The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP016931	Yersinia enterocolitica strain YE165 chromosome, complete genome	4685321	254978	336097	4685321	protease,bacteriocin,transposase	Planktothrix_phage(66.67%)	54	NA	NA
WP_057618920.1|254978_255230_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_005162673.1|255512_255767_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_005162670.1|256079_256439_+	antitermination protein	NA	K7PGW2	Enterobacterial_phage	47.5	1.7e-21
WP_032904442.1|256541_257300_-	molecular chaperone	NA	NA	NA	NA	NA
WP_072087371.1|261390_262068_-	molecular chaperone	NA	NA	NA	NA	NA
WP_049525161.1|262263_263295_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_005165289.1|264237_265200_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_072087397.1|265233_265695_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_049528676.1|266955_267810_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_005165296.1|268038_268407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129019424.1|268470_268623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005166182.1|270069_271533_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_057618982.1|271765_273172_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_069017961.1|273291_275004_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_016266334.1|275135_275600_-	Large exoprotein involved in heme utilization or adhesion	NA	NA	NA	NA	NA
WP_005166173.1|278268_279801_-	signal transduction histidine-protein kinase/phosphatase UhpB	NA	NA	NA	NA	NA
WP_049528662.1|279797_280388_-	transcriptional regulator UhpA	NA	NA	NA	NA	NA
WP_050127428.1|280499_282191_-	kdo(2)-lipid A phosphoethanolamine 7''-transferase	NA	NA	NA	NA	NA
WP_048618714.1|282450_282876_-	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_023160836.1|283346_284366_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_005174918.1|285177_286785_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005157323.1|287067_288087_+	dipeptide ABC transporter permease DppB	NA	NA	NA	NA	NA
WP_049525223.1|288097_289000_+	dipeptide ABC transporter permease DppC	NA	NA	NA	NA	NA
WP_049525224.1|289015_289996_+	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.9	2.5e-14
WP_005157326.1|290010_291015_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.7	1.9e-20
WP_049525225.1|291357_293010_-	cellulose biosynthesis protein BcsG	NA	NA	NA	NA	NA
WP_005157335.1|293012_293201_-	cellulose biosynthesis protein BcsF	NA	NA	NA	NA	NA
WP_069017964.1|293197_294757_-	cellulose biosynthesis protein BcsE	NA	NA	NA	NA	NA
WP_005157340.1|294954_295146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013650602.1|295149_295887_+	cellulose synthase operon protein YhjQ	NA	NA	NA	NA	NA
WP_049525228.1|295883_298511_+	UDP-forming cellulose synthase catalytic subunit	NA	NA	NA	NA	NA
WP_072087275.1|298518_300825_+	cellulose biosynthesis cyclic di-GMP-binding regulatory protein BcsB	NA	NA	NA	NA	NA
WP_057618858.1|300830_301958_+	cellulase	NA	NA	NA	NA	NA
WP_069017966.1|301939_305446_+	cellulose biosynthesis protein BcsC	NA	NA	NA	NA	NA
WP_020283535.1|305676_307206_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_005157352.1|307930_308635_+	porin	NA	NA	NA	NA	NA
WP_005157353.1|308711_310430_+	pectate lyase	NA	NA	NA	NA	NA
WP_005157355.1|310554_311034_+	discoidin domain-containing protein	NA	NA	NA	NA	NA
WP_005157357.1|311411_312704_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_005157359.1|313118_314609_+	insulinase family protein	NA	NA	NA	NA	NA
WP_005157362.1|314768_315713_-	sugar kinase	NA	NA	NA	NA	NA
WP_004388926.1|315857_316058_-	4-oxalocrotonate tautomerase family protein	NA	NA	NA	NA	NA
WP_072079324.1|316311_317088_+	cyclic-guanylate-specific phosphodiesterase	NA	NA	NA	NA	NA
WP_049525233.1|319371_320136_-	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_049525234.1|320159_321149_-	inner membrane protein YhjD	NA	NA	NA	NA	NA
WP_057618857.1|321565_324808_+	autotransporter adhesin YapE	NA	NA	NA	NA	NA
WP_005157379.1|325166_326519_-	glutathione-disulfide reductase	NA	NA	NA	NA	NA
WP_049525236.1|326762_327605_-	23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ	NA	NA	NA	NA	NA
WP_023160901.1|327941_329984_+	oligopeptidase A	NA	NA	NA	NA	NA
WP_020283527.1|329987_330746_+	16S rRNA (guanine(1516)-N(2))-methyltransferase RsmJ	NA	NA	NA	NA	NA
WP_013650589.1|330812_332054_-|protease	metalloprotease	protease	NA	NA	NA	NA
WP_049525237.1|332276_333620_-	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_005157389.1|333883_334330_-	universal stress protein UspA	NA	NA	NA	NA	NA
WP_023160836.1|335077_336097_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP016931	Yersinia enterocolitica strain YE165 chromosome, complete genome	4685321	615304	725679	4685321	protease,terminase,tail,tRNA,head,holin,capsid,integrase,transposase	Cronobacter_phage(50.0%)	92	604160:604177	696535:696552
604160:604177	attL	CGGCCGGTACTGCGGCAG	NA	NA	NA	NA
WP_069017988.1|615304_616324_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_005174358.1|616521_617442_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	53.5	8.0e-79
WP_032904499.1|617800_619213_-	anion permease	NA	NA	NA	NA	NA
WP_005163087.1|619722_619935_-	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	80.0	4.4e-25
WP_005163090.1|620206_620419_-	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	80.0	1.7e-24
WP_005163093.1|620801_621272_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_002210061.1|623145_623442_-	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
WP_005163099.1|623462_624428_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_005163101.1|624870_625752_-	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_049525330.1|625843_627298_-	sodium/pantothenate symporter	NA	NA	NA	NA	NA
WP_005163104.1|627287_627530_-	YhdT family protein	NA	NA	NA	NA	NA
WP_005163110.1|627668_629018_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_005163113.1|629029_629494_-	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_005163116.1|629526_629979_-	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_049525332.1|630187_630787_-	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_005163122.1|630786_631821_-	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_005163130.1|631974_632952_-	oxidoreductase	NA	NA	NA	NA	NA
WP_050156006.1|633236_635156_+	RNase E specificity factor CsrD	NA	NA	NA	NA	NA
WP_002228205.1|635490_636534_+	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.0e-06
WP_005163136.1|636633_637620_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_005163138.1|637616_638105_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_005180107.1|638118_638712_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_049525335.1|638701_640171_+	ribonuclease G	NA	NA	NA	NA	NA
WP_069017990.1|640372_644248_+	AsmA2 domain-containing protein	NA	NA	NA	NA	NA
WP_057618713.1|644244_645105_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_049525337.1|645116_646562_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_005163164.1|646615_647902_-	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_013650506.1|647898_648177_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155295582.1|651577_651814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005163183.1|651746_652106_-	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_020282680.1|652102_652504_-	M15 family metallopeptidase	NA	A9DET4	Yersinia_phage	58.4	1.4e-40
WP_005163187.1|652512_652824_-|holin	holin	holin	R9W0A1	Serratia_phage	51.2	3.1e-19
WP_023160836.1|656159_657179_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_050127097.1|658835_662366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057618715.1|662407_662917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057618716.1|663072_664842_-	toxin	NA	NA	NA	NA	NA
WP_057618717.1|666036_666948_-	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
WP_005163197.1|667273_667477_+	AaeX family protein	NA	NA	NA	NA	NA
WP_050127093.1|667484_668420_+	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
WP_020282685.1|668421_670377_+	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
WP_049525342.1|670498_671992_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_020282687.1|672104_672563_+	ribonuclease	NA	NA	NA	NA	NA
WP_004392366.1|672567_672834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005163212.1|672865_673411_-	ribosome-associated protein	NA	NA	NA	NA	NA
WP_049525344.1|673548_674541_-|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	60.4	2.8e-109
WP_049525345.1|674607_674907_-	helix-turn-helix transcriptional regulator	NA	Q1JS29	Enterobacteria_phage	74.7	4.6e-36
WP_129019376.1|675016_675349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049525347.1|675475_675697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049525348.1|675711_676068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049525349.1|676140_676407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049525350.1|676406_677303_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	E5G6L8	Salmonella_phage	51.0	2.8e-76
WP_049525351.1|677299_678337_+	phosphoadenosine phosphosulfate reductase family protein	NA	B7SYG0	Stenotrophomonas_phage	42.6	7.7e-62
WP_069008964.1|678333_680739_+	replication endonuclease	NA	F1BUS0	Erwinia_phage	49.9	1.2e-203
WP_049525352.1|680784_681045_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	64.3	1.3e-26
WP_154295064.1|681989_682199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049525353.1|682152_683940_-|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	66.4	8.2e-237
WP_069017993.1|684109_684967_+|capsid	phage capsid protein	capsid	F1BUM4	Cronobacter_phage	48.1	3.5e-44
WP_057618719.1|685032_686064_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	76.4	3.6e-144
WP_049525356.1|686073_686772_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	53.9	4.5e-66
WP_072087891.1|686867_687320_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	56.0	1.4e-39
WP_049525357.1|687316_687805_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	44.8	4.2e-34
WP_049525359.1|689296_689752_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	60.9	9.8e-46
WP_049525360.1|689761_690052_+|holin	holin	holin	C7BGD7	Burkholderia_phage	50.6	6.7e-16
WP_049525361.1|690048_690390_+	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	82.2	1.4e-44
WP_049525362.1|690389_690731_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	41.8	4.4e-14
WP_004389570.1|690880_691147_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	53.7	5.1e-18
WP_057618720.1|691334_693311_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	48.5	1.9e-170
WP_049525364.1|693310_693643_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	67.3	1.7e-34
WP_049525365.1|693635_694820_+	phage protein	NA	F1BUK6	Cronobacter_phage	67.0	1.3e-153
WP_057618721.1|694812_695421_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	63.1	4.6e-67
WP_049525367.1|697275_697749_+	hypothetical protein	NA	NA	NA	NA	NA
696535:696552	attR	CGGCCGGTACTGCGGCAG	NA	NA	NA	NA
WP_049525368.1|697738_698470_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	47.1	3.9e-44
WP_049525369.1|700851_701058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057618723.1|701192_702029_-	abortive infection family protein	NA	NA	NA	NA	NA
WP_057618724.1|702564_703905_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_042663659.1|704454_705474_-|transposase	IS110-like element ISYen1 family transposase	transposase	NA	NA	NA	NA
WP_005162547.1|706005_706392_+	cytochrome b562	NA	NA	NA	NA	NA
WP_005162545.1|706439_706850_-	nucleoside diphosphate kinase regulator	NA	NA	NA	NA	NA
WP_005174305.1|707381_707726_+	glycine dehydrogenase	NA	NA	NA	NA	NA
WP_004392359.1|707749_708115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005162543.1|708114_708411_+	DUF4312 family protein	NA	NA	NA	NA	NA
WP_005162542.1|708423_709200_+	DUF4311 domain-containing protein	NA	NA	NA	NA	NA
WP_020282728.1|709218_709872_+	DUF4310 family protein	NA	NA	NA	NA	NA
WP_049525373.1|709955_711125_+	amidohydrolase/deacetylase family metallohydrolase	NA	NA	NA	NA	NA
WP_013650491.1|711108_712221_+	DgaE family pyridoxal phosphate-dependent ammonia lyase	NA	NA	NA	NA	NA
WP_049525374.1|712224_712965_+	KDGP aldolase family protein	NA	NA	NA	NA	NA
WP_072079298.1|714408_716337_+	BglG family transcription antiterminator	NA	NA	NA	NA	NA
WP_049525376.1|716408_716714_-	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	66.3	1.5e-29
WP_005162526.1|716713_716992_-	plasmid maintenance system killer protein	NA	A0A2L1IV28	Escherichia_phage	77.2	6.0e-38
WP_049525377.1|720295_721243_+	HTH-type transcriptional regulator TreR	NA	NA	NA	NA	NA
WP_049525378.1|722941_724603_+	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_049525379.1|724944_725679_-|protease	proteasome-type protease	protease	NA	NA	NA	NA
>prophage 3
NZ_CP016931	Yersinia enterocolitica strain YE165 chromosome, complete genome	4685321	1093178	1177227	4685321	transposase,tRNA	Escherichia_phage(23.53%)	60	NA	NA
WP_023160836.1|1093178_1094198_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_049525523.1|1094597_1095761_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	A0A142C026	Faustovirus	28.4	3.3e-21
WP_049525524.1|1096026_1097448_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_005165137.1|1097794_1098136_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_005165144.1|1100693_1101041_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_049525526.1|1101081_1102332_-	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_011815634.1|1102419_1103250_-	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_020282645.1|1103261_1104089_-	PTS mannose/fructose/sorbose transporter subunit IIC	NA	NA	NA	NA	NA
WP_049525527.1|1104684_1105107_-	PTS sorbose transporter subunit IIA	NA	NA	NA	NA	NA
WP_057618928.1|1105250_1106210_-	sugar-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_049525529.1|1106577_1108311_-	amidohydrolase	NA	M1HUK8	Acanthocystis_turfacea_Chlorella_virus	30.1	9.6e-17
WP_013649258.1|1108366_1109005_-	ANTAR domain-containing protein	NA	NA	NA	NA	NA
WP_005165160.1|1108994_1110161_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_069018027.1|1110234_1111224_-	acetamidase	NA	NA	NA	NA	NA
WP_032904567.1|1111255_1111975_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.0	3.7e-15
WP_049525530.1|1111971_1112706_-	ABC transporter ATP-binding protein	NA	A0A2H4UUX5	Bodo_saltans_virus	26.7	2.2e-07
WP_020282650.1|1112702_1113749_-	permease component of ABC transporter	NA	NA	NA	NA	NA
WP_005165172.1|1113758_1114628_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_057618925.1|1114724_1115891_-	urea ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005165177.1|1116438_1118082_-	fumarate hydratase	NA	NA	NA	NA	NA
WP_057618924.1|1118767_1121212_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.4	5.8e-217
WP_049525534.1|1121220_1121838_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	58.0	1.5e-73
WP_049525535.1|1121839_1122691_+	dimethylsulfoxide reductase	NA	A0A077SK59	Escherichia_phage	33.3	9.8e-23
WP_005165185.1|1122687_1123293_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	40.5	2.9e-29
WP_023160836.1|1123713_1124733_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_049525536.1|1124860_1126207_-	MFS transporter	NA	NA	NA	NA	NA
WP_005166463.1|1126443_1126932_+	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	47.1	2.0e-28
WP_049525537.1|1127043_1128108_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	61.0	4.6e-110
WP_005166466.1|1128417_1128921_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_049525538.1|1129062_1131690_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	36.7	1.6e-79
WP_002209449.1|1131943_1132129_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	3.8e-12
WP_069018028.1|1133052_1133619_+	fructose-1-phosphate/6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
WP_049525539.1|1133615_1134044_+	DedA family protein	NA	NA	NA	NA	NA
WP_049528904.1|1134126_1135686_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_004877244.1|1135851_1136367_+	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_049525541.1|1137996_1138788_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_005166004.1|1138953_1140315_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_005166006.1|1140522_1140771_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_005166009.1|1140792_1141341_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_004393426.1|1141379_1142120_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_004393427.1|1142200_1142557_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_005166016.1|1145455_1146172_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_005166017.1|1146406_1147486_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B6VT43	Edwardsiella_phage	51.1	6.9e-90
WP_013649240.1|1147488_1148610_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_049525542.1|1148889_1150047_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_069018029.1|1150486_1151491_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_049525544.1|1151746_1154320_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.2	6.2e-129
WP_049525545.1|1154450_1155182_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_005166515.1|1155181_1156159_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_005166516.1|1156294_1157026_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_069018030.1|1157171_1157648_+|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	44.5	5.5e-31
WP_005166518.1|1159144_1159507_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_069009025.1|1159813_1161016_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	71.5	9.8e-77
WP_049525547.1|1168733_1169075_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_005180039.1|1169137_1170496_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_049525548.1|1170670_1173313_-	bifunctional acetate--CoA ligase family protein/GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_013649392.1|1173365_1174115_-	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_014609138.1|1174269_1174710_-	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	36.0	4.0e-12
WP_005166475.1|1174930_1176037_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_023160836.1|1176207_1177227_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP016931	Yersinia enterocolitica strain YE165 chromosome, complete genome	4685321	1195523	1277659	4685321	plate,terminase,tail,head,holin,capsid,integrase,portal,transposase	Salmonella_phage(17.65%)	93	1188011:1188025	1205939:1205953
1188011:1188025	attL	TTCTGATGTTTCTTT	NA	NA	NA	NA
WP_049525556.1|1195523_1196795_-|integrase	site-specific integrase	integrase	Q8W658	Enterobacteria_phage	52.7	1.4e-126
WP_049525557.1|1196827_1197079_-	DNA-binding protein	NA	A0A286S2A4	Klebsiella_phage	50.0	5.8e-16
WP_049525558.1|1197436_1198072_-	DNA methyltransferase	NA	I6PDF5	Cronobacter_phage	73.0	7.2e-87
WP_049525559.1|1198068_1198287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129019389.1|1198696_1199083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050128071.1|1199072_1199294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049525779.1|1199318_1199588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049525781.1|1199589_1200018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049525783.1|1200014_1200422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154236079.1|1200465_1200639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049525787.1|1200872_1201469_-	hypothetical protein	NA	K7PHD7	Enterobacteria_phage	51.6	3.0e-42
WP_049525790.1|1201465_1202146_-	AAA family ATPase	NA	A0A2D1GLT5	Escherichia_phage	69.0	2.6e-90
WP_049525792.1|1202117_1202366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154236080.1|1202362_1202536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049525794.1|1202801_1203095_-	hypothetical protein	NA	A0A0B4SK56	Proteus_phage	31.3	7.6e-07
WP_050344827.1|1203116_1203485_-	hypothetical protein	NA	B9UDG8	Salmonella_phage	47.5	7.5e-36
WP_049525796.1|1203594_1203936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071828178.1|1204094_1204274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154236085.1|1204478_1204637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057619036.1|1204639_1204924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049611538.1|1205421_1206174_-	helix-turn-helix transcriptional regulator	NA	G8C7L8	Escherichia_phage	41.2	7.3e-30
1205939:1205953	attR	AAAGAAACATCAGAA	NA	NA	NA	NA
WP_049611541.1|1206291_1206525_+	antirepressor	NA	A0A0P0ZDD7	Stx2-converting_phage	58.4	6.4e-17
WP_057619037.1|1206636_1206930_+	hypothetical protein	NA	A2SY75	Escherichia_phage	62.9	8.0e-25
WP_057619038.1|1206954_1207659_+	hypothetical protein	NA	Q71T76	Escherichia_phage	54.0	2.1e-63
WP_071890465.1|1207655_1208477_+	replication protein	NA	K7PL20	Enterobacteria_phage	64.3	5.5e-55
WP_069009079.1|1208473_1209328_+	AAA family ATPase	NA	K7PLU3	Enterobacteria_phage	57.3	8.2e-86
WP_129019429.1|1209468_1209666_+	hypothetical protein	NA	K7PHN9	Enterobacterial_phage	61.9	9.2e-17
WP_069018033.1|1209662_1209965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049525574.1|1210455_1210653_+	hypothetical protein	NA	A0A2H4FUS3	Salmonella_phage	42.2	5.1e-07
WP_049525575.1|1210796_1211267_+	recombination protein NinB	NA	I6R9D0	Salmonella_phage	53.9	2.6e-41
WP_049525577.1|1211888_1212497_+	protein ninG	NA	K7PHP1	Enterobacterial_phage	60.9	1.0e-53
WP_049525578.1|1212493_1213099_+	hypothetical protein	NA	Q8HA89	Salmonella_phage	40.7	1.4e-39
WP_155295583.1|1213329_1213491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148561856.1|1213558_1213798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049525816.1|1213835_1214369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049525581.1|1214560_1214878_+|holin	holin	holin	E7C9S8	Salmonella_phage	57.6	8.4e-28
WP_049525582.1|1214864_1215263_+	M15 family metallopeptidase	NA	E7C9S9	Salmonella_phage	61.7	1.0e-38
WP_049528915.1|1215280_1215781_+	DUF2514 family protein	NA	Q7Y3V2	Yersinia_phage	86.7	1.8e-72
WP_049525583.1|1215791_1216202_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129019398.1|1216232_1216499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049525585.1|1216709_1216943_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.1e-16
WP_057618770.1|1217019_1217664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050126514.1|1217677_1218499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049525588.1|1218870_1219470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_102970453.1|1219438_1221418_+|terminase	phage terminase large subunit family protein	terminase	G8EXZ6	Synechococcus_phage	46.0	3.1e-136
WP_005278866.1|1221426_1221690_+|head,tail	phage head-tail adapter protein	head,tail	NA	NA	NA	NA
WP_069018034.1|1221758_1223342_+|portal	phage portal protein	portal	A0A291AUL8	Sinorhizobium_phage	38.4	6.0e-98
WP_049525590.1|1223338_1224199_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	39.9	1.1e-50
WP_049525591.1|1224191_1224785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069018035.1|1224784_1225186_+|head	head decoration protein	head	NA	NA	NA	NA
WP_049525593.1|1225295_1226342_+|capsid	major capsid protein	capsid	Q6UYI3	Burkholderia_phage	30.7	4.9e-40
WP_049525594.1|1226343_1226838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049525596.1|1226837_1227182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049525598.1|1227178_1227724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049525600.1|1227729_1227921_+	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_050156942.1|1227920_1229411_+|tail	phage tail protein	tail	B5TK67	Pseudomonas_phage	44.2	2.6e-103
WP_049525603.1|1229423_1229798_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_049525606.1|1229799_1230102_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_049525607.1|1230219_1232022_+	lytic transglycosylase domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	49.2	1.1e-23
WP_050879847.1|1232079_1233486_+	hypothetical protein	NA	Q8W619	Enterobacteria_phage	27.6	6.8e-21
WP_049525612.1|1233482_1234556_+|tail	tail protein	tail	M1PVV2	Vibrio_phage	30.1	5.5e-39
WP_049525614.1|1234552_1235146_+|plate	phage baseplate assembly protein	plate	NA	NA	NA	NA
WP_049525616.1|1235142_1235580_+	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	45.4	3.4e-19
WP_050156966.1|1235583_1236720_+|plate	baseplate J/gp47 family protein	plate	A0A1E1GE19	Vibrio_phage	28.0	1.7e-09
WP_050107865.1|1236716_1237313_+	YmfQ family protein	NA	A0A2P9JZK7	Alteromonadaceae_phage	39.8	4.6e-35
WP_049525621.1|1238819_1239035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020283486.1|1239329_1240019_+	methylthioribulose 1-phosphate dehydratase	NA	NA	NA	NA	NA
WP_005164975.1|1240015_1240705_+	acireductone synthase	NA	NA	NA	NA	NA
WP_005164973.1|1240701_1241244_+	acireductone dioxygenase	NA	NA	NA	NA	NA
WP_005164971.1|1241385_1242426_-	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
WP_049525625.1|1242619_1243819_+	S-methyl-5-thioribose kinase	NA	NA	NA	NA	NA
WP_071826071.1|1244831_1246415_+	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_154588537.1|1246455_1253073_+	filamentous hemagglutinin N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_049525627.1|1255225_1257673_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_049525629.1|1257927_1258509_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	8.2e-13
WP_005160484.1|1258610_1259375_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_005160486.1|1259348_1260122_-	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_049525630.1|1260594_1261938_+	Na(+)-translocating NADH-quinone reductase subunit A	NA	NA	NA	NA	NA
WP_049525632.1|1261941_1263183_+	NADH:ubiquinone reductase (Na(+)-transporting) subunit B	NA	NA	NA	NA	NA
WP_013649409.1|1263172_1263973_+	Na(+)-translocating NADH-quinone reductase subunit C	NA	NA	NA	NA	NA
WP_049525633.1|1263965_1264595_+	NADH:ubiquinone reductase (Na(+)-transporting) subunit D	NA	NA	NA	NA	NA
WP_057636510.1|1264601_1265198_+	NADH:ubiquinone reductase (Na(+)-transporting) subunit E	NA	NA	NA	NA	NA
WP_049525636.1|1265213_1266437_+	NADH:ubiquinone reductase (Na(+)-transporting) subunit F	NA	NA	NA	NA	NA
WP_072079353.1|1266476_1267499_+	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_005160496.1|1267511_1267739_+	(Na+)-NQR maturation NqrM	NA	NA	NA	NA	NA
WP_049525638.1|1267878_1268829_-	glycerophosphodiester phosphodiesterase	NA	NA	NA	NA	NA
WP_013649412.1|1269238_1270339_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_049525639.1|1270590_1271223_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_049525640.1|1271225_1272194_+	threo-3-hydroxy-L-aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_005160512.1|1272687_1273746_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_049525641.1|1273819_1275280_-	beta-Ala-His dipeptidase	NA	NA	NA	NA	NA
WP_049525642.1|1275587_1276046_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_020282363.1|1276639_1277659_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP016931	Yersinia enterocolitica strain YE165 chromosome, complete genome	4685321	1449015	1494377	4685321	protease,plate,terminase,lysis,integrase	Escherichia_phage(30.23%)	66	1446429:1446443	1457642:1457656
1446429:1446443	attL	GCTTCACGCTGGATA	NA	NA	NA	NA
WP_005158281.1|1449015_1449882_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	35.0	3.7e-33
WP_154588534.1|1450565_1451210_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4R586	Salmonella_phage	67.8	6.8e-85
WP_046051422.1|1451227_1451575_-	helix-turn-helix domain-containing protein	NA	M1FJ59	Enterobacteria_phage	58.3	2.4e-28
WP_069018041.1|1451932_1452568_-	DNA methyltransferase	NA	I6PDF5	Cronobacter_phage	72.5	2.7e-86
WP_049525559.1|1452564_1452783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129019389.1|1453192_1453579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050128071.1|1453568_1453790_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049525779.1|1453814_1454084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049525781.1|1454085_1454514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057619046.1|1454510_1454918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049526811.1|1454959_1455142_-	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	59.6	1.3e-09
WP_057619042.1|1455138_1456074_-	recombinase RecT	NA	A0A193GYL3	Enterobacter_phage	62.5	2.4e-107
WP_057619043.1|1456066_1456885_-	exodeoxyribonuclease VIII	NA	E5AGE0	Erwinia_phage	74.4	1.2e-121
WP_049526808.1|1456884_1457178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129019391.1|1457281_1457413_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	NA	NA	NA	NA
WP_057619041.1|1457430_1458450_-	hypothetical protein	NA	K7P6J9	Enterobacteria_phage	65.3	1.8e-31
1457642:1457656	attR	GCTTCACGCTGGATA	NA	NA	NA	NA
WP_049525794.1|1458538_1458832_-	hypothetical protein	NA	A0A0B4SK56	Proteus_phage	31.3	7.6e-07
WP_155295584.1|1459408_1459657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071828178.1|1459907_1460087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154236085.1|1460291_1460450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049525798.1|1460452_1460737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049528945.1|1461235_1461445_+	DUF2767 family protein	NA	I6R0R9	Salmonella_phage	47.5	5.9e-06
WP_049525800.1|1461489_1461933_-	hypothetical protein	NA	M1FPN8	Enterobacteria_phage	50.4	4.3e-30
WP_050128085.1|1461950_1462796_-	hypothetical protein	NA	M1FPD4	Enterobacteria_phage	44.3	2.1e-57
WP_080382459.1|1462936_1463635_-	helix-turn-helix transcriptional regulator	NA	A0A2D1GM27	Escherichia_phage	63.5	3.4e-82
WP_049525807.1|1463793_1464024_+	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	47.1	5.0e-06
WP_049525811.1|1464443_1464980_+	hypothetical protein	NA	A0A291AXH9	Shigella_phage	53.6	1.2e-50
WP_057619033.1|1465226_1466129_+	replication protein	NA	C6ZR51	Salmonella_phage	56.0	2.2e-36
WP_049525813.1|1466128_1467466_+	AAA family ATPase	NA	A0A2I7REC3	Vibrio_phage	38.7	1.5e-81
WP_050128081.1|1467478_1467703_+	hypothetical protein	NA	A0A192Y6R5	Salmonella_phage	63.8	2.5e-18
WP_129019429.1|1467843_1468041_+	hypothetical protein	NA	K7PHN9	Enterobacterial_phage	61.9	9.2e-17
WP_049525572.1|1468037_1468340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050294067.1|1468336_1468735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057619053.1|1468731_1468971_+	DUF4752 family protein	NA	T1S9K2	Salmonella_phage	58.7	3.5e-18
WP_050294071.1|1468974_1469424_+	DUF1367 family protein	NA	A0A0P0ZFW0	Escherichia_phage	70.5	5.3e-60
WP_050294074.1|1469643_1470027_+	HNH endonuclease	NA	A0A2R2Z2X9	Escherichia_phage	75.2	8.5e-51
WP_050294075.1|1470166_1470496_+	DUF2591 domain-containing protein	NA	R9VYJ6	Serratia_phage	52.8	3.3e-19
WP_050294079.1|1470497_1471148_+	serine/threonine protein phosphatase	NA	Q716B9	Shigella_phage	61.1	8.5e-75
WP_155295585.1|1471323_1471488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050156987.1|1471602_1472238_+	hypothetical protein	NA	H6WRY9	Salmonella_phage	44.9	1.9e-42
WP_050156985.1|1472234_1472426_+	protein ninH	NA	Q777W6	Enterobacteria_phage	59.3	1.1e-09
WP_050156984.1|1472422_1472911_+	antiterminator	NA	M1FPN0	Enterobacteria_phage	67.9	2.4e-58
WP_049525816.1|1473214_1473748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049528949.1|1473965_1474247_+	hypothetical protein	NA	H6WRZ3	Salmonella_phage	54.3	1.1e-18
WP_049526777.1|1474246_1474759_+	lysozyme	NA	I6PBN2	Cronobacter_phage	59.9	2.4e-48
WP_049525819.1|1474743_1475205_+|lysis	lysis protein	lysis	A5LH84	Enterobacteria_phage	43.0	1.7e-21
WP_049529053.1|1475350_1476073_+	hypothetical protein	NA	A0A1I9KFG9	Aeromonas_phage	29.3	2.6e-16
WP_049526775.1|1476074_1477397_+|terminase	terminase	terminase	A0A0U2JTW9	Escherichia_phage	59.7	4.9e-154
WP_069018044.1|1477409_1478828_+	DUF1073 domain-containing protein	NA	A0A0U2S5X9	Escherichia_phage	37.3	1.6e-86
WP_057619023.1|1478824_1479646_+	hypothetical protein	NA	A0A0U2I1R8	Escherichia_phage	41.8	1.0e-53
WP_049529051.1|1479680_1481282_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_057619022.1|1481297_1482164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057619021.1|1482180_1483212_+	hypothetical protein	NA	A0A0U2QQI2	Escherichia_phage	46.6	5.1e-74
WP_049526766.1|1483759_1484188_+	hypothetical protein	NA	A0A0U2S646	Escherichia_phage	39.1	7.1e-22
WP_049526765.1|1484184_1484619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057619028.1|1484602_1485544_+	hypothetical protein	NA	A0A0U2SH76	Escherichia_phage	36.7	1.5e-51
WP_057619029.1|1485548_1486943_+	hypothetical protein	NA	A0A0U2KD19	Escherichia_phage	36.9	1.3e-67
WP_049526758.1|1486946_1487384_+	hypothetical protein	NA	A0A0U2S616	Escherichia_phage	39.6	7.0e-25
WP_057619030.1|1487387_1487963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069018045.1|1488086_1489907_+	hypothetical protein	NA	A0A2R3UAN6	Myoviridae_environmental_samples	42.7	1.3e-19
WP_057618993.1|1489906_1490623_+	hypothetical protein	NA	A0A0U2JGI7	Escherichia_phage	37.2	1.8e-30
WP_057618994.1|1490619_1490895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057618995.1|1490894_1491920_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057618996.1|1491916_1492633_+	hypothetical protein	NA	A0A0U2JTX5	Escherichia_phage	31.9	9.2e-22
WP_050072736.1|1492629_1492962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057618997.1|1492958_1494377_+|plate	baseplate J-like family protein	plate	A0A2I7QLA6	Vibrio_phage	38.2	1.4e-05
>prophage 6
NZ_CP016931	Yersinia enterocolitica strain YE165 chromosome, complete genome	4685321	1655289	1696215	4685321		uncultured_Caudovirales_phage(30.77%)	61	NA	NA
WP_050344554.1|1655289_1656483_+	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	39.9	2.4e-75
WP_042806437.1|1656448_1656649_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_049525976.1|1656857_1657106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049525978.1|1657108_1657345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080347401.1|1657337_1657631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049525983.1|1657639_1657981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049525985.1|1657974_1658385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049525987.1|1658384_1658609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049525989.1|1658605_1659454_-	hypothetical protein	NA	A3EZV6	Salmonella_phage	37.7	5.2e-08
WP_069018050.1|1659464_1660040_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	62.0	5.4e-65
WP_049525992.1|1660042_1660261_-	hypothetical protein	NA	A0A291LBA3	Klebsiella_phage	44.3	1.9e-07
WP_049525994.1|1660257_1660446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057618581.1|1660442_1660811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049525998.1|1660895_1661321_-	hypothetical protein	NA	H6WRV0	Salmonella_phage	46.0	7.8e-13
WP_049526000.1|1661317_1661701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049526001.1|1661693_1661897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057618580.1|1661893_1662172_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_049526005.1|1662168_1662468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049526007.1|1662470_1662671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148561861.1|1662892_1663603_-	helix-turn-helix transcriptional regulator	NA	A0A2D1GM27	Escherichia_phage	55.0	2.2e-68
WP_049526011.1|1663710_1663932_+	helix-turn-helix domain-containing protein	NA	A0A0N7C1T6	Escherichia_phage	59.7	2.7e-17
WP_049526013.1|1663951_1664776_+	transporter	NA	Q8W644	Enterobacteria_phage	70.1	1.2e-113
WP_049526015.1|1664772_1665084_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069018051.1|1665085_1666081_+	hypothetical protein	NA	A0A068C8G6	Acinetobacter_phage	48.7	1.6e-32
WP_050293922.1|1666077_1666953_+	hypothetical protein	NA	K7PLU3	Enterobacteria_phage	45.0	9.0e-64
WP_049526017.1|1666949_1668311_+	helicase	NA	Q8W640	Enterobacteria_phage	50.0	4.9e-117
WP_049526018.1|1668327_1669092_+	molecular chaperone	NA	A0A286N2Q2	Klebsiella_phage	48.1	5.1e-63
WP_049526019.1|1669547_1669820_+	bacteriophage protein	NA	A0A2H4FNF0	Salmonella_phage	81.1	1.8e-34
WP_049526021.1|1669823_1670312_+	lysozyme	NA	A0A2H4JCH1	uncultured_Caudovirales_phage	60.1	3.2e-50
WP_069018194.1|1670433_1670934_+	DUF2514 family protein	NA	Q7Y3V2	Yersinia_phage	89.2	1.7e-75
WP_049526024.1|1671546_1671927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049526026.1|1671964_1672147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071891684.1|1672181_1672784_+	hypothetical protein	NA	A0A2R3UAN5	Myoviridae_environmental_samples	49.7	2.4e-39
WP_057618574.1|1673144_1674767_+	TerL protein	NA	A9YWZ6	Burkholderia_phage	72.6	8.5e-233
WP_049617022.1|1674791_1676261_+	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	54.6	5.6e-151
WP_049617023.1|1676331_1676865_+	phage Mu F like family protein	NA	A0A0M4REK0	Salmonella_phage	55.8	1.6e-47
WP_057618572.1|1677126_1678392_+	DUF2213 domain-containing protein	NA	A0A2H4J159	uncultured_Caudovirales_phage	43.8	1.9e-70
WP_057618570.1|1678402_1678906_+	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	45.2	1.3e-27
WP_050133318.1|1678916_1679864_+	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	58.5	6.7e-105
WP_049526028.1|1679902_1680253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069018052.1|1680221_1680629_+	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	53.3	4.2e-32
WP_049526030.1|1680625_1681132_+	hypothetical protein	NA	A9YX26	Burkholderia_phage	34.9	2.4e-16
WP_049526031.1|1681131_1681518_+	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	78.2	3.6e-49
WP_049526033.1|1681510_1682053_+	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	55.8	3.2e-51
WP_057618568.1|1682055_1683531_+	DUF3383 domain-containing protein	NA	A0A0P0I492	Acinetobacter_phage	55.7	3.1e-149
WP_049526038.1|1683542_1683983_+	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	71.2	6.2e-53
WP_057618564.1|1683993_1684392_+	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	56.0	1.7e-33
WP_069018196.1|1684403_1684574_+	lytic transglycosylase	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	42.6	3.1e-05
WP_069018053.1|1684570_1686541_+	lytic transglycosylase	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	48.3	1.2e-167
WP_049526045.1|1686549_1687131_+	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	67.9	1.0e-63
WP_080382442.1|1687244_1687436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049526049.1|1687489_1688509_+	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	61.0	2.4e-124
WP_049526051.1|1688535_1689237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049526053.1|1689503_1690241_+	translation initiation factor IF-2	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	58.8	4.6e-77
WP_049526056.1|1690242_1690596_+	bacteriophage protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	74.4	7.1e-44
WP_049526058.1|1690596_1691784_+	bacteriophage protein	NA	A0A0M4RD32	Salmonella_phage	56.6	9.0e-115
WP_049526060.1|1691783_1692458_+	DUF2612 domain-containing protein	NA	A9YX13	Burkholderia_phage	47.9	1.6e-52
WP_080347385.1|1692450_1694004_+	hypothetical protein	NA	A9YX14	Burkholderia_phage	39.3	6.1e-63
WP_049526063.1|1694017_1694203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013649558.1|1694458_1695157_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_049526065.1|1695150_1696215_+	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	33.8	1.5e-20
>prophage 7
NZ_CP016931	Yersinia enterocolitica strain YE165 chromosome, complete genome	4685321	2040211	2052875	4685321		Vaccinia_virus(16.67%)	9	NA	NA
WP_049526354.1|2040211_2043364_-	beta-galactosidase	NA	B9U1H7	Vaccinia_virus	62.9	0.0e+00
WP_005164513.1|2043542_2044577_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	50.3	1.4e-84
WP_002210893.1|2045058_2045271_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	80.0	2.0e-25
WP_071530598.1|2045479_2045716_+	protein DsrB	NA	NA	NA	NA	NA
WP_013649692.1|2045849_2047589_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.4	1.1e-09
WP_005177865.1|2047836_2048208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005177868.1|2048454_2048694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072087318.1|2049245_2049956_+	MgtC family protein	NA	G3MA03	Bacillus_virus	41.8	3.7e-15
WP_057618704.1|2050172_2052875_+	magnesium-translocating P-type ATPase	NA	M1HM40	Paramecium_bursaria_Chlorella_virus	25.2	2.1e-42
>prophage 8
NZ_CP016931	Yersinia enterocolitica strain YE165 chromosome, complete genome	4685321	2101941	2198052	4685321	plate,tail,head,holin,lysis,capsid,integrase,portal,transposase	Salmonella_phage(40.0%)	98	2156247:2156306	2189227:2189349
WP_038892112.1|2101941_2102055_-|integrase	integrase	integrase	Q8W658	Enterobacteria_phage	83.3	1.7e-07
WP_013649707.1|2102149_2102365_+	hypothetical protein	NA	A0A1I9KFG8	Aeromonas_phage	42.2	4.7e-06
WP_013649708.1|2102892_2103288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005160360.1|2103930_2104533_-	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
WP_049526403.1|2104619_2107580_-	metal-dependent phosphohydrolase	NA	NA	NA	NA	NA
WP_005160357.1|2107907_2108777_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005160355.1|2109050_2109413_-	flagella biosynthesis regulatory protein FliT	NA	NA	NA	NA	NA
WP_005160351.1|2109424_2109823_-	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_020283290.1|2109833_2111234_-	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_049526408.1|2111502_2112612_+	flagellin FliC	NA	NA	NA	NA	NA
WP_049526410.1|2112801_2113947_+	FliC/FljB family flagellin	NA	NA	NA	NA	NA
WP_005160341.1|2115494_2116217_+	RNA polymerase sigma factor FliA	NA	NA	NA	NA	NA
WP_005160338.1|2116272_2116782_+	flagella biosynthesis regulatory protein FliZ	NA	NA	NA	NA	NA
WP_069018068.1|2117160_2118153_+	D-cysteine desulfhydrase	NA	NA	NA	NA	NA
WP_049526413.1|2118271_2119072_+	cystine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005160319.1|2119071_2119734_+	cystine ABC transporter permease	NA	NA	NA	NA	NA
WP_005160316.1|2119736_2120492_+	L-cystine ABC transporter ATP-binding protein YecC	NA	G9BWD6	Planktothrix_phage	41.4	7.1e-33
WP_005160301.1|2120563_2120935_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013649717.1|2120934_2121228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050128020.1|2121527_2125517_-	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_049526417.1|2126043_2127528_+	sodium/proline symporter PutP	NA	NA	NA	NA	NA
WP_005160269.1|2129012_2129342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005160265.1|2129345_2130413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049526419.1|2131203_2132064_+	iron permease	NA	NA	NA	NA	NA
WP_005160262.1|2132080_2133211_+	iron uptake system protein EfeO	NA	NA	NA	NA	NA
WP_049526423.1|2133219_2134521_+	deferrochelatase/peroxidase EfeB	NA	NA	NA	NA	NA
WP_005160258.1|2134722_2135322_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_049526425.1|2135491_2135974_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_049526426.1|2136307_2137486_+	N-acetylneuraminate epimerase	NA	NA	NA	NA	NA
WP_005177999.1|2137496_2137637_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_005178006.1|2139101_2139650_-	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	64.5	1.9e-27
WP_049526428.1|2139699_2140290_-	malonic semialdehyde reductase	NA	NA	NA	NA	NA
WP_049526430.1|2140301_2141138_-	pyrimidine utilization protein D	NA	NA	NA	NA	NA
WP_072075717.1|2141170_2141560_-	pyrimidine utilization protein C	NA	NA	NA	NA	NA
WP_023160573.1|2141606_2142299_-	pyrimidine utilization protein B	NA	NA	NA	NA	NA
WP_049526435.1|2142949_2143618_+	HTH-type transcriptional regulator RutR	NA	NA	NA	NA	NA
WP_049526436.1|2143675_2145106_-	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_049526442.1|2147179_2147914_-	class I SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	39.9	2.0e-48
WP_005160200.1|2148894_2149224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023160574.1|2149368_2150868_+	alpha-amylase	NA	NA	NA	NA	NA
WP_013649732.1|2151119_2151374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005160193.1|2151404_2151743_-	GlpM family protein	NA	NA	NA	NA	NA
WP_049526446.1|2151853_2152078_-	DUF2594 family protein	NA	NA	NA	NA	NA
WP_005160181.1|2152771_2153428_+	UvrY/SirA/GacA family response regulator transcription factor	NA	NA	NA	NA	NA
WP_050127815.1|2153420_2155253_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_005160174.1|2155311_2155860_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
2156247:2156306	attL	TTTAAAATCCCTCGGCTTATGGCTGTGCGGGTTCAAGTCCCGCCCCGGGTACCATGGAAA	NA	NA	NA	NA
WP_057618808.1|2156489_2156705_-	late control protein B	NA	S4TNZ3	Salmonella_phage	60.6	2.4e-18
WP_154588540.1|2156779_2157880_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	66.9	1.7e-128
WP_069018069.1|2157882_2158347_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	65.9	1.2e-46
WP_069018070.1|2158358_2161286_-|tail	phage tail tape measure protein	tail	Q9ZXK0	Pseudomonas_virus	53.9	5.2e-156
WP_042562521.1|2161278_2161398_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	56.4	1.4e-07
WP_004705492.1|2161412_2161691_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	53.6	1.2e-17
WP_042562520.1|2161842_2162358_-|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	68.0	3.2e-61
WP_057618804.1|2162369_2163545_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	80.1	1.0e-179
WP_050879719.1|2163736_2163919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057618803.1|2163915_2165631_-	hypothetical protein	NA	F1BUP1	Erwinia_phage	50.1	5.1e-103
WP_057618802.1|2165627_2166236_-|tail	phage tail protein I	tail	F1BUP2	Erwinia_phage	73.5	1.1e-84
WP_057618801.1|2166228_2167137_-|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	71.5	9.6e-117
WP_050879715.1|2167136_2167493_-|plate	baseplate assembly protein	plate	F1BUP4	Erwinia_phage	60.0	9.7e-33
WP_057618800.1|2167489_2168125_-|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	61.5	4.5e-65
WP_057618799.1|2168311_2168758_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	46.6	1.5e-30
WP_057618798.1|2168754_2169222_-|tail	phage tail protein	tail	F1BUP9	Erwinia_phage	55.9	1.4e-42
WP_057618797.1|2169320_2169746_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	45.5	3.2e-22
WP_057618796.1|2169750_2170146_-	M15 family metallopeptidase	NA	A9DET4	Yersinia_phage	71.0	2.7e-47
WP_071891654.1|2170132_2170519_-|holin	holin	holin	NA	NA	NA	NA
WP_057618795.1|2170549_2170753_-|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	67.2	6.8e-23
WP_057618794.1|2170752_2171244_-|head	head completion/stabilization protein	head	A0A1S5NNA6	Burkholderia_phage	49.7	1.0e-32
WP_057618793.1|2171539_2172193_-	hypothetical protein	NA	F1BUQ7	Erwinia_phage	46.1	2.5e-42
WP_069018071.1|2172198_2173254_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	64.1	1.4e-124
WP_080382448.1|2173290_2174196_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	54.1	2.3e-54
WP_057618790.1|2174271_2176035_+	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	63.4	6.8e-228
WP_057618789.1|2176034_2176760_+	hypothetical protein	NA	A0A077K8Q7	Ralstonia_phage	35.4	3.2e-30
WP_069018072.1|2176756_2177788_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	66.6	8.3e-133
WP_080382447.1|2178468_2178813_-	hypothetical protein	NA	H9C172	Pectobacterium_phage	40.7	6.6e-18
WP_057618786.1|2178826_2179147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057618785.1|2179171_2179402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057618784.1|2179382_2181938_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	38.1	9.5e-130
WP_154588539.1|2181934_2182891_-	phosphoadenosine phosphosulfate reductase family protein	NA	B7SYG0	Stenotrophomonas_phage	43.8	2.9e-63
WP_080382446.1|2182968_2183871_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1S6L011	Salmonella_phage	53.7	1.5e-77
WP_154588538.1|2183867_2184500_-	3'-5' exonuclease	NA	A0A1D9C9N8	Salinivibrio_phage	62.4	2.2e-59
WP_057618810.1|2184502_2184814_-	DUF3850 domain-containing protein	NA	A0A1I9SED1	Escherichia_phage	45.9	2.7e-10
WP_057618782.1|2185254_2185560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069018073.1|2185607_2185907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057618780.1|2185903_2186110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004706419.1|2186121_2186325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057618779.1|2186334_2186529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057618778.1|2186606_2186999_+	hypothetical protein	NA	Q6QID2	Burkholderia_phage	51.3	2.7e-23
WP_057618777.1|2187017_2187656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057618776.1|2187724_2188105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057618775.1|2188104_2189109_+|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	54.2	5.8e-99
WP_013649733.1|2189499_2189715_-	phage transcriptional activator, Ogr/Delta	NA	S4TNZ3	Salmonella_phage	60.6	1.1e-18
2189227:2189349	attR	TTTAAAATCCCTCGGCTTATGGCTGTGCGGGTTCAAGTCCCGCCCCGGGTACCATGGAAAATATTCTAAGTAAAACAAAGTAGTACGAGTATGTCGTTAACCGCCGAGAGGCGGTTTTTTTGT	NA	NA	NA	NA
WP_049526451.1|2193515_2193962_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	47.3	9.4e-33
WP_057619027.1|2193958_2194426_-|tail	phage tail protein	tail	F1BUP9	Erwinia_phage	55.9	6.3e-40
WP_129019410.1|2194527_2194947_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	40.6	8.8e-17
WP_013649751.1|2194956_2195352_-	M15 family metallopeptidase	NA	A9DET4	Yersinia_phage	71.0	5.9e-47
WP_013649752.1|2195338_2195518_-|holin	holin	holin	NA	NA	NA	NA
WP_071598556.1|2195511_2195814_-	hypothetical protein	NA	A0A077KEQ8	Ralstonia_phage	68.7	2.6e-26
WP_069018057.1|2196615_2198052_-|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	39.1	2.9e-83
>prophage 9
NZ_CP016931	Yersinia enterocolitica strain YE165 chromosome, complete genome	4685321	2337253	2355764	4685321		Enterobacteria_phage(33.33%)	33	NA	NA
WP_049525787.1|2337253_2337850_-	hypothetical protein	NA	K7PHD7	Enterobacteria_phage	51.6	3.0e-42
WP_049525790.1|2337846_2338527_-	AAA family ATPase	NA	A0A2D1GLT5	Escherichia_phage	69.0	2.6e-90
WP_049525792.1|2338498_2338747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154236080.1|2338743_2338917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049525794.1|2339182_2339476_-	hypothetical protein	NA	A0A0B4SK56	Proteus_phage	31.3	7.6e-07
WP_050344827.1|2339497_2339866_-	hypothetical protein	NA	B9UDG8	Salmonella_phage	47.5	7.5e-36
WP_049525796.1|2339975_2340317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071828178.1|2340475_2340655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050879870.1|2341020_2341317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049528945.1|2341809_2342019_+	DUF2767 family protein	NA	I6R0R9	Salmonella_phage	47.5	5.9e-06
WP_049525800.1|2342063_2342507_-	hypothetical protein	NA	M1FPN8	Enterobacteria_phage	50.4	4.3e-30
WP_069018076.1|2342524_2343370_-	hypothetical protein	NA	M1FPD4	Enterobacteria_phage	44.0	7.9e-57
WP_012304433.1|2343499_2344222_-	LexA family transcriptional regulator	NA	A0A2R2X2B0	Escherichia_phage	55.5	2.3e-65
WP_042562436.1|2344326_2344521_+	Cro/Cl family transcriptional regulator	NA	K7PLQ6	Enterobacteria_phage	85.5	4.2e-22
WP_050296274.1|2344632_2344926_+	hypothetical protein	NA	A2SY75	Escherichia_phage	63.9	6.1e-25
WP_050156967.1|2344950_2345553_+	hypothetical protein	NA	M1F3E2	Salmonella_phage	42.1	5.5e-36
WP_057619044.1|2345549_2346389_+	replication protein	NA	A0A075B8J2	Enterobacteria_phage	62.3	5.0e-35
WP_069018077.1|2346385_2347240_+	AAA family ATPase	NA	K7PLU3	Enterobacteria_phage	57.3	6.3e-86
WP_129019429.1|2347380_2347578_+	hypothetical protein	NA	K7PHN9	Enterobacterial_phage	61.9	9.2e-17
WP_049525572.1|2347574_2347877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050294067.1|2347873_2348272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057619053.1|2348268_2348508_+	DUF4752 family protein	NA	T1S9K2	Salmonella_phage	58.7	3.5e-18
WP_050294071.1|2348511_2348961_+	DUF1367 family protein	NA	A0A0P0ZFW0	Escherichia_phage	70.5	5.3e-60
WP_050294074.1|2349180_2349564_+	HNH endonuclease	NA	A0A2R2Z2X9	Escherichia_phage	75.2	8.5e-51
WP_050294075.1|2349703_2350033_+	DUF2591 domain-containing protein	NA	R9VYJ6	Serratia_phage	52.8	3.3e-19
WP_050294079.1|2350034_2350685_+	serine/threonine protein phosphatase	NA	Q716B9	Shigella_phage	61.1	8.5e-75
WP_155295585.1|2350860_2351025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050156987.1|2351139_2351775_+	hypothetical protein	NA	H6WRY9	Salmonella_phage	44.9	1.9e-42
WP_050156985.1|2351771_2351963_+	protein ninH	NA	Q777W6	Enterobacteria_phage	59.3	1.1e-09
WP_050156984.1|2351959_2352448_+	antiterminator	NA	M1FPN0	Enterobacteria_phage	67.9	2.4e-58
WP_049525816.1|2352751_2353285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049528949.1|2353502_2353784_+	hypothetical protein	NA	H6WRZ3	Salmonella_phage	54.3	1.1e-18
WP_057618962.1|2355038_2355764_+	hypothetical protein	NA	A0A0U2JGI7	Escherichia_phage	35.4	2.5e-27
>prophage 10
NZ_CP016931	Yersinia enterocolitica strain YE165 chromosome, complete genome	4685321	2563699	2623153	4685321	coat,protease,transposase,tRNA	Bacillus_phage(28.57%)	54	NA	NA
WP_049525161.1|2563699_2564731_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_071828211.1|2564711_2564882_+	NINE protein	NA	M4ZS56	Bacillus_phage	62.5	1.0e-08
WP_002211830.1|2565094_2565391_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	4.2e-13
WP_049526614.1|2565395_2567783_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	27.8	1.1e-07
WP_005161570.1|2567797_2568781_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	5.8e-35
WP_152414234.1|2569129_2569177_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_004393357.1|2569245_2569602_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_004713020.1|2569639_2569837_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_011816226.1|2569933_2570485_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.7	3.4e-16
WP_049526612.1|2570488_2572417_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.2	8.8e-128
WP_005161573.1|2572740_2572953_+	KTSC domain-containing protein	NA	A0A0K1LMB5	Caulobacter_phage	42.0	9.9e-09
WP_005161576.1|2573072_2573786_-	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_049526607.1|2574310_2574490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005161581.1|2574555_2574792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011816223.1|2575264_2575549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005161586.1|2575956_2576640_+	MarC family NAAT transporter	NA	NA	NA	NA	NA
WP_005161592.1|2577002_2577665_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_049526602.1|2577876_2578845_+	iron/manganese ABC transporter substrate-binding protein YfeA	NA	NA	NA	NA	NA
WP_005161600.1|2578841_2579732_+	iron/manganese ABC transporter ATP-binding protein YfeB	NA	W8CYL7	Bacillus_phage	29.7	5.9e-10
WP_049526599.1|2579731_2580616_+	iron/manganese ABC transporter permease subunit YfeC	NA	NA	NA	NA	NA
WP_049526597.1|2580612_2581488_+	iron/manganese ABC transporter permease subunit YfeD	NA	NA	NA	NA	NA
WP_049526595.1|2582119_2582989_+	fructosamine kinase family protein	NA	NA	NA	NA	NA
WP_013649829.1|2585392_2586388_+	methylmalonyl Co-A mutase-associated GTPase MeaB	NA	NA	NA	NA	NA
WP_005161631.1|2586401_2587187_+	methylmalonyl-CoA decarboxylase	NA	NA	NA	NA	NA
WP_049526593.1|2587212_2588694_+	succinate CoA transferase	NA	NA	NA	NA	NA
WP_049526592.1|2588690_2589581_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005170142.1|2589789_2590344_-	yfeABCD regulator yfeE	NA	NA	NA	NA	NA
WP_005161643.1|2590593_2591259_+	hexitol phosphatase HxpB	NA	NA	NA	NA	NA
WP_049526590.1|2591368_2592571_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	71.0	5.8e-77
WP_005170147.1|2592675_2593008_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_013649826.1|2593245_2594082_+	5-dehydro-4-deoxy-D-glucuronate isomerase	NA	NA	NA	NA	NA
WP_049529028.1|2594193_2594955_+	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	33.3	3.5e-19
WP_069018090.1|2595282_2596950_+	pectate lyase	NA	NA	NA	NA	NA
WP_005161668.1|2596990_2597881_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_005161693.1|2597873_2598791_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_005161697.1|2598804_2599932_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.5	3.0e-11
WP_049526584.1|2599947_2601240_+	carbohydrate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_013649825.1|2601549_2602248_+	porin	NA	NA	NA	NA	NA
WP_005161706.1|2602605_2603154_+	metal-dependent hydrolase	NA	A0A127AVX7	Bacillus_phage	33.3	2.9e-07
WP_005164953.1|2604844_2605696_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1W6DX33	Sphingobium_phage	29.5	4.3e-10
WP_005164952.1|2605971_2606763_-	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_005164950.1|2606949_2608116_-	oligogalacturonate lyase	NA	NA	NA	NA	NA
WP_049526580.1|2609833_2609959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005164945.1|2609993_2610875_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_005164944.1|2611171_2613247_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	35.4	4.3e-88
WP_005170218.1|2613266_2613995_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_013649820.1|2614090_2614588_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_049526576.1|2614828_2616076_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_069018091.1|2616044_2618675_+	PqiB family protein	NA	NA	NA	NA	NA
WP_049526572.1|2618687_2619608_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_049526570.1|2619735_2621157_+	MFS transporter	NA	NA	NA	NA	NA
WP_072077031.1|2621466_2622021_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_049526568.1|2622026_2622584_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_005164931.1|2622595_2623153_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
>prophage 11
NZ_CP016931	Yersinia enterocolitica strain YE165 chromosome, complete genome	4685321	2745294	2805477	4685321	integrase,tail,transposase,tRNA	Escherichia_phage(26.67%)	44	2732529:2732543	2805996:2806010
2732529:2732543	attL	ACCGCCTGAACGGCA	NA	NA	NA	NA
WP_049526889.1|2745294_2747025_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	35.1	5.9e-91
WP_069018097.1|2747116_2748553_+|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.8	6.4e-83
WP_049526892.1|2748688_2749477_-	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	73.8	1.2e-88
WP_032904241.1|2749530_2749734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005164388.1|2750005_2750713_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_049526894.1|2750928_2751396_-	poly-beta-1,6-N-acetyl-D-glucosamine biosynthesis protein PgaD	NA	NA	NA	NA	NA
WP_005164390.1|2751392_2752727_-	poly-beta-1,6 N-acetyl-D-glucosamine synthase	NA	NA	NA	NA	NA
WP_057618883.1|2757901_2759119_-	M24 family metallopeptidase	NA	NA	NA	NA	NA
WP_049526898.1|2759169_2759940_-	siderophore-iron reductase FhuF	NA	NA	NA	NA	NA
WP_005164398.1|2760097_2760724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049526901.1|2761795_2762665_-	SAM-dependent methyltransferase TehB	NA	NA	NA	NA	NA
WP_005164402.1|2762809_2763124_-	cytochrome c	NA	NA	NA	NA	NA
WP_005164403.1|2763123_2763612_-	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_049526903.1|2763601_2764315_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.2	3.7e-31
WP_005179185.1|2765464_2766757_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_049526908.1|2766759_2768163_-	DUF2318 domain-containing protein	NA	NA	NA	NA	NA
WP_004390794.1|2768298_2768826_-	iron transporter	NA	NA	NA	NA	NA
WP_014608895.1|2768906_2770844_-	FTR1 family iron permease	NA	NA	NA	NA	NA
WP_020283107.1|2771017_2771536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049526912.1|2773405_2774413_-	glutaminase A	NA	NA	NA	NA	NA
WP_023160703.1|2774978_2775758_-	hydroxypyruvate isomerase family protein	NA	NA	NA	NA	NA
WP_057618885.1|2775760_2776384_-	aldolase	NA	A0A077SK32	Escherichia_phage	77.2	2.2e-88
WP_072079349.1|2776380_2777688_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	60.5	3.2e-137
WP_005164436.1|2778165_2778945_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	63.9	1.7e-82
WP_005164439.1|2779189_2780866_+	two-component system sensor histidine kinase DcuS	NA	NA	NA	NA	NA
WP_069018098.1|2780858_2781578_+	two-component system response regulator DcuR	NA	NA	NA	NA	NA
WP_050156560.1|2781993_2783352_-	2-hydroxycarboxylate transporter family protein	NA	A0A140XAH4	Dickeya_phage	68.8	5.6e-28
WP_071828284.1|2784414_2785920_+	L-asparagine permease	NA	NA	NA	NA	NA
WP_005164450.1|2786068_2786422_-	DUF488 family protein	NA	NA	NA	NA	NA
WP_072089378.1|2786716_2787733_+	ROK family protein	NA	NA	NA	NA	NA
WP_049526926.1|2787969_2789142_+	MFS transporter	NA	NA	NA	NA	NA
WP_020283100.1|2789322_2790141_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_049526590.1|2791198_2792401_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	71.0	5.8e-77
WP_013649992.1|2792593_2793115_-	ricin-type beta-trefoil lectin domain protein	NA	NA	NA	NA	NA
WP_005166647.1|2793252_2793909_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_069018099.1|2794750_2795953_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	71.5	4.4e-77
WP_013649995.1|2796944_2798258_-	cytosine permease	NA	NA	NA	NA	NA
WP_005163571.1|2798461_2799226_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_050156510.1|2800140_2801358_+|tail	phage tail tape measure protein	tail	S4TP64	Salmonella_phage	40.7	6.5e-60
WP_005163578.1|2801360_2801813_+|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	63.2	2.7e-48
WP_020283095.1|2801809_2802952_+	phage late control D family protein	NA	A0A218M4J7	Erwinia_phage	67.9	6.5e-147
WP_005163580.1|2803044_2803266_+	DNA-binding transcriptional regulator	NA	Q37973	Salmonella_virus	67.6	4.3e-23
WP_005163581.1|2803350_2804166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069009291.1|2804478_2805477_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4S6G4	Salmonella_phage	58.0	4.7e-109
2805996:2806010	attR	ACCGCCTGAACGGCA	NA	NA	NA	NA
>prophage 1
NZ_CP016932	Yersinia enterocolitica strain YE165 plasmid unnamed1, complete sequence	125964	34336	84784	125964	transposase,integrase	Macacine_betaherpesvirus(20.0%)	40	29720:29735	101144:101159
29720:29735	attL	TATAGGCCAATAAATC	NA	NA	NA	NA
WP_071891480.1|34336_35542_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_129019442.1|36037_37471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050127659.1|37625_37901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050156614.1|38000_38354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012291420.1|38464_38785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050127661.1|38997_39315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050156626.1|39319_40186_+	DsbC family protein	NA	NA	NA	NA	NA
WP_050127662.1|40239_40608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050127663.1|40907_41558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012291411.1|41559_42348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069009838.1|42347_43595_+	conjugal transfer protein TraB	NA	NA	NA	NA	NA
WP_050127664.1|43618_44125_+	TraV family lipoprotein	NA	NA	NA	NA	NA
WP_080382451.1|44148_46698_+	TraC family protein	NA	NA	NA	NA	NA
WP_080357812.1|46699_48745_+	conjugal transfer protein TraN	NA	NA	NA	NA	NA
WP_050127667.1|48725_50501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050127668.1|50654_52238_+	conjugal transfer protein TraU	NA	NA	NA	NA	NA
WP_050127685.1|52369_52957_+	conjugal transfer protein TrbC	NA	NA	NA	NA	NA
WP_050127669.1|52956_53421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005276898.1|53431_53851_+	PEGA domain-containing protein	NA	NA	NA	NA	NA
WP_102778917.1|53935_54724_+	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_050156620.1|54733_56122_+	pilus assembly protein	NA	NA	NA	NA	NA
WP_069018221.1|56118_59772_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154236062.1|60203_60530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057618892.1|60621_61035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069018231.1|61155_61407_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_050127675.1|61697_62744_-	Abi family protein	NA	NA	NA	NA	NA
WP_069018233.1|63450_63852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069018235.1|64226_65021_+	DUF4225 domain-containing protein	NA	NA	NA	NA	NA
WP_023160836.1|65748_66768_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_050156624.1|69819_70737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129019443.1|70837_71611_+|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	81.4	6.1e-48
WP_069018238.1|71794_72433_+	serine recombinase	NA	NA	NA	NA	NA
WP_057618893.1|73069_75016_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_154236065.1|75273_76959_+	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	A0A0R6PI85	Moraxella_phage	28.3	7.4e-38
WP_071891490.1|79884_80259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050344858.1|80457_81105_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.0	7.3e-10
WP_050128091.1|81385_82021_+	ParA family protein	NA	NA	NA	NA	NA
WP_050128092.1|82083_82377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129019436.1|83830_84527_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	1.9e-40
WP_069018239.1|84541_84784_-|transposase	IS3 family transposase	transposase	Q716C1	Shigella_phage	63.2	9.6e-16
101144:101159	attR	TATAGGCCAATAAATC	NA	NA	NA	NA
>prophage 1
NZ_CP016933	Yersinia enterocolitica strain YE165 plasmid unnamed2, complete sequence	74497	25926	33708	74497	transposase	uncultured_Caudovirales_phage(57.14%)	9	NA	NA
WP_050294038.1|25926_26625_-	arsenic resistance NADPH-dependent reductase ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	68.1	4.2e-88
WP_013749489.1|26710_27031_+	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	46.7	1.7e-20
WP_057618950.1|27076_28366_+	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	70.4	7.1e-166
WP_010891244.1|28378_28804_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	5.6e-51
WP_050294040.1|28821_29403_-	recombinase family protein	NA	A0A219YA40	Aeromonas_phage	35.5	3.3e-22
WP_071890451.1|29578_30415_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.5	4.2e-18
WP_010891241.1|30570_31023_+	PprA	NA	NA	NA	NA	NA
WP_013749484.1|31344_32220_-	DMT family transporter	NA	NA	NA	NA	NA
WP_050294042.1|32289_33708_-	trimeric autotransporter adhesin YadA	NA	Q9MCI8	Enterobacteria_phage	55.6	2.6e-12
