The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP016888	Mycobacterium tuberculosis strain SCAID 252.0 chromosome, complete genome	4439387	1661031	1668146	4439387	transposase	Burkholderia_virus(50.0%)	8	NA	NA
WP_153302707.1|1661031_1661526_-|transposase	transposase	transposase	Q8W6R2	Burkholderia_virus	62.9	9.4e-34
WP_068986957.1|1661335_1661923_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	57.0	4.2e-41
WP_079121477.1|1661968_1662823_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	57.0	8.0e-41
WP_003905583.1|1662821_1664798_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	33.2	3.8e-86
WP_003900345.1|1664841_1665216_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_003407501.1|1665231_1665603_+	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	37.6	8.4e-11
WP_003898888.1|1665624_1666482_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_003407507.1|1666517_1668146_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	25.3	1.4e-33
>prophage 2
NZ_CP016888	Mycobacterium tuberculosis strain SCAID 252.0 chromosome, complete genome	4439387	2939188	2974557	4439387	capsid,head,integrase,terminase,transposase,tRNA,protease	Tupanvirus(11.11%)	42	2967989:2968016	2978974:2979001
WP_003413486.1|2939188_2941267_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	34.9	2.5e-104
WP_003413487.1|2941375_2941603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031659639.1|2941599_2942985_-	PE family protein	NA	NA	NA	NA	NA
WP_003413569.1|2943329_2943830_+	DUF1990 family protein	NA	NA	NA	NA	NA
WP_003413574.1|2943846_2944287_-	DoxX family membrane protein	NA	NA	NA	NA	NA
WP_003901437.1|2944433_2945111_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_003413583.1|2945095_2945449_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003413586.1|2945461_2945887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003901438.1|2945883_2946558_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003413589.1|2946635_2947457_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003413592.1|2947592_2948486_+	universal stress protein	NA	NA	NA	NA	NA
WP_003413594.1|2948488_2949307_-	universal stress protein	NA	NA	NA	NA	NA
WP_003899401.1|2949321_2950503_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003413598.1|2950561_2950993_-	CBS domain-containing protein	NA	A0A2I6B2H4	Macacine_betaherpesvirus	100.0	1.9e-75
WP_003899402.1|2951506_2952748_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003899403.1|2953057_2953420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003902322.1|2953766_2954891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413614.1|2954892_2955432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413616.1|2955571_2956870_+	RNA-splicing ligase RtcB	NA	A2RQD0	Archaeal_BJ1_virus	43.3	3.8e-90
WP_003413619.1|2956908_2957190_-	DUF1876 domain-containing protein	NA	NA	NA	NA	NA
WP_003413625.1|2957334_2957820_-	hemerythrin domain-containing protein	NA	NA	NA	NA	NA
WP_003902325.1|2957846_2958104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009938544.1|2958104_2960441_-	PE family protein	NA	NA	NA	NA	NA
WP_003899405.1|2960469_2960712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899406.1|2960712_2961390_+	membrane protein	NA	NA	NA	NA	NA
WP_003413654.1|2961585_2962242_+	DedA family protein	NA	NA	NA	NA	NA
WP_003910926.1|2962404_2962851_+	anti-sigma factor antagonist	NA	NA	NA	NA	NA
WP_003413663.1|2963025_2963358_-	YnfA family protein	NA	NA	NA	NA	NA
WP_003413665.1|2963477_2963837_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413675.1|2963938_2964397_+	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_003899407.1|2964532_2964913_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413686.1|2964909_2966406_+	ACR3 family arsenite efflux transporter	NA	A0A2H4PQT9	Staphylococcus_phage	39.7	5.1e-14
WP_085972563.1|2966595_2966832_+	antitoxin MazE family protein	NA	NA	NA	NA	NA
WP_077365235.1|2966904_2967078_+	hypothetical protein	NA	NA	NA	NA	NA
2967989:2968016	attL	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
WP_003899409.1|2968122_2968554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003900538.1|2968550_2969549_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D1G8E2	Mycobacterium_phage	47.8	7.4e-62
WP_003900539.1|2969562_2970027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087902221.1|2970159_2971420_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_068986962.1|2971447_2971636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003901443.1|2971797_2973237_-|capsid	phage major capsid protein	capsid	A0A1B3AYS4	Gordonia_phage	40.6	1.4e-66
WP_003899412.1|2973244_2973778_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	32.9	3.1e-06
WP_003899413.1|2973930_2974557_-|terminase	phage terminase small subunit P27 family	terminase	V9H0V4	Actinophage	47.2	1.6e-17
2978974:2979001	attR	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
>prophage 3
NZ_CP016888	Mycobacterium tuberculosis strain SCAID 252.0 chromosome, complete genome	4439387	3712922	3802722	4439387	tRNA,transposase	Burkholderia_virus(28.57%)	55	NA	NA
WP_087902221.1|3712922_3714184_-|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_009937401.1|3714477_3714639_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_003902445.1|3714660_3716190_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_003417413.1|3716122_3717061_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_003902446.1|3717069_3718437_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	25.8	9.0e-18
WP_003417415.1|3718505_3719723_+	D-alanyl-D-alanine carboxypeptidase	NA	A0A1P8VVG5	Erythrobacter_phage	27.3	8.0e-10
WP_003417416.1|3719818_3721327_+	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_003417418.1|3721323_3722475_+	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_003417421.1|3722665_3723511_-	DUF732 domain-containing protein	NA	NA	NA	NA	NA
WP_003900026.1|3723985_3724426_+	heavy metal-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_003417435.1|3724459_3725329_-	inner membrane protein YhjD	NA	NA	NA	NA	NA
WP_003417440.1|3725349_3726360_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_009940431.1|3726644_3727277_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_003417452.1|3727343_3728573_-	NADP-dependent isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_003900028.1|3728855_3730205_+	bifunctional o-acetylhomoserine/o-acetylserine sulfhydrylase	NA	A0A0B5JD48	Pandoravirus	26.5	2.5e-12
WP_003417458.1|3730216_3731356_+	homoserine O-acetyltransferase	NA	NA	NA	NA	NA
WP_003417461.1|3731352_3732084_+	methyltransferase	NA	NA	NA	NA	NA
WP_031648820.1|3743179_3749119_-	PE family protein	NA	NA	NA	NA	NA
WP_003417619.1|3749548_3749806_-	DUF3017 domain-containing protein	NA	NA	NA	NA	NA
WP_003901612.1|3750061_3759535_-	PPE family protein	NA	NA	NA	NA	NA
WP_049961743.1|3760160_3760607_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016810328.1|3760643_3761462_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_009938650.1|3761678_3761966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003417738.1|3773695_3774490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003417739.1|3774571_3774943_-	FAD-binding oxidoreductase	NA	A0A0B5JBT9	Pandoravirus	56.4	3.3e-15
WP_071854233.1|3774840_3775251_-	FAD-binding protein	NA	NA	NA	NA	NA
WP_003417741.1|3775085_3775346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003417745.1|3775460_3775850_+	DUF732 domain-containing protein	NA	NA	NA	NA	NA
WP_003417749.1|3775863_3776157_-	DUF3017 domain-containing protein	NA	NA	NA	NA	NA
WP_003417751.1|3776153_3776999_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	NA	NA	NA	NA
WP_003417757.1|3777122_3777398_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_003417760.1|3777394_3777652_+	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_003900033.1|3777693_3778884_+	NADH:flavin oxidoreductase	NA	NA	NA	NA	NA
WP_003417765.1|3779000_3779369_+	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_003417767.1|3779365_3779917_-	pentapeptide repeat protein MfpA	NA	NA	NA	NA	NA
WP_003417769.1|3779923_3780505_-	ATP/GTP-binding protein	NA	NA	NA	NA	NA
WP_003417772.1|3780485_3780854_-	DUF742 domain-containing protein	NA	NA	NA	NA	NA
WP_003417776.1|3780831_3781224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003901616.1|3781220_3783851_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_003901617.1|3784086_3784551_+|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
WP_009938654.1|3784917_3786693_+	PE family protein	NA	NA	NA	NA	NA
WP_003417881.1|3786693_3787338_-	nitroreductase family protein	NA	NA	NA	NA	NA
WP_003417882.1|3787336_3787771_+	TIGR03667 family PPOX class F420-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003908228.1|3787859_3791099_-	error-prone DNA polymerase	NA	A0A1C9LWS4	Streptomyces_phage	32.4	1.6e-118
WP_003900036.1|3791290_3792631_+	wax ester/triacylglycerol synthase family O-acyltransferase	NA	NA	NA	NA	NA
WP_003417892.1|3792672_3793848_+	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_003417895.1|3793901_3794006_+	PE family protein	NA	NA	NA	NA	NA
WP_003900037.1|3794084_3794726_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_003417897.1|3794726_3794975_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_003417900.1|3794979_3796407_+	amidase	NA	NA	NA	NA	NA
WP_003417903.1|3796514_3797168_+	HAD family phosphatase	NA	NA	NA	NA	NA
WP_003417905.1|3797206_3798712_-	type B diterpene cyclase	NA	NA	NA	NA	NA
WP_003417908.1|3798716_3799607_-	diterpene synthase	NA	NA	NA	NA	NA
WP_078750126.1|3799615_3801409_-	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_144061628.1|3801460_3802722_-|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
