The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP016935	Yersinia enterocolitica strain YE7 chromosome, complete genome	4661129	93607	174607	4661129	protease,bacteriocin,transposase	Enterobacterial_phage(33.33%)	52	NA	NA
WP_057618920.1|93607_93859_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_005162673.1|94141_94396_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_005162670.1|94708_95068_+	antitermination protein	NA	K7PGW2	Enterobacterial_phage	47.5	1.7e-21
WP_032904442.1|95170_95929_-	molecular chaperone	NA	NA	NA	NA	NA
WP_069008913.1|100043_100772_-	molecular chaperone	NA	NA	NA	NA	NA
WP_049525161.1|100916_101948_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_005165289.1|102890_103853_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_049528679.1|103886_104360_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_049528676.1|105608_106463_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_005165296.1|106691_107060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129019424.1|107123_107276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005166182.1|108722_110186_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_016266334.1|113787_114252_-	Large exoprotein involved in heme utilization or adhesion	NA	NA	NA	NA	NA
WP_005166173.1|116920_118453_-	signal transduction histidine-protein kinase/phosphatase UhpB	NA	NA	NA	NA	NA
WP_049528662.1|118449_119040_-	transcriptional regulator UhpA	NA	NA	NA	NA	NA
WP_050127428.1|119151_120843_-	kdo(2)-lipid A phosphoethanolamine 7''-transferase	NA	NA	NA	NA	NA
WP_048618714.1|121102_121528_-	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_023160836.1|121998_123018_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_069008919.1|123829_125437_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005157323.1|125719_126739_+	dipeptide ABC transporter permease DppB	NA	NA	NA	NA	NA
WP_049525223.1|126749_127652_+	dipeptide ABC transporter permease DppC	NA	NA	NA	NA	NA
WP_049525224.1|127667_128648_+	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.9	2.5e-14
WP_005157326.1|128662_129667_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.7	1.7e-18
WP_049525225.1|130009_131662_-	cellulose biosynthesis protein BcsG	NA	NA	NA	NA	NA
WP_005157335.1|131664_131853_-	cellulose biosynthesis protein BcsF	NA	NA	NA	NA	NA
WP_049525226.1|131849_133409_-	cellulose biosynthesis protein BcsE	NA	NA	NA	NA	NA
WP_005157340.1|133606_133798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013650602.1|133801_134539_+	cellulose synthase operon protein YhjQ	NA	NA	NA	NA	NA
WP_049525228.1|134535_137163_+	UDP-forming cellulose synthase catalytic subunit	NA	NA	NA	NA	NA
WP_049528808.1|137173_139477_+	cellulose biosynthesis cyclic di-GMP-binding regulatory protein BcsB	NA	NA	NA	NA	NA
WP_057618858.1|139482_140610_+	cellulase	NA	NA	NA	NA	NA
WP_069008921.1|140591_143966_+	cellulose biosynthesis protein BcsC	NA	NA	NA	NA	NA
WP_069008922.1|144229_145726_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_005157352.1|146450_147155_+	porin	NA	NA	NA	NA	NA
WP_005157353.1|147231_148950_+	pectate lyase	NA	NA	NA	NA	NA
WP_069008923.1|149074_149554_+	discoidin domain-containing protein	NA	NA	NA	NA	NA
WP_005157357.1|149931_151224_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_005157359.1|151638_153129_+	insulinase family protein	NA	NA	NA	NA	NA
WP_005157362.1|153288_154233_-	sugar kinase	NA	NA	NA	NA	NA
WP_004388926.1|154377_154578_-	4-oxalocrotonate tautomerase family protein	NA	NA	NA	NA	NA
WP_049525232.1|154816_155608_+	cyclic-guanylate-specific phosphodiesterase	NA	NA	NA	NA	NA
WP_049525233.1|157882_158647_-	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_049525234.1|158670_159660_-	inner membrane protein YhjD	NA	NA	NA	NA	NA
WP_069008925.1|160076_163319_+	autotransporter adhesin YapE	NA	NA	NA	NA	NA
WP_005157379.1|163677_165030_-	glutathione-disulfide reductase	NA	NA	NA	NA	NA
WP_049525236.1|165273_166116_-	23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ	NA	NA	NA	NA	NA
WP_023160901.1|166452_168495_+	oligopeptidase A	NA	NA	NA	NA	NA
WP_020283527.1|168498_169257_+	16S rRNA (guanine(1516)-N(2))-methyltransferase RsmJ	NA	NA	NA	NA	NA
WP_013650589.1|169323_170565_-|protease	metalloprotease	protease	NA	NA	NA	NA
WP_049525237.1|170787_172131_-	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_005157389.1|172394_172841_-	universal stress protein UspA	NA	NA	NA	NA	NA
WP_023160836.1|173587_174607_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP016935	Yersinia enterocolitica strain YE7 chromosome, complete genome	4661129	451140	583212	4661129	holin,capsid,head,tail,protease,transposase,integrase,tRNA,terminase	Cronobacter_phage(39.47%)	113	450836:450864	538664:538692
450836:450864	attL	CGCCATATATGGACGCTCCCAATAAACCA	NA	NA	NA	NA
WP_042663659.1|451140_452160_-|transposase	IS110-like element ISYen1 family transposase	transposase	NA	NA	NA	NA
WP_005174358.1|452357_453278_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	53.5	8.0e-79
WP_049525329.1|453636_455049_-	anion permease	NA	NA	NA	NA	NA
WP_005163087.1|455558_455771_-	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	80.0	4.4e-25
WP_005163090.1|456042_456255_-	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	80.0	1.7e-24
WP_005163093.1|456636_457107_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_002210061.1|458980_459277_-	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
WP_005163099.1|459297_460263_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_005163101.1|460705_461587_-	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_049525330.1|461678_463133_-	sodium/pantothenate symporter	NA	NA	NA	NA	NA
WP_005163104.1|463122_463365_-	YhdT family protein	NA	NA	NA	NA	NA
WP_005163110.1|463503_464853_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_005163113.1|464864_465329_-	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_049525331.1|465361_465814_-	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_049525332.1|466022_466622_-	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_005163122.1|466621_467656_-	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_005163130.1|467809_468787_-	oxidoreductase	NA	NA	NA	NA	NA
WP_069008954.1|469071_470991_+	RNase E specificity factor CsrD	NA	NA	NA	NA	NA
WP_002228205.1|471325_472369_+	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.0e-06
WP_005163136.1|472468_473455_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_005163138.1|473451_473940_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_005180107.1|473953_474547_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_049525335.1|474536_476006_+	ribonuclease G	NA	NA	NA	NA	NA
WP_069008956.1|476207_480083_+	AsmA2 domain-containing protein	NA	NA	NA	NA	NA
WP_005163159.1|480079_480940_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_049525337.1|480951_482397_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_069008958.1|482450_483737_-	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_013650506.1|483733_484012_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_005163183.1|487581_487941_-	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_020282680.1|487937_488339_-	M15 family metallopeptidase	NA	A9DET4	Yersinia_phage	58.4	1.4e-40
WP_005163187.1|488347_488659_-|holin	holin	holin	R9W0A1	Serratia_phage	51.2	3.1e-19
WP_069008960.1|488735_493238_-	toxin	NA	NA	NA	NA	NA
WP_050127097.1|493294_496825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005163194.1|500495_501407_-	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
WP_005163197.1|501732_501936_+	AaeX family protein	NA	NA	NA	NA	NA
WP_050127093.1|501943_502879_+	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
WP_069008961.1|502880_504836_+	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
WP_049525342.1|504957_506451_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_049525343.1|506548_507022_+	ribonuclease	NA	NA	NA	NA	NA
WP_004392366.1|507026_507293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005163212.1|507324_507870_-	ribosome-associated protein	NA	NA	NA	NA	NA
WP_049525344.1|508007_509000_-|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	60.4	2.8e-109
WP_049525345.1|509066_509366_-	helix-turn-helix transcriptional regulator	NA	Q1JS29	Enterobacteria_phage	74.7	4.6e-36
WP_129019376.1|509475_509808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049525347.1|509934_510156_+	DUF2724 domain-containing protein	NA	NA	NA	NA	NA
WP_049525348.1|510170_510527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049525349.1|510599_510866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049525350.1|510865_511762_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	E5G6L8	Salmonella_phage	51.0	2.8e-76
WP_049525351.1|511758_512796_+	phosphoadenosine phosphosulfate reductase family protein	NA	B7SYG0	Stenotrophomonas_phage	42.6	7.7e-62
WP_069008964.1|512792_515198_+	replication endonuclease	NA	F1BUS0	Erwinia_phage	49.9	1.2e-203
WP_049525352.1|515243_515504_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	64.3	1.3e-26
WP_069008967.1|516599_518387_-|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	66.6	4.8e-237
WP_049525354.1|518556_519414_+|capsid	phage capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	48.1	2.7e-44
WP_049525355.1|519479_520511_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	76.4	3.6e-144
WP_049525356.1|520520_521219_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	53.9	4.5e-66
WP_046050145.1|521278_521767_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	56.0	1.1e-39
WP_049525357.1|521763_522252_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	44.8	4.2e-34
WP_049525359.1|523743_524199_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	60.9	9.8e-46
WP_049525360.1|524208_524499_+|holin	holin	holin	C7BGD7	Burkholderia_phage	50.6	6.7e-16
WP_049525361.1|524495_524837_+	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	82.2	1.4e-44
WP_049525362.1|524836_525178_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	41.8	4.4e-14
WP_004389570.1|525327_525594_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	53.7	5.1e-18
WP_057618720.1|525781_527758_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	48.5	1.9e-170
WP_049525364.1|527757_528090_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	67.3	1.7e-34
WP_049525365.1|528082_529267_+	phage protein	NA	F1BUK6	Cronobacter_phage	67.0	1.3e-153
WP_049525366.1|529259_529868_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	63.6	9.4e-68
WP_049525367.1|531722_532196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049525368.1|532185_532917_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	47.1	3.9e-44
WP_049525369.1|535341_535548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049525370.1|535682_536519_-	abortive infection family protein	NA	NA	NA	NA	NA
WP_069008969.1|537054_538395_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_042663659.1|538944_539964_-|transposase	IS110-like element ISYen1 family transposase	transposase	NA	NA	NA	NA
538664:538692	attR	CGCCATATATGGACGCTCCCAATAAACCA	NA	NA	NA	NA
WP_005162547.1|540495_540882_+	cytochrome b562	NA	NA	NA	NA	NA
WP_005162545.1|540929_541340_-	nucleoside diphosphate kinase regulator	NA	NA	NA	NA	NA
WP_005174305.1|541871_542216_+	glycine dehydrogenase	NA	NA	NA	NA	NA
WP_004392359.1|542239_542605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005162543.1|542604_542901_+	DUF4312 family protein	NA	NA	NA	NA	NA
WP_005162542.1|542913_543690_+	DUF4311 domain-containing protein	NA	NA	NA	NA	NA
WP_013650492.1|543711_544362_+	DUF4310 family protein	NA	NA	NA	NA	NA
WP_049525373.1|544445_545615_+	amidohydrolase/deacetylase family metallohydrolase	NA	NA	NA	NA	NA
WP_013650491.1|545598_546711_+	DgaE family pyridoxal phosphate-dependent ammonia lyase	NA	NA	NA	NA	NA
WP_049525374.1|546714_547455_+	KDGP aldolase family protein	NA	NA	NA	NA	NA
WP_049525375.1|548928_550827_+	BglG family transcription antiterminator	NA	NA	NA	NA	NA
WP_049525376.1|550898_551204_-	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	66.3	1.5e-29
WP_005162526.1|551203_551482_-	plasmid maintenance system killer protein	NA	A0A2L1IV28	Escherichia_phage	77.2	6.0e-38
WP_049525377.1|554785_555733_+	HTH-type transcriptional regulator TreR	NA	NA	NA	NA	NA
WP_049525378.1|557431_559093_+	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_049525379.1|559434_560169_-|protease	proteasome-type protease	protease	NA	NA	NA	NA
WP_005162507.1|560192_561014_-	transglutaminase family protein	NA	NA	NA	NA	NA
WP_005162503.1|561010_561940_-	alpha-E domain-containing protein	NA	NA	NA	NA	NA
WP_011817265.1|561933_563370_-	circularly permuted type 2 ATP-grasp protein	NA	NA	NA	NA	NA
WP_005162498.1|563637_564024_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_005162495.1|564517_564982_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_049525380.1|564993_565929_-	aspartate carbamoyltransferase	NA	A7RB08	Paramecium_bursaria_Chlorella_virus	40.2	2.7e-50
WP_005162489.1|567055_567328_-	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_005162486.1|567328_568180_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	29.3	1.9e-05
WP_005162484.1|568258_568741_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_005162480.1|568911_569199_-	ribosome hibernation promoting factor	NA	NA	NA	NA	NA
WP_049525381.1|569222_570656_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_004392029.1|570859_571585_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.4	1.6e-21
WP_049525382.1|571591_572137_-	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_049525383.1|572120_572684_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_049525384.1|572680_573244_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	79.3	6.9e-57
WP_019080048.1|573257_574262_-	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	29.5	7.5e-38
WP_005162453.1|575432_576236_+	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	31.7	1.3e-19
WP_069008970.1|576250_577033_+	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
WP_005162449.1|577037_577598_+	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_005162447.1|577610_578237_+	phospholipid-binding protein MlaC	NA	NA	NA	NA	NA
WP_005180174.1|578239_578581_+	lipid asymmetry maintenance protein MlaB	NA	NA	NA	NA	NA
WP_005162441.1|578755_579010_+	BolA family iron metabolism protein IbaG	NA	NA	NA	NA	NA
WP_005162439.1|579131_580400_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_069009633.1|580661_581750_-	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	33.8	1.4e-10
WP_050127209.1|581838_583212_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	29.0	6.0e-22
>prophage 3
NZ_CP016935	Yersinia enterocolitica strain YE7 chromosome, complete genome	4661129	1055721	1102707	4661129	plate,capsid,protease,lysis,integrase,terminase	Edwardsiella_phage(26.42%)	75	1054326:1054339	1072712:1072725
1054326:1054339	attL	TCAGCGGCATTCAT	NA	NA	NA	NA
WP_050294021.1|1055721_1056993_-|integrase	site-specific integrase	integrase	Q8W658	Enterobacteria_phage	52.7	1.4e-126
WP_049525557.1|1057025_1057277_-	DUF1233 family excisionase	NA	A0A286S2A4	Klebsiella_phage	50.0	5.8e-16
WP_049525558.1|1057634_1058270_-	DNA methyltransferase	NA	I6PDF5	Cronobacter_phage	73.0	7.2e-87
WP_049525559.1|1058266_1058485_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164971240.1|1058484_1058661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129019389.1|1058894_1059281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050128071.1|1059270_1059492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049525779.1|1059516_1059786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049525781.1|1059787_1060216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057619046.1|1060212_1060620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049526811.1|1060661_1060844_-	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	59.6	1.3e-09
WP_057619042.1|1060840_1061776_-	recombinase RecT	NA	A0A193GYL3	Enterobacter_phage	62.5	2.4e-107
WP_069009644.1|1061768_1062587_-	exodeoxyribonuclease VIII	NA	E5AGE0	Erwinia_phage	74.1	2.6e-121
WP_049526808.1|1062586_1062880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129019391.1|1062983_1063115_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	NA	NA	NA	NA
WP_069009030.1|1063132_1064152_-	hypothetical protein	NA	K7P6J9	Enterobacteria_phage	64.4	1.2e-30
WP_049525794.1|1064240_1064534_-	hypothetical protein	NA	A0A0B4SK56	Proteus_phage	31.3	7.6e-07
WP_049525796.1|1065079_1065421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071828178.1|1065579_1065759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154236085.1|1065963_1066122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050344824.1|1066124_1066421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049528945.1|1066913_1067123_+	DUF2767 family protein	NA	I6R0R9	Salmonella_phage	47.5	5.9e-06
WP_049525800.1|1067167_1067611_-	hypothetical protein	NA	M1FPN8	Enterobacteria_phage	50.4	4.3e-30
WP_049525803.1|1067628_1068474_-	hypothetical protein	NA	M1FPD4	Enterobacteria_phage	44.3	4.6e-57
WP_012304433.1|1068603_1069326_-	LexA family transcriptional regulator	NA	A0A2R2X2B0	Escherichia_phage	55.5	2.3e-65
WP_042562436.1|1069430_1069625_+	Cro/Cl family transcriptional regulator	NA	K7PLQ6	Enterobacteria_phage	85.5	4.2e-22
WP_050296274.1|1069736_1070030_+	hypothetical protein	NA	A2SY75	Escherichia_phage	63.9	6.1e-25
WP_049526793.1|1070054_1070657_+	hypothetical protein	NA	M1F3E2	Salmonella_phage	41.6	1.6e-35
WP_069009033.1|1070653_1071493_+	replication protein	NA	A0A075B8J2	Enterobacteria_phage	61.9	3.2e-34
WP_050344860.1|1071489_1072344_+	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	57.5	2.2e-86
WP_129019429.1|1072484_1072682_+	hypothetical protein	NA	K7PHN9	Enterobacterial_phage	61.9	9.2e-17
WP_069009034.1|1072678_1072981_+	hypothetical protein	NA	NA	NA	NA	NA
1072712:1072725	attR	ATGAATGCCGCTGA	NA	NA	NA	NA
WP_049526787.1|1072977_1073472_+	DUF551 domain-containing protein	NA	E7C9P2	Salmonella_phage	32.5	4.5e-12
WP_049525574.1|1073471_1073669_+	hypothetical protein	NA	A0A2H4FUS3	Salmonella_phage	42.2	5.1e-07
WP_164971241.1|1073658_1073820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049525575.1|1073812_1074283_+	recombination protein NinB	NA	I6R9D0	Salmonella_phage	53.9	2.6e-41
WP_049526784.1|1074904_1075195_+	DUF1364 domain-containing protein	NA	A0A220NQY2	Salmonella_phage	75.8	1.3e-38
WP_049526782.1|1075191_1075554_+	RusA family crossover junction endodeoxyribonuclease	NA	E5AGG1	Erwinia_phage	65.8	8.7e-37
WP_049526779.1|1075762_1076587_+	antitermination protein	NA	M9NZB0	Enterobacteria_phage	53.6	1.3e-75
WP_049525816.1|1077060_1077594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049528949.1|1077811_1078093_+	hypothetical protein	NA	H6WRZ3	Salmonella_phage	54.3	1.1e-18
WP_049526777.1|1078092_1078605_+	lysozyme	NA	I6PBN2	Cronobacter_phage	59.9	2.4e-48
WP_049525819.1|1078589_1079051_+|lysis	lysis protein	lysis	A5LH84	Enterobacteria_phage	43.0	1.7e-21
WP_069009038.1|1079368_1080055_+	Rha family transcriptional regulator	NA	A0A192Y918	Salmonella_phage	86.0	6.5e-110
WP_155296413.1|1080057_1080231_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069009040.1|1080297_1080522_+	hypothetical protein	NA	A0A127KNL9	Pseudomonas_phage	64.7	7.0e-05
WP_069009041.1|1080581_1080782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069009044.1|1080785_1080977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069009046.1|1080987_1081464_+|terminase	terminase	terminase	C7U0V7	Enterobacteria_phage	74.1	3.2e-55
WP_069009047.1|1081465_1083142_+|terminase	phage terminase large subunit	terminase	H9C191	Pectobacterium_phage	72.6	7.9e-242
WP_069009050.1|1083142_1084678_+	DUF1073 domain-containing protein	NA	A0A2R3UAL5	Myoviridae_environmental_samples	44.2	1.0e-102
WP_069009051.1|1084730_1085426_+|capsid	minor capsid protein	capsid	H9C0V1	Aeromonas_phage	54.9	1.3e-65
WP_069009052.1|1085422_1085611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069009054.1|1085656_1086844_+	DUF2213 domain-containing protein	NA	A0A219YCD3	Aeromonas_phage	36.3	2.9e-57
WP_069009056.1|1086845_1087328_+	hypothetical protein	NA	A0A219YBF2	Aeromonas_phage	51.0	1.4e-34
WP_069009059.1|1087327_1088371_+	DUF2184 domain-containing protein	NA	A0A219YBB0	Aeromonas_phage	49.4	7.9e-83
WP_057627536.1|1088374_1088701_+	hypothetical protein	NA	H9C0V9	Aeromonas_phage	41.1	2.1e-10
WP_069009061.1|1088703_1089147_+	DUF4054 domain-containing protein	NA	Q2NPC6	Xanthomonas_phage	50.0	3.1e-20
WP_069009062.1|1089149_1089680_+	hypothetical protein	NA	A0A077KC03	Edwardsiella_phage	43.6	1.4e-27
WP_069009064.1|1089657_1090029_+	hypothetical protein	NA	A0A077KAW7	Edwardsiella_phage	61.0	5.0e-40
WP_049528954.1|1090226_1090544_+	hypothetical protein	NA	A0A077KC88	Edwardsiella_phage	67.3	9.6e-32
WP_049525848.1|1090540_1092028_+	DUF3383 domain-containing protein	NA	A0A077KGV4	Edwardsiella_phage	61.9	4.5e-164
WP_049525852.1|1092037_1092472_+	hypothetical protein	NA	A0A077K9T0	Edwardsiella_phage	67.1	1.6e-53
WP_049525854.1|1092471_1092879_+	hypothetical protein	NA	A0A077KC08	Edwardsiella_phage	60.7	8.3e-36
WP_049525857.1|1093093_1094854_+	lytic transglycosylase domain-containing protein	NA	A0A077KC92	Edwardsiella_phage	38.6	2.4e-100
WP_049525859.1|1094858_1095260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049525861.1|1095336_1095795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049525864.1|1095907_1096726_+	hypothetical protein	NA	A0A077KGW3	Edwardsiella_phage	57.9	4.8e-75
WP_049525866.1|1096722_1097028_+	hypothetical protein	NA	A0A077K9U4	Edwardsiella_phage	63.0	9.2e-32
WP_049525867.1|1097017_1097875_+	hypothetical protein	NA	A0A077KC17	Edwardsiella_phage	53.6	3.0e-80
WP_049525869.1|1097871_1098582_+|plate	phage baseplate assembly protein	plate	A0A077KAY0	Edwardsiella_phage	52.9	1.4e-59
WP_049525871.1|1098578_1098938_+	hypothetical protein	NA	A0A077KCA1	Edwardsiella_phage	73.7	1.2e-43
WP_069009065.1|1098934_1100176_+	hypothetical protein	NA	A0A077KGW9	Edwardsiella_phage	67.8	1.7e-156
WP_049525876.1|1100172_1100814_+	DUF2612 domain-containing protein	NA	A0A077K9U8	Edwardsiella_phage	73.6	1.1e-87
WP_129019393.1|1100991_1102707_+	hypothetical protein	NA	A9YX14	Burkholderia_phage	39.8	7.0e-52
>prophage 4
NZ_CP016935	Yersinia enterocolitica strain YE7 chromosome, complete genome	4661129	1302516	1424360	4661129	plate,holin,portal,capsid,head,tail,protease,lysis,coat,transposase,integrase,tRNA,terminase	Enterobacteria_phage(19.05%)	172	1308767:1308781	1359298:1359313
WP_005158258.1|1302516_1303152_-|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_005158259.1|1303122_1303809_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.2	2.7e-31
WP_049525769.1|1303805_1306232_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_005158266.1|1306371_1307436_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_049525771.1|1307432_1307957_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	38.5	5.3e-19
WP_049525773.1|1308132_1308855_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
1308767:1308781	attL	GCTTCACGCTGGATA	NA	NA	NA	NA
WP_005158275.1|1308865_1309360_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
1308767:1308781	attL	GCTTCACGCTGGATA	NA	NA	NA	NA
WP_020283435.1|1309572_1310958_+|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	32.0	5.5e-39
WP_004390634.1|1311126_1311339_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_005158281.1|1311353_1312220_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	35.0	3.7e-33
WP_050344586.1|1312542_1313697_-|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	71.1	6.2e-161
WP_049525558.1|1314297_1314933_-	DNA methyltransferase	NA	I6PDF5	Cronobacter_phage	73.0	7.2e-87
WP_049525559.1|1314929_1315148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164971240.1|1315147_1315324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129019389.1|1315557_1315944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050128071.1|1315933_1316155_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049525779.1|1316179_1316449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049525781.1|1316450_1316879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057619046.1|1316875_1317283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049526811.1|1317324_1317507_-	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	59.6	1.3e-09
WP_057619042.1|1317503_1318439_-	recombinase RecT	NA	A0A193GYL3	Enterobacter_phage	62.5	2.4e-107
WP_069009644.1|1318431_1319250_-	exodeoxyribonuclease VIII	NA	E5AGE0	Erwinia_phage	74.1	2.6e-121
WP_049526808.1|1319249_1319543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129019391.1|1319646_1319778_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	NA	NA	NA	NA
WP_069009030.1|1319795_1320815_-	hypothetical protein	NA	K7P6J9	Enterobacteria_phage	64.4	1.2e-30
1320007:1320021	attR	GCTTCACGCTGGATA	NA	NA	NA	NA
WP_049525794.1|1320903_1321197_-	hypothetical protein	NA	A0A0B4SK56	Proteus_phage	31.3	7.6e-07
1320007:1320021	attR	GCTTCACGCTGGATA	NA	NA	NA	NA
WP_049525796.1|1321742_1322084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071828178.1|1322242_1322422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154236085.1|1322626_1322785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049525565.1|1322787_1323072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049611538.1|1323569_1324322_-	helix-turn-helix transcriptional regulator	NA	G8C7L8	Escherichia_phage	41.2	7.3e-30
WP_049611541.1|1324439_1324673_+	antirepressor	NA	A0A0P0ZDD7	Stx2-converting_phage	58.4	6.4e-17
WP_057619037.1|1324784_1325078_+	hypothetical protein	NA	A2SY75	Escherichia_phage	62.9	8.0e-25
WP_057619038.1|1325102_1325807_+	hypothetical protein	NA	Q71T76	Escherichia_phage	54.0	2.1e-63
WP_071890465.1|1325803_1326625_+	replication protein	NA	K7PL20	Enterobacteria_phage	64.3	5.5e-55
WP_069009079.1|1326621_1327476_+	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	57.3	8.2e-86
WP_129019430.1|1327616_1327814_+	hypothetical protein	NA	K7PHN9	Enterobacterial_phage	61.9	9.2e-17
WP_049525572.1|1327810_1328113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050128082.1|1328109_1328610_+	DUF551 domain-containing protein	NA	NA	NA	NA	NA
WP_049525574.1|1328609_1328807_+	hypothetical protein	NA	A0A2H4FUS3	Salmonella_phage	42.2	5.1e-07
WP_164971241.1|1328796_1328958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049525575.1|1328950_1329421_+	recombination protein NinB	NA	I6R9D0	Salmonella_phage	53.9	2.6e-41
WP_049526784.1|1330042_1330333_+	DUF1364 domain-containing protein	NA	A0A220NQY2	Salmonella_phage	75.8	1.3e-38
WP_049526782.1|1330329_1330692_+	RusA family crossover junction endodeoxyribonuclease	NA	E5AGG1	Erwinia_phage	65.8	8.7e-37
WP_049526779.1|1330900_1331725_+	antitermination protein	NA	M9NZB0	Enterobacteria_phage	53.6	1.3e-75
WP_050344746.1|1332198_1332732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049525581.1|1332923_1333241_+|holin	holin	holin	E7C9S8	Salmonella_phage	57.6	8.4e-28
WP_049525582.1|1333227_1333626_+	M15 family metallopeptidase	NA	E7C9S9	Salmonella_phage	61.7	1.0e-38
WP_069009658.1|1333643_1334144_+	DUF2514 family protein	NA	Q7Y3V2	Yersinia_phage	86.7	1.8e-72
WP_049525583.1|1334154_1334565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129019398.1|1334595_1334862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049525585.1|1335072_1335306_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.1e-16
WP_049525586.1|1335382_1336027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049525588.1|1336492_1337092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_102970453.1|1337060_1339040_+|terminase	phage terminase large subunit family protein	terminase	G8EXZ6	Synechococcus_phage	46.0	3.1e-136
WP_005278866.1|1339048_1339312_+|head,tail	phage head-tail adapter protein	head,tail	NA	NA	NA	NA
WP_049525589.1|1339380_1340964_+|portal	phage portal protein	portal	A0A291AUL8	Sinorhizobium_phage	38.5	1.2e-98
WP_049525590.1|1340960_1341821_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	39.9	1.1e-50
WP_049525591.1|1341813_1342407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049525592.1|1342406_1342808_+|head	head decoration protein	head	NA	NA	NA	NA
WP_049525593.1|1342917_1343964_+|capsid	major capsid protein	capsid	Q6UYI3	Burkholderia_phage	30.7	4.9e-40
WP_049525594.1|1343965_1344460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049525596.1|1344459_1344804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049525598.1|1344800_1345346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049525600.1|1345351_1345543_+	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_050156942.1|1345542_1347033_+|tail	phage tail protein	tail	B5TK67	Pseudomonas_phage	44.2	2.6e-103
WP_050319427.1|1347045_1347420_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_049525606.1|1347421_1347724_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_069009080.1|1347841_1349644_+	lytic transglycosylase domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	49.2	1.1e-23
WP_050879847.1|1349701_1351108_+	hypothetical protein	NA	Q8W619	Enterobacteria_phage	27.6	6.8e-21
WP_049525612.1|1351104_1352178_+|tail	tail protein	tail	M1PVV2	Vibrio_phage	30.1	5.5e-39
WP_049525614.1|1352174_1352768_+|plate	phage baseplate assembly protein	plate	NA	NA	NA	NA
WP_049525616.1|1352764_1353202_+	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	45.4	3.4e-19
WP_050156966.1|1353205_1354342_+|plate	baseplate J/gp47 family protein	plate	A0A1E1GE19	Vibrio_phage	28.0	1.7e-09
WP_050107865.1|1354338_1354935_+	YmfQ family protein	NA	A0A2P9JZK7	Alteromonadaceae_phage	39.8	4.6e-35
WP_069009081.1|1356441_1356624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057619001.1|1356730_1357831_+	acyltransferase	NA	A0A2H4JA46	uncultured_Caudovirales_phage	28.0	4.4e-23
WP_071890467.1|1358049_1359072_-|integrase	site-specific integrase	integrase	F1C5B2	Cronobacter_phage	67.1	2.8e-141
WP_046051422.1|1359089_1359437_-	helix-turn-helix domain-containing protein	NA	M1FJ59	Enterobacteria_phage	58.3	2.4e-28
WP_049525558.1|1359794_1360430_-	DNA methyltransferase	NA	I6PDF5	Cronobacter_phage	73.0	7.2e-87
WP_049525559.1|1360426_1360645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164971240.1|1360644_1360821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129019389.1|1361054_1361441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050128071.1|1361430_1361652_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049525779.1|1361676_1361946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049525781.1|1361947_1362376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069009084.1|1362372_1362780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154236079.1|1362823_1362997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049525787.1|1363230_1363827_-	hypothetical protein	NA	K7PHD7	Enterobacteria_phage	51.6	3.0e-42
WP_049525790.1|1363823_1364504_-	AAA family ATPase	NA	A0A2D1GLT5	Escherichia_phage	69.0	2.6e-90
WP_049525792.1|1364475_1364724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154236080.1|1364720_1364894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049525794.1|1365159_1365453_-	hypothetical protein	NA	A0A0B4SK56	Proteus_phage	31.3	7.6e-07
WP_069009085.1|1365474_1365843_-	hypothetical protein	NA	B9UDG8	Salmonella_phage	50.0	2.1e-38
WP_049525796.1|1365952_1366294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071828178.1|1366452_1366632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154236085.1|1366836_1366995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049525798.1|1366997_1367282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049528945.1|1367780_1367990_+	DUF2767 family protein	NA	I6R0R9	Salmonella_phage	47.5	5.9e-06
WP_049525800.1|1368034_1368478_-	hypothetical protein	NA	M1FPN8	Enterobacteria_phage	50.4	4.3e-30
WP_049525803.1|1368495_1369341_-	hypothetical protein	NA	M1FPD4	Enterobacteria_phage	44.3	4.6e-57
WP_080347400.1|1369481_1370180_-	helix-turn-helix transcriptional regulator	NA	A0A2D1GM27	Escherichia_phage	63.9	2.6e-82
WP_049525807.1|1370338_1370569_+	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	47.1	5.0e-06
WP_049525808.1|1370684_1370978_+	hypothetical protein	NA	A2SY75	Escherichia_phage	62.9	1.2e-23
WP_049525811.1|1370987_1371524_+	hypothetical protein	NA	A0A291AXH9	Shigella_phage	53.6	1.2e-50
WP_049525571.1|1371770_1372673_+	replication protein	NA	C6ZR51	Salmonella_phage	56.0	2.2e-36
WP_049525813.1|1372672_1374010_+	AAA family ATPase	NA	A0A2I7REC3	Vibrio_phage	38.7	1.5e-81
WP_050128081.1|1374022_1374247_+	hypothetical protein	NA	A0A192Y6R5	Salmonella_phage	63.8	2.5e-18
WP_129019429.1|1374387_1374585_+	hypothetical protein	NA	K7PHN9	Enterobacterial_phage	61.9	9.2e-17
WP_049525572.1|1374581_1374884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050294067.1|1374880_1375279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050294069.1|1375275_1375515_+	DUF4752 family protein	NA	T1S9K2	Salmonella_phage	58.7	4.5e-18
WP_050294071.1|1375518_1375968_+	DUF1367 family protein	NA	A0A0P0ZFW0	Escherichia_phage	70.5	5.3e-60
WP_050294074.1|1376187_1376571_+	HNH endonuclease	NA	A0A2R2Z2X9	Escherichia_phage	75.2	8.5e-51
WP_050294075.1|1376710_1377040_+	DUF2591 family protein	NA	R9VYJ6	Serratia_phage	52.8	3.3e-19
WP_050294079.1|1377041_1377692_+	serine/threonine protein phosphatase	NA	Q716B9	Shigella_phage	61.1	8.5e-75
WP_050156987.1|1378146_1378782_+	hypothetical protein	NA	H6WRY9	Salmonella_phage	44.9	1.9e-42
WP_050156985.1|1378778_1378970_+	protein ninH	NA	Q777W6	Enterobacteria_phage	59.3	1.1e-09
WP_050156984.1|1378966_1379455_+	antiterminator	NA	M1FPN0	Enterobacteria_phage	67.9	2.4e-58
WP_050344746.1|1379758_1380292_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042570178.1|1380489_1380804_+|holin	holin	holin	NA	NA	NA	NA
WP_050294008.1|1380806_1381250_+	lysozyme	NA	R9TMH8	Aeromonas_phage	57.3	2.1e-40
WP_050294009.1|1381246_1381705_+|lysis	lysis protein	lysis	A5LH84	Enterobacteria_phage	46.4	2.1e-24
WP_050127912.1|1382230_1382758_+	KilA-N domain-containing protein	NA	A0A1V0E5P7	Salmonella_phage	55.4	3.0e-46
WP_050127911.1|1382754_1383138_+	hypothetical protein	NA	A0A192Y658	Salmonella_phage	41.6	5.6e-18
WP_050127910.1|1383213_1383453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050127908.1|1383576_1384212_+	hypothetical protein	NA	H9C189	Pectobacterium_phage	71.0	4.7e-86
WP_050127906.1|1384245_1384695_+	DUF2280 domain-containing protein	NA	I6S1P9	Salmonella_phage	72.9	5.1e-47
WP_050127904.1|1384704_1386192_+	hypothetical protein	NA	A0A1W6JNY3	Morganella_phage	76.5	7.0e-226
WP_050156791.1|1386266_1387604_+	DUF4055 domain-containing protein	NA	A0A0S2SYJ5	Pseudomonas_phage	43.7	7.5e-94
WP_050156790.1|1387722_1388475_+	hypothetical protein	NA	G8C7P6	Escherichia_phage	47.6	3.2e-57
WP_050127902.1|1388490_1389615_+|coat	P22 coat - protein 5 family protein	coat	W6EBZ8	Rhizobium_phage	56.7	9.1e-101
WP_154236072.1|1389665_1389836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050156786.1|1389835_1390228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050127901.1|1390230_1390869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050127899.1|1390870_1391674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050127897.1|1391690_1391885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050294010.1|1391945_1393499_+|tail	phage tail protein	tail	B3GAJ6	uncultured_virus	44.8	2.1e-95
WP_050127893.1|1393548_1393980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050127891.1|1394000_1394378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050127914.1|1394553_1395039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050127890.1|1395097_1395433_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_071890470.1|1395540_1395705_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_050294012.1|1396578_1397355_+	hypothetical protein	NA	A0A077SL47	Escherichia_phage	44.3	2.4e-39
WP_050127887.1|1397474_1397822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050127885.1|1397892_1400031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154236071.1|1400114_1400474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050294015.1|1400855_1401845_+	hypothetical protein	NA	S5MNM1	Brevibacillus_phage	35.0	1.3e-13
WP_050127882.1|1401847_1402963_+	type IV secretion protein Rhs	NA	NA	NA	NA	NA
WP_050127881.1|1402959_1403586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050127880.1|1403593_1403959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080357946.1|1404020_1405091_+|plate	baseplate protein	plate	B3GAJ9	uncultured_virus	40.4	2.6e-52
WP_050127878.1|1405091_1405754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129019401.1|1405826_1408001_+	hypothetical protein	NA	A9YX14	Burkholderia_phage	40.0	5.2e-52
WP_049525621.1|1407997_1408213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005158292.1|1409877_1410063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069009664.1|1410778_1411876_+	Fic family protein	NA	NA	NA	NA	NA
WP_080478647.1|1412316_1412883_-	potassium-transporting ATPase subunit A	NA	Q7M2A8	Enterobacteria_phage	44.8	9.4e-38
WP_080478635.1|1413112_1414510_-	hypothetical protein	NA	Q8LTT9	Enterobacteria_phage	47.4	4.8e-59
WP_049525217.1|1414809_1415133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164971237.1|1415125_1415278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049525216.1|1415291_1415492_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_005158310.1|1415706_1416039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005158312.1|1416399_1416765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020283429.1|1416989_1417637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005158316.1|1417621_1417960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049525882.1|1418453_1418684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049525883.1|1419086_1419569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038892054.1|1419675_1420056_+	DNA polymerase V	NA	K7P6F7	Enterobacteria_phage	68.0	6.9e-45
WP_049528964.1|1421206_1421896_-	heavy metal response regulator transcription factor	NA	W8CYM9	Bacillus_phage	34.7	8.8e-30
WP_049525886.1|1422131_1423181_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_023160836.1|1423340_1424360_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP016935	Yersinia enterocolitica strain YE7 chromosome, complete genome	4661129	1892896	1905559	4661129		Vaccinia_virus(16.67%)	8	NA	NA
WP_049526354.1|1892896_1896049_-	beta-galactosidase	NA	B9U1H7	Vaccinia_virus	62.9	0.0e+00
WP_005164513.1|1896227_1897262_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	50.3	1.4e-84
WP_002210893.1|1897743_1897956_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	80.0	2.0e-25
WP_071530598.1|1898164_1898401_+	protein DsrB	NA	NA	NA	NA	NA
WP_013649692.1|1898534_1900274_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.4	1.1e-09
WP_005177868.1|1901138_1901378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049526360.1|1901941_1902640_+	MgtC family protein	NA	G3MA03	Bacillus_virus	41.8	3.6e-15
WP_069009161.1|1902856_1905559_+	magnesium-translocating P-type ATPase	NA	M1HM40	Paramecium_bursaria_Chlorella_virus	25.2	9.4e-43
>prophage 6
NZ_CP016935	Yersinia enterocolitica strain YE7 chromosome, complete genome	4661129	2006158	2071782	4661129	holin,tail,lysis,transposase,tRNA	Salmonella_phage(17.65%)	60	NA	NA
WP_049526451.1|2006158_2006605_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	47.3	9.4e-33
WP_049526452.1|2006601_2007069_-|tail	phage tail protein	tail	F1BUP9	Erwinia_phage	56.6	1.3e-40
WP_069009185.1|2007170_2007587_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	40.6	8.8e-17
WP_013649751.1|2007599_2007995_-	M15 family metallopeptidase	NA	A9DET4	Yersinia_phage	71.0	5.9e-47
WP_013649752.1|2007981_2008161_-|holin	holin	holin	NA	NA	NA	NA
WP_071598556.1|2008154_2008457_-	hypothetical protein	NA	A0A077KEQ8	Ralstonia_phage	68.7	2.6e-26
WP_049526453.1|2009258_2010695_-|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	39.1	2.9e-83
WP_049526455.1|2011001_2012210_-	MFS transporter	NA	NA	NA	NA	NA
WP_069009186.1|2012312_2013230_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013649756.1|2013835_2014255_-	helix-turn-helix domain-containing protein	NA	A0A0M4REM4	Salmonella_phage	31.1	9.8e-16
WP_049526459.1|2014655_2015300_+	CatB-related O-acetyltransferase	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	31.3	8.0e-17
WP_005161392.1|2015442_2015625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049529016.1|2016049_2016466_+	antitermination protein Q	NA	K7PGW2	Enterobacterial_phage	63.0	8.1e-39
WP_005161372.1|2016642_2016819_-	GhoT/OrtT family toxin	NA	NA	NA	NA	NA
WP_005161370.1|2017045_2017222_+	hypothetical protein	NA	B6SD15	Bacteriophage	60.7	2.2e-14
WP_049526462.1|2017223_2017706_+	lysozyme	NA	A0A2H4JCH1	uncultured_Caudovirales_phage	63.1	2.7e-54
WP_049526464.1|2018078_2018963_+	triacylglycerol lipase	NA	NA	NA	NA	NA
WP_005161358.1|2019264_2019921_+	DUF533 domain-containing protein	NA	NA	NA	NA	NA
WP_013649759.1|2020027_2020912_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_049529017.1|2021046_2022213_+	class C beta-lactamase	NA	NA	NA	NA	NA
WP_049526465.1|2022359_2023451_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_005161346.1|2023718_2024177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049526468.1|2024231_2024825_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_005161340.1|2025156_2025429_+	stress-induced protein YchH	NA	NA	NA	NA	NA
WP_004390739.1|2025914_2026862_-	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	38.2	2.7e-45
WP_049526470.1|2027059_2027941_-	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_049526472.1|2027942_2028566_-	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_005161325.1|2028871_2030134_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_005161322.1|2030165_2031248_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	42.1	5.6e-07
WP_005161319.1|2031247_2032102_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_013649766.1|2032119_2032521_+	SirB2 family protein	NA	NA	NA	NA	NA
WP_049526475.1|2032517_2033327_+	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_049526477.1|2033471_2034326_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.3	2.2e-46
WP_049526479.1|2034399_2036100_-	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	24.3	4.0e-23
WP_005161308.1|2036655_2037774_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.4	1.5e-18
WP_049526481.1|2040761_2041499_+	phosphatase	NA	NA	NA	NA	NA
WP_005161295.1|2041562_2042123_+	molecular chaperone	NA	NA	NA	NA	NA
WP_005161292.1|2042160_2042724_-	lipoprotein	NA	NA	NA	NA	NA
WP_005161289.1|2042940_2044146_-	multidrug efflux MFS transporter MdtH	NA	NA	NA	NA	NA
WP_005161286.1|2044820_2045138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050293987.1|2045149_2045884_-	DUF4225 domain-containing protein	NA	NA	NA	NA	NA
WP_049526484.1|2046560_2047145_+	ribosomal protein S5-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_014608990.1|2047152_2047794_+	YceH family protein	NA	NA	NA	NA	NA
WP_112999213.1|2047804_2048746_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_049526486.1|2048884_2050420_+	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_005178667.1|2050739_2051849_-	sodium-potassium/proton antiporter ChaA	NA	NA	NA	NA	NA
WP_049526488.1|2052069_2052906_-	siderophore-interacting protein	NA	NA	NA	NA	NA
WP_049526492.1|2053094_2054261_-	MFS transporter	NA	NA	NA	NA	NA
WP_069017988.1|2054756_2055776_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_049526495.1|2057179_2058961_-	nitrate/nitrite two-component system sensor histidine kinase NarX	NA	NA	NA	NA	NA
WP_005178681.1|2059025_2059187_-	DUF2474 domain-containing protein	NA	NA	NA	NA	NA
WP_005161249.1|2059187_2060195_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_005161246.1|2060197_2061646_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_005161245.1|2061830_2063264_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_049526497.1|2063856_2065101_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	28.0	1.2e-24
WP_005161241.1|2065143_2066181_+	arginine N-succinyltransferase	NA	NA	NA	NA	NA
WP_049526499.1|2066177_2067659_+	succinylglutamate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_049526500.1|2067701_2069045_+	N-succinylarginine dihydrolase	NA	NA	NA	NA	NA
WP_005161236.1|2069109_2070102_+	succinylglutamate desuccinylase	NA	NA	NA	NA	NA
WP_023160836.1|2070762_2071782_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP016935	Yersinia enterocolitica strain YE7 chromosome, complete genome	4661129	2148388	2207853	4661129	protease,coat,tRNA,transposase	Bacillus_phage(28.57%)	55	NA	NA
WP_005164931.1|2148388_2148946_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_049526568.1|2148957_2149515_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_069009194.1|2149520_2150057_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_049526570.1|2150384_2151806_-	MFS transporter	NA	NA	NA	NA	NA
WP_069096391.1|2151933_2152854_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_049526574.1|2152866_2155497_-	PqiB family protein	NA	NA	NA	NA	NA
WP_049526576.1|2155465_2156713_-	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_013649820.1|2156953_2157451_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_005170218.1|2157546_2158275_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_005164944.1|2158294_2160370_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	35.4	4.3e-88
WP_005164945.1|2160666_2161548_+|protease	protease HtpX	protease	NA	NA	NA	NA
WP_049526580.1|2161582_2161708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005164950.1|2163425_2164592_+	oligogalacturonate lyase	NA	NA	NA	NA	NA
WP_005164952.1|2164778_2165570_+	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_005164953.1|2165845_2166697_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1W6DX33	Sphingobium_phage	29.5	4.3e-10
WP_005161706.1|2168387_2168936_-	metal-dependent hydrolase	NA	A0A127AVX7	Bacillus_phage	33.3	2.9e-07
WP_049526582.1|2169019_2169220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013649825.1|2169293_2169992_-	porin	NA	NA	NA	NA	NA
WP_049526584.1|2170301_2171594_-	carbohydrate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005161697.1|2171609_2172737_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.5	3.0e-11
WP_005161693.1|2172750_2173668_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_005161668.1|2173660_2174551_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_069009197.1|2174591_2176259_-	pectate lyase	NA	NA	NA	NA	NA
WP_069009678.1|2176586_2177348_-	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.9	4.5e-19
WP_013649826.1|2177459_2178296_-	5-dehydro-4-deoxy-D-glucuronate isomerase	NA	NA	NA	NA	NA
WP_005170147.1|2178533_2178866_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_049526590.1|2178970_2180173_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	71.0	5.8e-77
WP_005161643.1|2180282_2180948_-	hexitol phosphatase HxpB	NA	NA	NA	NA	NA
WP_005170142.1|2181197_2181752_+	yfeABCD regulator yfeE	NA	NA	NA	NA	NA
WP_049526592.1|2181960_2182851_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_049526593.1|2182847_2184329_-	succinate CoA transferase	NA	NA	NA	NA	NA
WP_005161631.1|2184354_2185140_-	methylmalonyl-CoA decarboxylase	NA	NA	NA	NA	NA
WP_013649829.1|2185153_2186149_-	methylmalonyl Co-A mutase-associated GTPase MeaB	NA	NA	NA	NA	NA
WP_049526595.1|2188563_2189433_-	fructosamine kinase family protein	NA	NA	NA	NA	NA
WP_049526597.1|2190064_2190940_-	iron/manganese ABC transporter permease subunit YfeD	NA	NA	NA	NA	NA
WP_049526599.1|2190936_2191821_-	iron/manganese ABC transporter permease subunit YfeC	NA	NA	NA	NA	NA
WP_049526600.1|2191820_2192711_-	iron/manganese ABC transporter ATP-binding protein YfeB	NA	W8CYL7	Bacillus_phage	29.7	7.7e-10
WP_049526602.1|2192707_2193676_-	iron/manganese ABC transporter substrate-binding protein YfeA	NA	NA	NA	NA	NA
WP_005161592.1|2193887_2194550_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_005161586.1|2194912_2195596_-	MarC family NAAT transporter	NA	NA	NA	NA	NA
WP_005161584.1|2196036_2196288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005161581.1|2196760_2196997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049526607.1|2197062_2197242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005161576.1|2197766_2198480_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_005161573.1|2198599_2198812_-	KTSC domain-containing protein	NA	A0A0K1LMB5	Caulobacter_phage	42.0	9.9e-09
WP_049526612.1|2199135_2201064_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.2	8.8e-128
WP_011816226.1|2201067_2201619_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.7	3.4e-16
WP_004713020.1|2201715_2201913_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_004393357.1|2201950_2202307_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_152414234.1|2202375_2202423_+	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_005161570.1|2202771_2203755_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	5.8e-35
WP_049526614.1|2203769_2206157_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	27.8	1.1e-07
WP_002211830.1|2206161_2206458_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	4.2e-13
WP_071828211.1|2206670_2206841_-	NINE protein	NA	M4ZS56	Bacillus_phage	62.5	1.0e-08
WP_049525161.1|2206821_2207853_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP016935	Yersinia enterocolitica strain YE7 chromosome, complete genome	4661129	2415103	2445806	4661129	lysis,terminase	Escherichia_phage(34.48%)	43	NA	NA
WP_049526752.1|2415103_2415829_-	hypothetical protein	NA	A0A0U2JGI7	Escherichia_phage	35.9	5.1e-28
WP_069018045.1|2415828_2417649_-	hypothetical protein	NA	A0A2R3UAN6	Myoviridae_environmental_samples	42.7	1.3e-19
WP_049526756.1|2417772_2418348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069009223.1|2418351_2418789_-	hypothetical protein	NA	A0A0U2S616	Escherichia_phage	39.6	2.0e-24
WP_049526761.1|2418792_2420187_-	hypothetical protein	NA	A0A0U2KD19	Escherichia_phage	36.4	2.6e-65
WP_049526763.1|2420191_2421133_-	hypothetical protein	NA	A0A0U2SH76	Escherichia_phage	37.3	1.3e-52
WP_049526765.1|2421116_2421551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049526766.1|2421547_2421976_-	hypothetical protein	NA	A0A0U2S646	Escherichia_phage	39.1	7.1e-22
WP_049526768.1|2421976_2422456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057619021.1|2422524_2423556_-	hypothetical protein	NA	A0A0U2QQI2	Escherichia_phage	46.6	5.1e-74
WP_057619022.1|2423572_2424439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069009681.1|2424454_2426056_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_049526771.1|2426090_2426912_-	hypothetical protein	NA	A0A0U2I1R8	Escherichia_phage	41.4	4.0e-53
WP_050293991.1|2426908_2428324_-	DUF1073 domain-containing protein	NA	A0A0U2S5X9	Escherichia_phage	37.3	1.4e-85
WP_049526775.1|2428336_2429659_-|terminase	terminase	terminase	A0A0U2JTW9	Escherichia_phage	59.7	4.9e-154
WP_049529053.1|2429660_2430383_-	hypothetical protein	NA	A0A1I9KFG9	Aeromonas_phage	29.3	2.6e-16
WP_049525819.1|2430528_2430990_-|lysis	lysis protein	lysis	A5LH84	Enterobacteria_phage	43.0	1.7e-21
WP_049526777.1|2430974_2431487_-	lysozyme	NA	I6PBN2	Cronobacter_phage	59.9	2.4e-48
WP_049528949.1|2431486_2431768_-	hypothetical protein	NA	H6WRZ3	Salmonella_phage	54.3	1.1e-18
WP_049525816.1|2431985_2432519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049525578.1|2432927_2433533_-	hypothetical protein	NA	Q8HA89	Salmonella_phage	40.7	1.4e-39
WP_049525577.1|2433529_2434138_-	protein ninG	NA	K7PHP1	Enterobacterial_phage	60.9	1.0e-53
WP_049525575.1|2434759_2435230_-	recombination protein NinB	NA	I6R9D0	Salmonella_phage	53.9	2.6e-41
WP_164971241.1|2435222_2435384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049525574.1|2435373_2435571_-	hypothetical protein	NA	A0A2H4FUS3	Salmonella_phage	42.2	5.1e-07
WP_049526787.1|2435570_2436065_-	DUF551 domain-containing protein	NA	E7C9P2	Salmonella_phage	32.5	4.5e-12
WP_069009034.1|2436061_2436364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129019429.1|2436360_2436558_-	hypothetical protein	NA	K7PHN9	Enterobacterial_phage	61.9	9.2e-17
WP_049526791.1|2436698_2437553_-	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	57.3	2.2e-86
WP_069009228.1|2437549_2438374_-	replication protein	NA	A0A075B8J2	Enterobacteria_phage	52.7	7.5e-36
WP_050156967.1|2438370_2438973_-	hypothetical protein	NA	M1F3E2	Salmonella_phage	42.1	5.5e-36
WP_049526795.1|2438997_2439291_-	hypothetical protein	NA	A2SY75	Escherichia_phage	62.9	1.4e-24
WP_049526797.1|2439405_2439624_-	helix-turn-helix transcriptional regulator	NA	I6S1U2	Salmonella_phage	62.7	3.7e-19
WP_049526799.1|2439730_2440396_+	LexA family transcriptional regulator	NA	A0A286S2B2	Klebsiella_phage	61.5	1.6e-73
WP_049526801.1|2440483_2441047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049526803.1|2441043_2441796_+	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
WP_049529057.1|2441851_2442061_-	DUF2767 family protein	NA	I6R0R9	Salmonella_phage	47.5	1.3e-05
WP_049525565.1|2442559_2442844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154236085.1|2442846_2443005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071828178.1|2443209_2443389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049525796.1|2443547_2443889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049525794.1|2444404_2444698_+	hypothetical protein	NA	A0A0B4SK56	Proteus_phage	31.3	7.6e-07
WP_050293951.1|2444786_2445806_+	hypothetical protein	NA	K7P6J9	Enterobacteria_phage	65.3	1.8e-31
>prophage 9
NZ_CP016935	Yersinia enterocolitica strain YE7 chromosome, complete genome	4661129	2564882	2641049	4661129	integrase,tail,transposase	Escherichia_phage(23.53%)	60	2612504:2612521	2641755:2641772
WP_069009268.1|2564882_2566319_+|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.8	4.9e-83
WP_049526892.1|2566454_2567243_-	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	73.8	1.2e-88
WP_032904241.1|2567296_2567500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005164388.1|2567771_2568479_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_049526894.1|2568694_2569162_-	poly-beta-1,6-N-acetyl-D-glucosamine biosynthesis protein PgaD	NA	NA	NA	NA	NA
WP_049526896.1|2569158_2570493_-	poly-beta-1,6 N-acetyl-D-glucosamine synthase	NA	NA	NA	NA	NA
WP_069009273.1|2575667_2576885_-	M24 family metallopeptidase	NA	NA	NA	NA	NA
WP_049526898.1|2576935_2577706_-	siderophore-iron reductase FhuF	NA	NA	NA	NA	NA
WP_005164398.1|2577863_2578490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049526901.1|2579560_2580430_-	SAM-dependent methyltransferase TehB	NA	NA	NA	NA	NA
WP_005164402.1|2580574_2580889_-	cytochrome c	NA	NA	NA	NA	NA
WP_069009280.1|2580888_2581377_-	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_049526903.1|2581366_2582080_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	31.7	1.4e-17
WP_005179185.1|2583229_2584522_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_049526908.1|2584524_2585928_-	DUF2318 domain-containing protein	NA	NA	NA	NA	NA
WP_004390794.1|2586063_2586591_-	iron transporter	NA	NA	NA	NA	NA
WP_014608895.1|2586671_2588609_-	FTR1 family iron permease	NA	NA	NA	NA	NA
WP_020283107.1|2588782_2589301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049526912.1|2591170_2592178_-	glutaminase A	NA	NA	NA	NA	NA
WP_023160703.1|2592743_2593523_-	hydroxypyruvate isomerase family protein	NA	NA	NA	NA	NA
WP_049526915.1|2593525_2594149_-	aldolase	NA	A0A077SK32	Escherichia_phage	77.7	2.0e-89
WP_069009288.1|2594145_2595408_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	60.3	1.5e-136
WP_005164436.1|2595930_2596710_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	63.9	1.7e-82
WP_005164439.1|2596954_2598631_+	two-component system sensor histidine kinase DcuS	NA	NA	NA	NA	NA
WP_005164442.1|2598623_2599343_+	two-component system response regulator DcuR	NA	NA	NA	NA	NA
WP_050156560.1|2599758_2601117_-	2-hydroxycarboxylate transporter family protein	NA	A0A140XAH4	Dickeya_phage	68.8	5.6e-28
WP_049526922.1|2602170_2603685_+	L-asparagine permease	NA	NA	NA	NA	NA
WP_005164450.1|2603833_2604187_-	DUF488 family protein	NA	NA	NA	NA	NA
WP_049526924.1|2604472_2605498_+	ROK family protein	NA	NA	NA	NA	NA
WP_049526926.1|2605734_2606907_+	MFS transporter	NA	NA	NA	NA	NA
WP_020283100.1|2607087_2607906_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_005177551.1|2608963_2610166_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	72.0	1.5e-77
WP_013649992.1|2610358_2610880_-	ricin-type beta-trefoil lectin domain protein	NA	NA	NA	NA	NA
WP_005166647.1|2611017_2611674_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
2612504:2612521	attL	TTTAAAAAATCATTACAA	NA	NA	NA	NA
WP_049526932.1|2612515_2613727_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	71.4	9.9e-77
WP_013649995.1|2614718_2616032_-	cytosine permease	NA	NA	NA	NA	NA
WP_005163571.1|2616235_2617000_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_005163578.1|2619134_2619587_+|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	63.2	2.7e-48
WP_020283095.1|2619583_2620726_+	phage late control D family protein	NA	A0A218M4J7	Erwinia_phage	67.9	6.5e-147
WP_005163580.1|2620818_2621040_+	DNA-binding transcriptional regulator	NA	Q37973	Salmonella_virus	67.6	4.3e-23
WP_005163581.1|2621124_2621940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164971242.1|2622180_2623251_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4S6G4	Salmonella_phage	58.6	1.7e-120
WP_005163587.1|2623577_2623919_-	YebY family protein	NA	NA	NA	NA	NA
WP_005163602.1|2624015_2624900_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_005170441.1|2624901_2625288_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_013650000.1|2625680_2626190_-	non-heme ferritin	NA	NA	NA	NA	NA
WP_004389928.1|2626573_2626807_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	58.8	1.7e-14
WP_020283091.1|2626856_2627813_-	prolyl aminopeptidase	NA	NA	NA	NA	NA
WP_013650001.1|2628322_2628985_+	exodeoxyribonuclease X	NA	A0A1W5PTR6	Pseudoalteromonas_phage	30.7	2.2e-17
WP_049526938.1|2628996_2631051_-	prolyl oligopeptidase family serine peptidase	NA	NA	NA	NA	NA
WP_049526939.1|2631240_2631597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005163608.1|2631702_2632011_-	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_005163610.1|2632050_2632371_-	YebG family protein	NA	NA	NA	NA	NA
WP_049526941.1|2632466_2633849_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	30.6	1.1e-52
WP_049526943.1|2634102_2635284_+	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_005163637.1|2635351_2635609_-	YoaH family protein	NA	NA	NA	NA	NA
WP_049526945.1|2635791_2637162_+	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	37.9	1.5e-36
WP_032904251.1|2637162_2637762_+	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_005163643.1|2638214_2639579_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_023160836.1|2640029_2641049_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
2641755:2641772	attR	TTGTAATGATTTTTTAAA	NA	NA	NA	NA
>prophage 10
NZ_CP016935	Yersinia enterocolitica strain YE7 chromosome, complete genome	4661129	3007580	3051638	4661129	protease,transposase	Shigella_phage(16.67%)	32	NA	NA
WP_049527252.1|3007580_3008783_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	72.0	1.5e-77
WP_013650139.1|3008850_3009501_-	DUF1120 domain-containing protein	NA	NA	NA	NA	NA
WP_023160793.1|3009879_3010191_+|transposase	IS3 family transposase	transposase	Q716C1	Shigella_phage	72.2	3.0e-30
WP_023160794.1|3010235_3010640_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	62.7	2.2e-36
WP_049527255.1|3012105_3013137_+	methyltransferase	NA	NA	NA	NA	NA
WP_069009350.1|3013447_3014182_-	carbonic anhydrase	NA	NA	NA	NA	NA
WP_049527261.1|3014457_3015894_-	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_049527265.1|3015997_3017524_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_049527267.1|3017689_3018430_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_049527270.1|3018521_3018893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164971243.1|3018979_3019147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013650148.1|3019199_3019529_-	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_049527272.1|3019529_3019844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013650150.1|3019954_3020434_-	antitermination protein Q	NA	K7PGW2	Enterobacterial_phage	59.2	1.4e-34
WP_005159354.1|3020707_3021331_+	helix-turn-helix domain-containing protein	NA	F1C599	Cronobacter_phage	53.2	1.6e-51
WP_005159352.1|3021677_3021920_+	DinI family protein	NA	K7PKM2	Enterobacterial_phage	70.9	5.1e-25
WP_049527276.1|3022084_3023020_+|protease	omptin family outer membrane protease	protease	NA	NA	NA	NA
WP_049527278.1|3023345_3025133_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	48.9	6.2e-11
WP_049527280.1|3025202_3026192_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_049527284.1|3026605_3028132_+	MFS transporter	NA	NA	NA	NA	NA
WP_005171542.1|3028311_3029454_+	D-alanyl-D-alanine- carboxypeptidase/endopeptidase AmpH	NA	NA	NA	NA	NA
WP_049527286.1|3029968_3031072_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	58.3	3.0e-112
WP_013650153.1|3033520_3034675_+	MFS transporter	NA	NA	NA	NA	NA
WP_013650154.1|3034697_3037391_+	phosphotransferase RcsD	NA	NA	NA	NA	NA
WP_005159308.1|3037393_3038041_+	transcriptional regulator RcsB	NA	NA	NA	NA	NA
WP_069009695.1|3038302_3041170_-	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	28.4	9.9e-43
WP_013650157.1|3041287_3043945_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	A0A172JHV7	Bacillus_phage	30.9	1.0e-102
WP_049527294.1|3044148_3044877_+	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
WP_013650159.1|3045393_3047679_+	ribonucleoside-diphosphate reductase subunit alpha	NA	I3UMG3	Colwellia_phage	65.1	9.3e-286
WP_005159298.1|3047764_3048895_+	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	79.4	4.0e-173
WP_020283002.1|3049539_3050046_+|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_158506293.1|3050132_3051638_-|protease	calcium-dependent protease	protease	NA	NA	NA	NA
>prophage 11
NZ_CP016935	Yersinia enterocolitica strain YE7 chromosome, complete genome	4661129	3673514	3738644	4661129	protease,integrase,tRNA,transposase	Bacillus_phage(13.33%)	57	3683171:3683224	3697212:3697265
WP_042663659.1|3673514_3674534_+|transposase	IS110-like element ISYen1 family transposase	transposase	NA	NA	NA	NA
WP_049527926.1|3674952_3676197_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	33.9	3.1e-17
WP_005166615.1|3676279_3676675_-	SgcJ/EcaC family oxidoreductase	NA	NA	NA	NA	NA
WP_049527931.1|3678011_3678212_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_049527934.1|3678354_3679557_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	72.0	1.5e-77
WP_049527936.1|3679633_3680062_-	type II toxin-antitoxin system MqsA family antitoxin	NA	NA	NA	NA	NA
WP_005166025.1|3680061_3680358_-	type II toxin-antitoxin system MqsR family toxin	NA	NA	NA	NA	NA
WP_005166026.1|3680514_3680877_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005166028.1|3680942_3681203_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A1S5NR91	Burkholderia_phage	36.0	2.5e-06
3683171:3683224	attL	TGGAGCGGGTGAAGGGAATCGAACCCTCGTATAGAGCTTGGGAAGCTCTCGTTC	NA	NA	NA	NA
WP_049527941.1|3683286_3684507_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_049527943.1|3684582_3684957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049527946.1|3684953_3685163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069009460.1|3686786_3687179_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045844230.1|3687259_3687448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084738254.1|3687587_3688640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049527955.1|3688689_3688962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049527956.1|3690195_3690438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049527959.1|3691080_3691404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049527961.1|3691765_3691966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049527964.1|3691992_3693516_-	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_154295071.1|3693536_3693689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069009462.1|3694809_3695070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049527969.1|3695073_3695304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049527972.1|3695920_3696469_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A141E0P1	Streptococcus_phage	34.4	1.2e-21
WP_013649344.1|3697455_3698973_-|tRNA	lysine--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	37.6	2.3e-86
3697212:3697265	attR	TGGAGCGGGTGAAGGGAATCGAACCCTCGTATAGAGCTTGGGAAGCTCTCGTTC	NA	NA	NA	NA
WP_020282590.1|3698982_3700081_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	5.4e-05
WP_005166036.1|3700526_3702260_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.7	1.6e-64
WP_013649342.1|3702266_3702983_-	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_005166040.1|3703031_3703931_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	30.2	2.1e-31
WP_005166042.1|3704037_3704556_+	flavodoxin FldB	NA	NA	NA	NA	NA
WP_049527976.1|3704614_3706036_-	cell envelope integrity protein CreD	NA	NA	NA	NA	NA
WP_049527980.1|3706127_3707555_-	two-component system sensor histidine kinase CreC	NA	NA	NA	NA	NA
WP_005166045.1|3707565_3708264_-	two-component system response regulator CreB	NA	NA	NA	NA	NA
WP_005166047.1|3708263_3708689_-	membrane protein	NA	NA	NA	NA	NA
WP_004390965.1|3708669_3708936_-	FAD assembly factor SdhE	NA	NA	NA	NA	NA
WP_049527983.1|3709202_3710195_+|tRNA	tRNA-modifying protein YgfZ	tRNA	NA	NA	NA	NA
WP_084738255.1|3710390_3711410_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_050155820.1|3711820_3712504_-	hemolysin III family protein	NA	NA	NA	NA	NA
WP_069009466.1|3712734_3713337_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_013649334.1|3713349_3714099_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.5	2.6e-27
WP_049527993.1|3714114_3714552_-	lipocalin-like domain-containing protein	NA	NA	NA	NA	NA
WP_049527996.1|3714885_3717774_-	aminomethyl-transferring glycine dehydrogenase	NA	M4QFZ1	Prochlorococcus_phage	52.7	4.2e-267
WP_005164125.1|3717873_3718260_-	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_013649331.1|3718326_3719424_-	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_023160249.1|3719816_3721031_-	FAD-dependent 2-octaprenylphenol hydroxylase	NA	NA	NA	NA	NA
WP_050126799.1|3721118_3722288_-	2-octaprenyl-6-methoxyphenyl hydroxylase	NA	NA	NA	NA	NA
WP_069009468.1|3722291_3723605_-	Xaa-Pro aminopeptidase	NA	NA	NA	NA	NA
WP_005164114.1|3723659_3724238_-	YecA family protein	NA	NA	NA	NA	NA
WP_004706812.1|3724693_3725023_+	cell division protein ZapA	NA	NA	NA	NA	NA
WP_005164106.1|3725526_3726123_+	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_005164105.1|3726268_3727564_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	58.0	2.2e-130
WP_013649329.1|3727643_3729281_-	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.7	1.6e-154
WP_013649328.1|3729492_3730329_-	nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_005164102.1|3730616_3732851_-	GTP diphosphokinase	NA	NA	NA	NA	NA
WP_049528014.1|3732860_3734192_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	27.4	5.1e-34
WP_049528017.1|3734248_3737113_+	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	29.2	2.7e-48
WP_013649325.1|3737207_3738644_-|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	31.0	5.0e-27
>prophage 1
NZ_CP016934	Yersinia enterocolitica strain YE7 plasmid unnamed1, complete sequence	100790	27877	80683	100790	integrase,transposase	Moraxella_phage(25.0%)	38	23262:23277	85340:85355
23262:23277	attL	TATAGGCCAATAAATC	NA	NA	NA	NA
WP_071891480.1|27877_29083_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_129019442.1|29578_31012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050127659.1|31166_31442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050156614.1|31541_31895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012291420.1|32005_32326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050127661.1|32537_32855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050156626.1|32859_33726_+	DsbC family protein	NA	NA	NA	NA	NA
WP_050127662.1|33779_34148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050127663.1|34447_35098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012291411.1|35099_35888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069009838.1|35887_37135_+	conjugal transfer protein TraB	NA	NA	NA	NA	NA
WP_050127664.1|37158_37665_+	TraV family lipoprotein	NA	NA	NA	NA	NA
WP_080357812.1|40238_42284_+	conjugal transfer protein TraN	NA	NA	NA	NA	NA
WP_164971252.1|42297_44040_+	conjugal transfer protein TraN	NA	NA	NA	NA	NA
WP_050127668.1|44193_45777_+	conjugal transfer protein TraU	NA	NA	NA	NA	NA
WP_050127685.1|45908_46496_+	conjugal transfer protein TrbC	NA	NA	NA	NA	NA
WP_069009780.1|46495_46960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050156618.1|46991_47390_+	PEGA domain-containing protein	NA	NA	NA	NA	NA
WP_102778917.1|47474_48263_+	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_069009775.1|48272_49649_+	pilus assembly protein	NA	NA	NA	NA	NA
WP_069017905.1|49645_53530_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_050156624.1|54016_54934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129019443.1|55034_55808_+|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	81.4	6.1e-48
WP_050127681.1|55991_56630_+	recombinase family protein	NA	NA	NA	NA	NA
WP_057618893.1|57266_59213_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_164971253.1|59458_61156_+	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	A0A0R6PI85	Moraxella_phage	28.3	9.7e-38
WP_050127682.1|61192_61912_+	filamentous hemagglutinin N-terminal domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	43.7	2.5e-35
WP_071891490.1|64081_64456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069009764.1|64654_65302_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.0	7.3e-10
WP_050128091.1|65582_66218_+	ParA family protein	NA	NA	NA	NA	NA
WP_050128092.1|66280_66574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129019436.1|68027_68724_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	1.9e-40
WP_050128033.1|68738_68981_-|transposase	IS3 family transposase	transposase	Q716C1	Shigella_phage	64.7	3.3e-16
WP_069017906.1|69237_74088_+	hypothetical protein	NA	A0A1W5K0N1	Bacteriophage	33.8	2.1e-178
WP_069096386.1|74310_76377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129028057.1|76409_77033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164971249.1|78997_79534_+	CaiF/GrlA family transcriptional regulator	NA	NA	NA	NA	NA
WP_129019437.1|79985_80683_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	5.5e-40
85340:85355	attR	TATAGGCCAATAAATC	NA	NA	NA	NA
>prophage 1
NZ_CP016936	Yersinia enterocolitica strain YE7 plasmid unnamed2, complete sequence	88902	13931	21713	88902	transposase	uncultured_Caudovirales_phage(57.14%)	9	NA	NA
WP_050294042.1|13931_15350_+	trimeric autotransporter adhesin YadA	NA	Q9MCI8	Enterobacteria_phage	55.6	2.6e-12
WP_013749484.1|15419_16295_+	DMT family transporter	NA	NA	NA	NA	NA
WP_010891241.1|16616_17069_-	PprA	NA	NA	NA	NA	NA
WP_071890451.1|17224_18061_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.5	4.2e-18
WP_050294040.1|18236_18818_+	recombinase family protein	NA	A0A219YA40	Aeromonas_phage	35.5	3.3e-22
WP_010891244.1|18835_19261_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	5.6e-51
WP_057618950.1|19273_20563_-	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	70.4	7.1e-166
WP_013749489.1|20608_20929_-	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	46.7	1.7e-20
WP_050294038.1|21014_21713_+	arsenic resistance NADPH-dependent reductase ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	68.1	4.2e-88
