139_+	MgtC family protein	NA	G3MA03	Bacillus_virus	41.8	3.7e-15
WP_069009161.1|1903355_1906058_+	magnesium-translocating P-type ATPase	NA	M1HM40	Paramecium_bursaria_Chlorella_virus	25.2	9.4e-43
WP_020283309.1|1906123_1907158_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005164500.1|1907321_1907741_-	universal stress protein UspC	NA	NA	NA	NA	NA
WP_011816619.1|1908756_1909116_+	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_005164496.1|1909119_1909701_+	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_049526365.1|1909838_1910726_+	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_072079285.1|1911976_1914031_+	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_005164488.1|1914211_1914709_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_005164486.1|1914990_1916664_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	36.1	1.4e-12
WP_049526374.1|1916848_1918486_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	28.9	2.8e-18
WP_005164483.1|1918514_1919375_+	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_005164481.1|1919374_1920424_+	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.0	1.0e-05
WP_005164479.1|1920615_1921005_+	chemotaxis protein CheY	NA	Q56AR1	Bacillus_thuringiensis_phage	31.3	5.9e-07
WP_005164477.1|1921014_1921659_+	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_049526377.1|1921743_1923387_-	S8 family serine peptidase	NA	NA	NA	NA	NA
WP_005164474.1|1923801_1924953_+	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_049526378.1|1924952_1927031_+	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_049526379.1|1927030_1927453_+	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_014609050.1|1930470_1930911_-	flagella synthesis chaperone protein FlgN	NA	NA	NA	NA	NA
WP_005160467.1|1930962_1931262_-	anti-sigma-28 factor FlgM	NA	NA	NA	NA	NA
WP_005177923.1|1931410_1932091_-	flagellar basal body P-ring formation protein FlgA	NA	NA	NA	NA	NA
WP_005160174.1|1933547_1934096_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_013649733.1|1934760_1934976_-	phage transcriptional activator, Ogr/Delta	NA	S4TNZ3	Salmonella_phage	60.6	1.1e-18
WP_049526451.1|1938776_1939223_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	47.3	9.4e-33
WP_049526452.1|1939219_1939687_-|tail	phage tail protein	tail	F1BUP9	Erwinia_phage	56.6	1.3e-40
WP_129019410.1|1939788_1940208_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	40.6	8.8e-17
WP_013649751.1|1940217_1940613_-	M15 family metallopeptidase	NA	A9DET4	Yersinia_phage	71.0	5.9e-47
WP_013649752.1|1940599_1940779_-|holin	holin	holin	NA	NA	NA	NA
WP_071598556.1|1940772_1941075_-	hypothetical protein	NA	A0A077KEQ8	Ralstonia_phage	68.7	2.6e-26
WP_049526453.1|1941876_1943313_-|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	39.1	2.9e-83
>prophage 6
NZ_CP016940	Yersinia enterocolitica strain YE5 chromosome, complete genome	4593248	2081035	2140500	4593248	protease,coat,tRNA,transposase	Bacillus_phage(28.57%)	54	NA	NA
WP_005164931.1|2081035_2081593_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_049526568.1|2081604_2082162_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_084738269.1|2082167_2082722_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_049526570.1|2083031_2084453_-	MFS transporter	NA	NA	NA	NA	NA
WP_049526572.1|2084580_2085501_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_049526574.1|2085513_2088144_-	PqiB family protein	NA	NA	NA	NA	NA
WP_049526576.1|2088112_2089360_-	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_013649820.1|2089600_2090098_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_005170218.1|2090193_2090922_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_005164944.1|2090941_2093017_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	35.4	4.3e-88
WP_005164945.1|2093313_2094195_+|protease	protease HtpX	protease	NA	NA	NA	NA
WP_049526580.1|2094229_2094355_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005164950.1|2096072_2097239_+	oligogalacturonate lyase	NA	NA	NA	NA	NA
WP_005164952.1|2097425_2098217_+	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_005164953.1|2098492_2099344_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1W6DX33	Sphingobium_phage	29.5	4.3e-10
WP_005161706.1|2101034_2101583_-	metal-dependent hydrolase	NA	A0A127AVX7	Bacillus_phage	33.3	2.9e-07
WP_013649825.1|2101940_2102639_-	porin	NA	NA	NA	NA	NA
WP_049526584.1|2102948_2104241_-	carbohydrate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005161697.1|2104256_2105384_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.5	3.0e-11
WP_005161693.1|2105397_2106315_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_005161668.1|2106307_2107198_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_069009197.1|2107238_2108906_-	pectate lyase	NA	NA	NA	NA	NA
WP_069009678.1|2109233_2109995_-	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.9	4.5e-19
WP_013649826.1|2110106_2110943_-	5-dehydro-4-deoxy-D-glucuronate isomerase	NA	NA	NA	NA	NA
WP_005170147.1|2111180_2111513_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_049526590.1|2111617_2112820_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	71.0	5.8e-77
WP_005161643.1|2112929_2113595_-	hexitol phosphatase HxpB	NA	NA	NA	NA	NA
WP_005170142.1|2113844_2114399_+	yfeABCD regulator yfeE	NA	NA	NA	NA	NA
WP_049526592.1|2114607_2115498_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_049526593.1|2115494_2116976_-	succinate CoA transferase	NA	NA	NA	NA	NA
WP_005161631.1|2117001_2117787_-	methylmalonyl-CoA decarboxylase	NA	NA	NA	NA	NA
WP_013649829.1|2117800_2118796_-	methylmalonyl Co-A mutase-associated GTPase MeaB	NA	NA	NA	NA	NA
WP_049526595.1|2121210_2122080_-	fructosamine kinase family protein	NA	NA	NA	NA	NA
WP_049526597.1|2122711_2123587_-	iron/manganese ABC transporter permease subunit YfeD	NA	NA	NA	NA	NA
WP_049526599.1|2123583_2124468_-	iron/manganese ABC transporter permease subunit YfeC	NA	NA	NA	NA	NA
WP_049526600.1|2124467_2125358_-	iron/manganese ABC transporter ATP-binding protein YfeB	NA	W8CYL7	Bacillus_phage	29.7	7.7e-10
WP_049526602.1|2125354_2126323_-	iron/manganese ABC transporter substrate-binding protein YfeA	NA	NA	NA	NA	NA
WP_005161592.1|2126534_2127197_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_005161586.1|2127559_2128243_-	MarC family NAAT transporter	NA	NA	NA	NA	NA
WP_011816223.1|2128650_2128935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005161581.1|2129407_2129644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049526607.1|2129709_2129889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005161576.1|2130413_2131127_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_005161573.1|2131246_2131459_-	KTSC domain-containing protein	NA	A0A0K1LMB5	Caulobacter_phage	42.0	9.9e-09
WP_049526612.1|2131782_2133711_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.2	8.8e-128
WP_011816226.1|2133714_2134266_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.7	3.4e-16
WP_004713020.1|2134362_2134560_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_004393357.1|2134597_2134954_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_152414234.1|2135022_2135070_+	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_005161570.1|2135418_2136402_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	5.8e-35
WP_049526614.1|2136416_2138804_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	27.8	1.1e-07
WP_002211830.1|2138808_2139105_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	4.2e-13
WP_071828211.1|2139317_2139488_-	NINE protein	NA	M4ZS56	Bacillus_phage	62.5	1.0e-08
WP_049525161.1|2139468_2140500_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP016940	Yersinia enterocolitica strain YE5 chromosome, complete genome	4593248	2347755	2378458	4593248	lysis,terminase	Escherichia_phage(34.48%)	42	NA	NA
WP_049526752.1|2347755_2348481_-	hypothetical protein	NA	A0A0U2JGI7	Escherichia_phage	35.9	5.1e-28
WP_069009220.1|2348480_2350301_-	hypothetical protein	NA	A0A2R3UAN6	Myoviridae_environmental_samples	42.7	1.7e-19
WP_049526756.1|2350424_2351000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069009223.1|2351003_2351441_-	hypothetical protein	NA	A0A0U2S616	Escherichia_phage	39.6	2.0e-24
WP_049526761.1|2351444_2352839_-	hypothetical protein	NA	A0A0U2KD19	Escherichia_phage	36.4	2.6e-65
WP_049526763.1|2352843_2353785_-	hypothetical protein	NA	A0A0U2SH76	Escherichia_phage	37.3	1.3e-52
WP_049526765.1|2353768_2354203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049526766.1|2354199_2354628_-	hypothetical protein	NA	A0A0U2S646	Escherichia_phage	39.1	7.1e-22
WP_049526768.1|2354628_2355108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057619021.1|2355176_2356208_-	hypothetical protein	NA	A0A0U2QQI2	Escherichia_phage	46.6	5.1e-74
WP_057619022.1|2356224_2357091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069009681.1|2357106_2358708_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_049526771.1|2358742_2359564_-	hypothetical protein	NA	A0A0U2I1R8	Escherichia_phage	41.4	4.0e-53
WP_050293991.1|2359560_2360976_-	DUF1073 domain-containing protein	NA	A0A0U2S5X9	Escherichia_phage	37.3	1.4e-85
WP_049526775.1|2360988_2362311_-|terminase	terminase	terminase	A0A0U2JTW9	Escherichia_phage	59.7	4.9e-154
WP_049529053.1|2362312_2363035_-	hypothetical protein	NA	A0A1I9KFG9	Aeromonas_phage	29.3	2.6e-16
WP_049525819.1|2363180_2363642_-|lysis	lysis protein	lysis	A5LH84	Enterobacteria_phage	43.0	1.7e-21
WP_049526777.1|2363626_2364139_-	lysozyme	NA	I6PBN2	Cronobacter_phage	59.9	2.4e-48
WP_049528949.1|2364138_2364420_-	hypothetical protein	NA	H6WRZ3	Salmonella_phage	54.3	1.1e-18
WP_049525816.1|2364637_2365171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049525578.1|2365579_2366185_-	hypothetical protein	NA	Q8HA89	Salmonella_phage	40.7	1.4e-39
WP_049525577.1|2366181_2366790_-	protein ninG	NA	K7PHP1	Enterobacterial_phage	60.9	1.0e-53
WP_049525575.1|2367411_2367882_-	recombination protein NinB	NA	I6R9D0	Salmonella_phage	53.9	2.6e-41
WP_049525574.1|2368025_2368223_-	hypothetical protein	NA	A0A2H4FUS3	Salmonella_phage	42.2	5.1e-07
WP_049526787.1|2368222_2368717_-	DUF551 domain-containing protein	NA	E7C9P2	Salmonella_phage	32.5	4.5e-12
WP_069009034.1|2368713_2369016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129019429.1|2369012_2369210_-	hypothetical protein	NA	K7PHN9	Enterobacterial_phage	61.9	9.2e-17
WP_049526791.1|2369350_2370205_-	AAA family ATPase	NA	K7PLU3	Enterobacteria_phage	57.3	2.2e-86
WP_069009228.1|2370201_2371026_-	replication protein	NA	A0A075B8J2	Enterobacteria_phage	52.7	7.5e-36
WP_050156967.1|2371022_2371625_-	hypothetical protein	NA	M1F3E2	Salmonella_phage	42.1	5.5e-36
WP_049526795.1|2371649_2371943_-	hypothetical protein	NA	A2SY75	Escherichia_phage	62.9	1.4e-24
WP_049526797.1|2372057_2372276_-	helix-turn-helix transcriptional regulator	NA	I6S1U2	Salmonella_phage	62.7	3.7e-19
WP_049526799.1|2372382_2373048_+	LexA family transcriptional regulator	NA	A0A286S2B2	Klebsiella_phage	61.5	1.6e-73
WP_049526801.1|2373135_2373699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049526803.1|2373695_2374448_+	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
WP_049529057.1|2374503_2374713_-	DUF2767 family protein	NA	I6R0R9	Salmonella_phage	47.5	1.3e-05
WP_049525565.1|2375211_2375496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154236085.1|2375498_2375657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071828178.1|2375861_2376041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049525796.1|2376199_2376541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049525794.1|2377056_2377350_+	hypothetical protein	NA	A0A0B4SK56	Proteus_phage	31.3	7.6e-07
WP_050293951.1|2377438_2378458_+	hypothetical protein	NA	K7P6J9	Enterobacteria_phage	65.3	1.8e-31
>prophage 8
NZ_CP016940	Yersinia enterocolitica strain YE5 chromosome, complete genome	4593248	3605934	3671064	4593248	protease,transposase,tRNA,integrase	Bacillus_phage(13.33%)	56	3615591:3615644	3629632:3629685
WP_042663659.1|3605934_3606954_+|transposase	IS110-like element ISYen1 family transposase	transposase	NA	NA	NA	NA
WP_049527926.1|3607372_3608617_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	33.9	3.1e-17
WP_005166615.1|3608699_3609095_-	SgcJ/EcaC family oxidoreductase	NA	NA	NA	NA	NA
WP_049527931.1|3610431_3610632_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_049527934.1|3610774_3611977_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	72.0	1.5e-77
WP_049527936.1|3612053_3612482_-	type II toxin-antitoxin system MqsA family antitoxin	NA	NA	NA	NA	NA
WP_005166025.1|3612481_3612778_-	type II toxin-antitoxin system MqsR family toxin	NA	NA	NA	NA	NA
WP_005166026.1|3612934_3613297_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005166028.1|3613362_3613623_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A1S5NR91	Burkholderia_phage	36.0	2.5e-06
3615591:3615644	attL	TGGAGCGGGTGAAGGGAATCGAACCCTCGTATAGAGCTTGGGAAGCTCTCGTTC	NA	NA	NA	NA
WP_049527941.1|3615706_3616927_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_049527943.1|3617002_3617377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049527946.1|3617373_3617583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045844230.1|3619679_3619868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084738254.1|3620007_3621060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049527955.1|3621109_3621382_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049527956.1|3622615_3622858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049527959.1|3623500_3623824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049527961.1|3624185_3624386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049527964.1|3624412_3625936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154295071.1|3625956_3626109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069009462.1|3627229_3627490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049527969.1|3627493_3627724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049527972.1|3628340_3628889_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A141E0P1	Streptococcus_phage	34.4	1.2e-21
WP_013649344.1|3629875_3631393_-|tRNA	lysine--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	37.6	2.3e-86
3629632:3629685	attR	TGGAGCGGGTGAAGGGAATCGAACCCTCGTATAGAGCTTGGGAAGCTCTCGTTC	NA	NA	NA	NA
WP_020282590.1|3631402_3632501_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	5.4e-05
WP_005166036.1|3632946_3634680_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.7	1.6e-64
WP_013649342.1|3634686_3635403_-	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_005166040.1|3635451_3636351_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	30.2	2.1e-31
WP_005166042.1|3636457_3636976_+	flavodoxin FldB	NA	NA	NA	NA	NA
WP_049527976.1|3637034_3638456_-	cell envelope integrity protein CreD	NA	NA	NA	NA	NA
WP_049527980.1|3638547_3639975_-	two-component system sensor histidine kinase CreC	NA	NA	NA	NA	NA
WP_005166045.1|3639985_3640684_-	two-component system response regulator CreB	NA	NA	NA	NA	NA
WP_005166047.1|3640683_3641109_-	membrane protein	NA	NA	NA	NA	NA
WP_004390965.1|3641089_3641356_-	FAD assembly factor SdhE	NA	NA	NA	NA	NA
WP_049527983.1|3641622_3642615_+|tRNA	tRNA-modifying protein YgfZ	tRNA	NA	NA	NA	NA
WP_084738255.1|3642810_3643830_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_050155820.1|3644240_3644924_-	hemolysin III family protein	NA	NA	NA	NA	NA
WP_069009466.1|3645154_3645757_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_013649334.1|3645769_3646519_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.5	2.6e-27
WP_049527993.1|3646534_3646972_-	lipocalin-like domain-containing protein	NA	NA	NA	NA	NA
WP_049527996.1|3647305_3650194_-	aminomethyl-transferring glycine dehydrogenase	NA	M4QFZ1	Prochlorococcus_phage	52.7	4.2e-267
WP_005164125.1|3650293_3650680_-	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_013649331.1|3650746_3651844_-	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_023160249.1|3652236_3653451_-	FAD-dependent 2-octaprenylphenol hydroxylase	NA	NA	NA	NA	NA
WP_050126799.1|3653538_3654708_-	2-octaprenyl-6-methoxyphenyl hydroxylase	NA	NA	NA	NA	NA
WP_069009468.1|3654711_3656025_-	Xaa-Pro aminopeptidase	NA	NA	NA	NA	NA
WP_005164114.1|3656079_3656658_-	YecA family protein	NA	NA	NA	NA	NA
WP_004706812.1|3657113_3657443_+	cell division protein ZapA	NA	NA	NA	NA	NA
WP_005164106.1|3657946_3658543_+	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_005164105.1|3658688_3659984_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	58.0	2.2e-130
WP_013649329.1|3660063_3661701_-	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.7	1.6e-154
WP_013649328.1|3661912_3662749_-	nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_005164102.1|3663036_3665271_-	GTP diphosphokinase	NA	NA	NA	NA	NA
WP_049528014.1|3665280_3666612_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	27.4	5.1e-34
WP_049528017.1|3666668_3669533_+	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	29.2	2.7e-48
WP_013649325.1|3669627_3671064_-|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	31.0	5.0e-27
>prophage 1
NZ_CP016939	Yersinia enterocolitica strain YE5 plasmid unnamed1, complete sequence	73034	25683	33464	73034	transposase	uncultured_Caudovirales_phage(50.0%)	8	NA	NA
WP_050294038.1|25683_26382_-	arsenic resistance NADPH-dependent reductase ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	68.1	4.2e-88
WP_013749489.1|26467_26788_+	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	46.7	1.7e-20
WP_010891244.1|28134_28560_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	5.6e-51
WP_050294040.1|28577_29159_-	recombinase family protein	NA	A0A219YA40	Aeromonas_phage	35.5	3.3e-22
WP_071890451.1|29334_30171_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.5	4.2e-18
WP_010891241.1|30326_30779_+	PprA	NA	NA	NA	NA	NA
WP_013749484.1|31100_31976_-	DMT family transporter	NA	NA	NA	NA	NA
WP_050294042.1|32045_33464_-	trimeric autotransporter adhesin YadA	NA	Q9MCI8	Enterobacteria_phage	55.6	2.6e-12
>prophage 1
NZ_CP016941	Yersinia enterocolitica strain YE5 plasmid unnamed2, complete sequence	120760	0	14195	120760	transposase,integrase	Staphylococcus_phage(33.33%)	8	693:707	17167:17181
693:707	attL	TAACATGTTGTTTTT	NA	NA	NA	NA
WP_084743393.1|2028_2391_-	CaiF/GrlA family transcriptional regulator	NA	NA	NA	NA	NA
WP_071891475.1|3580_3949_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_069017904.1|5196_7827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129019440.1|8259_8953_-|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	36.4	1.4e-35
WP_069009821.1|9150_9654_+	Dabb family protein	NA	NA	NA	NA	NA
WP_129019439.1|10012_10709_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	43.6	1.0e-41
WP_069009811.1|11311_12040_-	DUF4145 domain-containing protein	NA	NA	NA	NA	NA
WP_057618936.1|13424_14195_+|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	52.0	8.9e-23
17167:17181	attR	AAAAACAACATGTTA	NA	NA	NA	NA
>prophage 2
NZ_CP016941	Yersinia enterocolitica strain YE5 plasmid unnamed2, complete sequence	120760	27447	27780	120760		Escherichia_phage(100.0%)	1	NA	NA
WP_012291259.1|27447_27780_-	addiction system toxin	NA	O64357	Escherichia_phage	40.8	4.0e-12
>prophage 3
NZ_CP016941	Yersinia enterocolitica strain YE5 plasmid unnamed2, complete sequence	120760	35421	35601	120760		Escherichia_phage(100.0%)	1	NA	NA
WP_050127872.1|35421_35601_+	hypothetical protein	NA	A0A2D2W2Z9	Escherichia_phage	54.9	2.7e-07
>prophage 4
NZ_CP016941	Yersinia enterocolitica strain YE5 plasmid unnamed2, complete sequence	120760	39346	93622	120760	transposase,integrase	Escherichia_phage(25.0%)	38	36197:36212	98279:98294
36197:36212	attL	TATAGGCCAATAAATC	NA	NA	NA	NA
WP_050127877.1|39346_40216_-	ParA family protein	NA	F0PIG8	Enterococcus_phage	26.5	7.2e-05
WP_071891480.1|40813_42019_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_129019442.1|42514_43948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050127659.1|44102_44378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050156614.1|44477_44831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012291420.1|44941_45262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050127661.1|45474_45792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050156626.1|45796_46663_+	DsbC family protein	NA	NA	NA	NA	NA
WP_050127662.1|46716_47085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050127663.1|47384_48035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012291411.1|48036_48825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069009838.1|48824_50072_+	conjugal transfer protein TraB	NA	NA	NA	NA	NA
WP_050127664.1|50095_50602_+	TraV family lipoprotein	NA	NA	NA	NA	NA
WP_080357814.1|50625_53175_+	TraC family protein	NA	NA	NA	NA	NA
WP_080357812.1|53176_55222_+	conjugal transfer protein TraN	NA	NA	NA	NA	NA
WP_050127667.1|55202_56978_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050127668.1|57131_58715_+	conjugal transfer protein TraU	NA	NA	NA	NA	NA
WP_050127685.1|58846_59434_+	conjugal transfer protein TrbC	NA	NA	NA	NA	NA
WP_069009780.1|59433_59898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005276898.1|59908_60328_+	PEGA domain-containing protein	NA	NA	NA	NA	NA
WP_102778917.1|60412_61201_+	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_069009775.1|61210_62587_+	pilus assembly protein	NA	NA	NA	NA	NA
WP_069017905.1|62583_66468_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_050156624.1|66954_67872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129019443.1|67972_68746_+|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	81.4	6.1e-48
WP_050127681.1|68929_69568_+	serine recombinase	NA	NA	NA	NA	NA
WP_057618893.1|70204_72151_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_129019444.1|72408_74094_+	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	A0A0R6PI85	Moraxella_phage	28.3	9.6e-38
WP_071891490.1|77019_77394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069009764.1|77592_78240_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.0	7.3e-10
WP_050128091.1|78520_79156_+	ParA family protein	NA	NA	NA	NA	NA
WP_050128092.1|79218_79512_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129019436.1|80965_81662_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	1.9e-40
WP_050128033.1|81676_81919_-|transposase	IS3 family transposase	transposase	Q716C1	Shigella_phage	64.7	3.3e-16
WP_069017906.1|82175_87026_+	hypothetical protein	NA	A0A1W5K0N1	Bacteriophage	33.8	2.1e-178
WP_069009758.1|87248_89972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050156982.1|91924_92473_+	CaiF/GrlA family transcriptional regulator	NA	NA	NA	NA	NA
WP_129019437.1|92924_93622_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	5.5e-40
98279:98294	attR	TATAGGCCAATAAATC	NA	NA	NA	NA
>prophage 5
NZ_CP016941	Yersinia enterocolitica strain YE5 plasmid unnamed2, complete sequence	120760	100572	105580	120760	transposase	Escherichia_phage(66.67%)	5	NA	NA
WP_069009830.1|100572_101367_-	hypothetical protein	NA	B6SD27	Bacteriophage	34.6	1.1e-23
WP_129019438.1|101632_102329_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	43.6	2.9e-41
WP_084738281.1|102803_103181_-	CaiF/GrlA family transcriptional regulator	NA	NA	NA	NA	NA
WP_071891488.1|103853_104744_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_129019439.1|104883_105580_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	43.6	1.0e-41
>prophage 6
NZ_CP016941	Yersinia enterocolitica strain YE5 plasmid unnamed2, complete sequence	120760	109057	114993	120760	transposase,integrase	Staphylococcus_phage(33.33%)	5	101480:101494	117965:117979
101480:101494	attL	TAACATGTTGTTTTT	NA	NA	NA	NA
WP_129019440.1|109057_109751_-|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	36.4	1.4e-35
WP_069009821.1|109948_110452_+	Dabb family protein	NA	NA	NA	NA	NA
WP_129019439.1|110810_111507_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	43.6	1.0e-41
WP_069009811.1|112109_112838_-	DUF4145 domain-containing protein	NA	NA	NA	NA	NA
WP_057618936.1|114222_114993_+|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	52.0	8.9e-23
117965:117979	attR	AAAAACAACATGTTA	NA	NA	NA	NA
