The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP015822	Klebsiella pneumoniae isolate blood sample 2 chromosome, complete genome	5452045	1885	11349	5452045	tRNA,protease	Dickeya_phage(16.67%)	8	NA	NA
WP_002896440.1|1885_3001_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
WP_004150848.1|2997_4938_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896516.1|5014_5236_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_002896520.1|5561_5879_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896522.1|5909_8189_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_001040187.1|8309_8528_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002898014.1|8881_9583_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_004150847.1|9627_11349_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
>prophage 2
NZ_CP015822	Klebsiella pneumoniae isolate blood sample 2 chromosome, complete genome	5452045	377420	548662	5452045	terminase,transposase,tail,holin,plate,integrase,protease	Klebsiella_phage(22.94%)	196	438357:438416	544566:545770
WP_002901758.1|377420_378467_+|protease	protease SohB	protease	NA	NA	NA	NA
WP_002901761.1|378514_378766_-	YciN family protein	NA	NA	NA	NA	NA
WP_002901763.1|379172_381770_+	type I DNA topoisomerase	NA	A0A2K9L5F8	Tupanvirus	35.6	2.9e-89
WP_002901772.1|382115_383090_+	HTH-type transcriptional regulator CysB	NA	NA	NA	NA	NA
WP_002901776.1|383335_383503_+	YmiA family putative membrane protein	NA	NA	NA	NA	NA
WP_002901777.1|383891_386564_+	aconitate hydratase AcnA	NA	NA	NA	NA	NA
WP_002901778.1|386610_387213_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	49.5	1.2e-43
WP_002901779.1|387376_388144_+	phosphatidylglycerophosphatase B	NA	NA	NA	NA	NA
WP_002901780.1|388279_388588_+	LapA family protein	NA	NA	NA	NA	NA
WP_002901781.1|388594_389764_+	lipopolysaccharide assembly protein LapB	NA	NA	NA	NA	NA
WP_004151907.1|389955_390693_+	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_002901782.1|390692_391019_+	stress response translation initiation inhibitor YciH	NA	NA	NA	NA	NA
WP_002901783.1|391150_391369_-	osmotically-inducible lipoprotein OsmB	NA	NA	NA	NA	NA
WP_002901785.1|391644_392394_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_002901786.1|392465_392645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002901787.1|392803_394738_-	exoribonuclease II	NA	A0A2H4UVB7	Bodo_saltans_virus	24.6	7.0e-08
WP_004151905.1|394819_395977_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_004140277.1|396167_396956_-	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_004152967.1|397154_397697_-	HutD family protein	NA	NA	NA	NA	NA
WP_004151902.1|397944_399324_+	cytosine permease	NA	NA	NA	NA	NA
WP_004140269.1|399368_400178_-	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	2.1e-14
WP_004140266.1|400179_401172_-	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	27.2	3.0e-07
WP_004151901.1|401171_402062_-	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
WP_004151900.1|402208_403426_+|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	51.9	8.6e-121
WP_004151899.1|403633_404296_-	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	84.6	2.7e-105
WP_004151898.1|404292_404721_-	hypothetical protein	NA	M9NYX4	Enterobacteria_phage	80.3	7.5e-64
WP_004201102.1|404717_405398_-	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	91.2	8.2e-121
WP_088224434.1|405399_405687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004201103.1|405683_406529_-	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	1.8e-69
WP_004201105.1|406544_406829_-	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	79.8	1.1e-39
WP_004135674.1|406917_407112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004219883.1|407104_407230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004201108.1|407540_407744_+	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	71.6	3.9e-18
WP_004201109.1|407825_408902_-	ParA family protein	NA	H2BD62	Pseudomonas_phage	37.9	9.1e-58
WP_004201113.1|409189_409888_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	84.1	3.7e-108
WP_004201115.1|409999_410227_+	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	77.1	1.4e-24
WP_001548453.1|410267_410489_+	hypothetical protein	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
WP_004201117.1|410574_411435_+	replication protein	NA	K7PGT1	Enterobacteria_phage	53.3	1.0e-59
WP_004201118.1|411431_412280_+	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	60.1	5.1e-88
WP_004218528.1|412276_412579_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004196831.1|412634_412880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004218530.1|413087_414116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004243011.1|414225_414504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004218531.1|414636_415104_+	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	45.8	3.4e-33
WP_004243010.1|415084_415252_+	NinE family protein	NA	K7P7K0	Enterobacteria_phage	62.5	4.6e-09
WP_004218532.1|415248_415917_+	metallophosphoesterase	NA	K7P6H8	Enterobacteria_phage	78.7	1.4e-104
WP_004218533.1|415909_416548_+	recombination protein NinG	NA	H6WRY9	Salmonella_phage	69.8	3.2e-74
WP_004218534.1|416544_416685_+	YlcG family protein	NA	NA	NA	NA	NA
WP_004232548.1|416684_417374_+	antiterminator-like protein	NA	I6PDF8	Cronobacter_phage	53.1	2.1e-55
WP_022644626.1|417599_418646_+|transposase	IS481-like element ISKpn28 family transposase	transposase	A0A0M3LR35	Mannheimia_phage	21.9	1.3e-05
WP_024940884.1|419124_419424_+|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	100.0	4.5e-47
WP_004218565.1|419420_419960_+	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	98.9	3.3e-101
WP_004190674.1|419956_420301_+	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	80.7	2.0e-38
WP_004190672.1|420297_420573_+	hypothetical protein	NA	A0A286N2Q8	Klebsiella_phage	72.5	2.2e-08
WP_004218558.1|421531_421777_+	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	96.3	4.6e-34
WP_004218556.1|422639_423644_+|terminase	terminase small subunit	terminase	Q5QF76	Pseudomonas_virus	45.5	1.5e-38
WP_004190663.1|423621_424929_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	58.9	3.6e-149
WP_004218551.1|424928_426329_+	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	53.5	1.1e-127
WP_019405022.1|426312_427425_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	55.1	5.6e-111
WP_004227000.1|427665_427842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004217351.1|427955_428741_+	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	63.9	1.0e-66
WP_004190653.1|428751_429705_+	Ig domain-containing protein	NA	A0A1B0VMF8	Pseudomonas_phage	74.4	5.0e-132
WP_142689607.1|429713_429986_+	Ig-like domain-containing protein	NA	NA	NA	NA	NA
WP_004217348.1|430026_430422_+	hypothetical protein	NA	A0A1B1P9F2	Acinetobacter_phage	38.5	4.3e-13
WP_004217346.1|430423_430678_+	hypothetical protein	NA	J9Q7U0	Salmonella_phage	52.4	1.0e-20
WP_004190646.1|430687_430921_+	hypothetical protein	NA	A0A2H4J0Y9	uncultured_Caudovirales_phage	47.1	5.8e-10
WP_004217344.1|430907_431291_+	hypothetical protein	NA	A0A0S2SYG4	Pseudomonas_phage	45.2	7.1e-21
WP_004217343.1|431292_431844_+	hypothetical protein	NA	G8C7Q1	Escherichia_phage	39.9	1.3e-28
WP_004190640.1|431840_432233_+	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
WP_004217341.1|432256_433429_+	Ig domain-containing protein	NA	A0A0D4DBN5	Acinetobacter_phage	27.0	1.2e-23
WP_004226994.1|433482_433965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016831940.1|434102_434309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004217333.1|434385_434742_+	hypothetical protein	NA	A0A1V0E5P9	Salmonella_phage	75.0	1.1e-44
WP_099119318.1|434966_435158_+	hypothetical protein	NA	S4TR42	Salmonella_phage	78.3	7.8e-05
WP_004217331.1|435419_438317_+|tail	phage tail length tape measure family protein	tail	A0A2H4J107	uncultured_Caudovirales_phage	32.7	1.6e-104
438357:438416	attL	TCTAAGGAAGGTGCGAACAAGTTCCTGATATGAGATCATCATATTCATCCGGAGCGCATC	NA	NA	NA	NA
WP_000019473.1|438429_439410_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_004152648.1|439600_439936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152649.1|440250_440715_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	67.8	6.7e-58
WP_004152650.1|440895_441378_+	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	94.4	1.7e-80
WP_004152651.1|441387_441768_+	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	99.2	1.8e-72
WP_004152652.1|441764_444833_+	hypothetical protein	NA	A0A286S259	Klebsiella_phage	97.5	0.0e+00
WP_024940942.1|447129_447864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152700.1|447867_448599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152702.1|448823_449423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152703.1|449664_451608_-	hypothetical protein	NA	A0A286S1P0	Klebsiella_phage	69.8	1.1e-37
WP_001067855.1|451856_452561_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001261740.1|453556_454348_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_000679427.1|454511_454859_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|454852_455692_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000376623.1|455819_456320_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001389365.1|456826_457591_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001067855.1|457767_458472_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004178082.1|460381_461869_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_002901812.1|461948_462368_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	57.5	1.4e-35
WP_002901813.1|462369_463635_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	82.7	9.6e-208
WP_071531199.1|463710_464538_-	FRG domain-containing protein	NA	A0A1S6KZX9	Salmonella_phage	30.2	8.4e-19
WP_002901815.1|464724_465396_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.6	4.5e-79
WP_002901816.1|465600_466566_-	peptide ABC transporter permease SapB	NA	NA	NA	NA	NA
WP_002901817.1|466562_468206_-	peptide ABC transporter substrate-binding protein SapA	NA	NA	NA	NA	NA
WP_004231410.1|468539_469448_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_004171423.1|469555_470386_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004152126.1|470364_472674_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002901900.1|472845_474015_+	amidohydrolase	NA	NA	NA	NA	NA
WP_002901901.1|474040_475432_+	MFS transporter	NA	NA	NA	NA	NA
WP_004148137.1|475422_476412_-	phage shock protein operon transcriptional activator	NA	NA	NA	NA	NA
WP_002901908.1|476564_477233_+	phage shock protein PspA	NA	NA	NA	NA	NA
WP_002901911.1|477288_477513_+	envelope stress response membrane protein PspB	NA	NA	NA	NA	NA
WP_002901913.1|477512_477872_+	envelope stress response membrane protein PspC	NA	NA	NA	NA	NA
WP_002901915.1|477900_478119_+	phage shock protein PspD	NA	NA	NA	NA	NA
WP_002901917.1|478221_479619_+	YcjX family protein	NA	NA	NA	NA	NA
WP_004152127.1|479615_480677_+	TIGR01620 family protein	NA	NA	NA	NA	NA
WP_071531198.1|480766_481648_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002901977.1|481779_483093_+	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_002901979.1|483265_484807_+	transcriptional regulator TyrR	NA	NA	NA	NA	NA
WP_004152128.1|484908_485961_+	AbrB family transcriptional regulator	NA	NA	NA	NA	NA
WP_004152131.1|486031_486538_-	thiol peroxidase	NA	NA	NA	NA	NA
WP_004152133.1|486640_487606_+	L-Ala-D/L-Glu epimerase	NA	NA	NA	NA	NA
WP_004152134.1|487602_488310_-	murein tripeptide amidase MpaA	NA	NA	NA	NA	NA
WP_004148146.1|488382_488499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152135.1|488495_490112_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004152136.1|490279_490666_-	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_004152137.1|490896_491730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152138.1|491854_492739_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004152139.1|492911_494048_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_004218007.1|494120_495323_+	MFS transporter	NA	NA	NA	NA	NA
WP_004152141.1|495401_496271_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.1	5.7e-50
WP_004176439.1|496817_497006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152143.1|497306_498221_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004152144.1|498329_499091_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	2.4e-20
WP_004152145.1|499307_500840_+	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	30.0	1.1e-21
WP_016197745.1|501038_501587_-	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_004152147.1|501783_502965_+|integrase	site-specific integrase	integrase	A0A0M4QX09	Salmonella_phage	84.2	5.6e-202
WP_004152148.1|502945_503188_-	hypothetical protein	NA	A0A0M4RTZ2	Salmonella_phage	73.8	2.2e-20
WP_004198245.1|503147_503294_-	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	70.8	2.9e-15
WP_014343018.1|503366_503600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152150.1|503842_504055_-	hypothetical protein	NA	A0A286S2B6	Klebsiella_phage	98.6	3.4e-33
WP_004152151.1|504051_504276_-	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	89.2	3.1e-29
WP_004154298.1|504265_504976_-	Rha family transcriptional regulator	NA	A0A286S260	Klebsiella_phage	88.3	2.1e-111
WP_004152153.1|504981_505500_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	98.8	1.7e-94
WP_004152154.1|505604_506432_-	hypothetical protein	NA	Q8W654	Enterobacteria_phage	84.0	5.5e-111
WP_004152155.1|506428_506623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152156.1|506619_507045_-	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	77.9	3.5e-53
WP_004177208.1|507041_507260_-	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	98.6	6.6e-32
WP_004152157.1|507231_507486_-	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	97.6	3.1e-41
WP_004152158.1|507478_507844_-	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	99.2	6.9e-58
WP_004152159.1|508013_508202_-	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	100.0	4.6e-26
WP_004152160.1|508194_508509_-	hypothetical protein	NA	A0A286S1T9	Klebsiella_phage	100.0	1.0e-49
WP_004152161.1|508679_509348_-	LexA family transcriptional regulator	NA	A0A286S2B2	Klebsiella_phage	99.5	2.4e-125
WP_004152162.1|509445_509667_+	helix-turn-helix transcriptional regulator	NA	A0A286S2C1	Klebsiella_phage	100.0	3.0e-32
WP_004198228.1|510243_511902_+	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	96.0	0.0e+00
WP_004198233.1|511903_512866_+	toprim domain-containing protein	NA	A0A286N2Q0	Klebsiella_phage	99.4	4.8e-183
WP_004198239.1|512862_513339_+	hypothetical protein	NA	A0A286N2Q1	Klebsiella_phage	100.0	1.8e-90
WP_004152167.1|513335_514118_+	antitermination protein	NA	F1C595	Cronobacter_phage	76.8	7.2e-113
WP_004146526.1|514523_514772_+|holin	class II holin family protein	holin	NA	NA	NA	NA
WP_004152169.1|514774_515305_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	77.1	2.7e-79
WP_004153952.1|515301_515691_+	lipase chaperone	NA	A0A192Y6H8	Salmonella_phage	49.2	9.4e-21
WP_004152170.1|515925_516246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004218030.1|516611_517100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152172.1|517050_518451_+|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.0	9.4e-188
WP_004152173.1|518688_520140_+	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	68.8	3.8e-192
WP_004152174.1|520195_520744_+	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.3	3.0e-49
WP_004199270.1|520795_521998_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	54.1	2.6e-106
WP_000528476.1|522001_522496_+	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.7	4.2e-50
WP_001132269.1|522507_523449_+	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.1	1.7e-137
WP_000725700.1|523488_523770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000113538.1|523738_524158_+	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	60.7	3.3e-40
WP_000834982.1|524154_524661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001116156.1|524660_525047_+	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	78.2	1.1e-48
WP_004152176.1|525141_525582_+	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.7	1.6e-40
WP_004152177.1|525585_526731_+	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	76.9	6.3e-166
WP_004152178.1|526741_527032_+	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	85.5	2.6e-23
WP_085955245.1|526972_528165_-|transposase	IS3-like element ISKpn18 family transposase	transposase	U5P429	Shigella_phage	43.5	3.5e-50
WP_004152564.1|528491_528917_+	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	63.4	2.6e-40
WP_004152565.1|528952_529105_+	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	88.0	7.6e-19
WP_004152566.1|529094_531098_+	lytic transglycosylase domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	63.6	1.2e-247
WP_004152567.1|531097_531697_+	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	57.6	9.9e-54
WP_004217362.1|531772_532000_+	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	56.0	4.6e-20
WP_004152569.1|532002_533025_+	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	54.2	9.2e-100
WP_004152570.1|533024_533366_+	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	46.6	1.8e-23
WP_004199301.1|533415_533598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152571.1|533640_534207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152572.1|534260_534914_+	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	63.5	1.0e-59
WP_004152573.1|534915_535269_+	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	80.3	2.3e-50
WP_004152574.1|535268_536465_+|plate	baseplate J/gp47 family protein	plate	A0A0M4RD32	Salmonella_phage	72.9	3.9e-158
WP_004152575.1|536461_537235_+	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	54.4	2.8e-77
WP_004152576.1|537234_538101_+	hypothetical protein	NA	A0A2H4IYR0	uncultured_Caudovirales_phage	64.5	1.9e-34
WP_004152577.1|538100_538298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004218487.1|540648_541377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002902128.1|541387_542119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002902131.1|542115_542325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002902133.1|542429_542714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002902136.1|542936_543185_-	DinI-like family protein	NA	S5MQI1	Escherichia_phage	70.4	1.4e-25
WP_000019473.1|543571_544552_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_002902144.1|545230_545722_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_002902148.1|545764_547309_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
544566:545770	attR	GATGCGCTCCGGATGAATATGATGATCTCATATCAGGAACTTGTTCGCACCTTCCTTAGATATAGCCTGGCGACTTGCAGAATGCGAACCGTTCAGGATGCCGACGACGGTGTCGTGTGCGTCTTGTAACCGGGCTCATGTTTTTTTGCTAACGACAACTTTGTTCGACATCGCGCTGTGGCTCGTTATCCGCAAAAAATCGGTTTGTGGGGAGTAAGGGGAGCAGAAGAATATTGTTACCGTTTAGATTTCGCGCCAGCACTATTAAGCGTCCGCCGCGAAGGGGCAATCGGATGGAAGCCAGATATTTTCCCTCTGAGTAATTGATTGCGTTGTTACGCTAAATTTGCATAATGAGCGAATTATATTGCCCCGGTCGTCTCTATGGTTTCCTTTATTCATCCGCTTAATGTTTTAGCCCGCCTTATGGTATCCATTGCAAACATTCCTTTGGTGCATTATTTATTGAATTTATCATTGACTGTTGTTTCATATTTTAAATATTGATATTCATGGTGCTTTTATTTTCGTGGTGAAAGTGGGTGTTTATGAATAAATATAATTATTAGGTGGTTAAGTTGATCGGTAATCCATTTTTGCTTTATCATCGTCACGTTTCACATCAATATATCTTCAATAATTATTCCTTAAGGAAAGGAACTGCTATGGCTGATACGTTCCAGAATGAAGTCCCCAGGGCGCGCATTAATCTCAAATTATCTCTTCATACCGGCGGCGCGCAAAAGAAGGTCGAACTGCCGCTCAAACTGCTTACCATTGGCGATTTTAGTCATGTTAAGGAAAACCGGCCTTTATCGGAAAGAGAAAAAATCAACGTCAATAAAAATAATTTTAACAGCGTACTTTCGGAATTTAGCCCGGAAGTTAACCTCTCGGTGCCGAATACGCTGGCCGGCAATGGCGAAGAGGAGAACGTCAGACTGCGTTTTACCGACATCAAAGATTTTGAACCGGAGCAGGTTGCCCGGCAAATTCCGCAACTCCGCGCCATGCTGGCGATGCGTAATTTATTACGCGATCTCAAATCCAATCTGCTCGATAACGCCACTTTCAGAAAAGAGCTTGAGGCAATCCTGAAAGATCCGGCGCTGTCCCAGGAATTACGCGACGAAATGAGTGCGCTTGCCCCGAAATAAGTGCGGGGCAAGTCTGTTAATGGATTAACCGGGAAAATGCTAATGTCT	NA	NA	NA	NA
WP_004218490.1|547318_548662_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 3
NZ_CP015822	Klebsiella pneumoniae isolate blood sample 2 chromosome, complete genome	5452045	765763	776650	5452045		Escherichia_phage(87.5%)	9	NA	NA
WP_002210516.1|765763_766384_-	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
WP_004151609.1|766376_767642_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.5	6.6e-233
WP_004151610.1|767653_768556_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.3	7.7e-159
WP_002210513.1|768816_769578_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_004176269.1|769598_770459_-	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002904006.1|770756_771017_+	hypothetical protein	NA	A0A077SK33	Escherichia_phage	97.7	3.5e-40
WP_001620097.1|771103_772192_+	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_004151612.1|772222_773488_-	MFS transporter	NA	NA	NA	NA	NA
WP_004151613.1|773542_776650_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
>prophage 4
NZ_CP015822	Klebsiella pneumoniae isolate blood sample 2 chromosome, complete genome	5452045	1433636	1476736	5452045	tRNA,plate,transposase	Microcystis_virus(25.0%)	41	NA	NA
WP_002910404.1|1433636_1434893_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_002910405.1|1435163_1435775_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_004217879.1|1435774_1436623_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_002910407.1|1436806_1437754_+	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.5	2.3e-44
WP_004152259.1|1437878_1439558_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.4	7.9e-24
WP_002910436.1|1439558_1440605_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002910437.1|1440827_1441103_-	stress-induced protein YchH	NA	NA	NA	NA	NA
WP_002910438.1|1441375_1441960_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_002910443.1|1442077_1443169_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_002910446.1|1443251_1443461_-	DUF1869 domain-containing protein	NA	NA	NA	NA	NA
WP_002910453.1|1443662_1444577_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004152260.1|1444708_1446124_-	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_004152261.1|1446143_1446587_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_002910493.1|1446589_1447126_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_004152910.1|1447106_1448123_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_002910495.1|1448152_1449916_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004152262.1|1450049_1453460_-	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_004198077.1|1453443_1454601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910497.1|1454604_1454871_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_072093174.1|1455168_1455354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171815252.1|1455614_1455917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000019473.1|1455974_1456955_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_004152632.1|1457291_1458182_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A7H6	Microcystis_virus	29.8	4.1e-11
WP_002910539.1|1458357_1459251_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BSL8	Microcystis_phage	27.1	2.8e-12
WP_038435084.1|1459272_1459401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152633.1|1459426_1460320_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BSL8	Microcystis_phage	27.3	1.7e-12
WP_004217423.1|1460341_1460458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910544.1|1460503_1461397_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A7H6	Microcystis_virus	30.5	6.7e-14
WP_002910547.1|1461418_1461724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910551.1|1463239_1463746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004153085.1|1463742_1464072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004199326.1|1464068_1464251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022644641.1|1464392_1465361_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.3	6.5e-180
WP_002910586.1|1466966_1467476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910589.1|1467465_1467618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910591.1|1467712_1468219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910593.1|1468215_1468725_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152319.1|1468725_1470081_-	S-type pyocin domain-containing protein	NA	NA	NA	NA	NA
WP_004152317.1|1473044_1474742_-	OmpA family protein	NA	NA	NA	NA	NA
WP_004152316.1|1474745_1475399_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_002910645.1|1475395_1476736_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 5
NZ_CP015822	Klebsiella pneumoniae isolate blood sample 2 chromosome, complete genome	5452045	1745201	1752826	5452045		Escherichia_phage(28.57%)	7	NA	NA
WP_004152482.1|1745201_1746203_-	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	28.6	1.2e-30
WP_004152483.1|1746396_1747563_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	4.1e-112
WP_004152484.1|1747743_1748298_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	58.2	3.8e-52
WP_004152485.1|1748312_1749203_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	33.6	2.8e-28
WP_004152486.1|1749234_1750104_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	67.0	9.8e-111
WP_004152487.1|1750130_1751195_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	55.0	3.4e-105
WP_004152488.1|1751419_1752826_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	4.7e-38
>prophage 6
NZ_CP015822	Klebsiella pneumoniae isolate blood sample 2 chromosome, complete genome	5452045	1789393	1796300	5452045	tRNA	Bacillus_phage(33.33%)	6	NA	NA
WP_004151135.1|1789393_1790872_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	1.1e-29
WP_002912634.1|1790868_1791591_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	6.4e-31
WP_002912635.1|1791909_1793271_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.5	2.5e-206
WP_004151134.1|1793513_1794410_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_002912638.1|1794652_1795426_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.3	1.5e-25
WP_004175147.1|1795436_1796300_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
>prophage 7
NZ_CP015822	Klebsiella pneumoniae isolate blood sample 2 chromosome, complete genome	5452045	2096082	2169733	5452045	terminase,tRNA,transposase,tail,capsid,holin,integrase,protease	Salmonella_phage(40.0%)	86	2101724:2101741	2168722:2168739
WP_004152006.1|2096082_2098086_-|tRNA	tRNA(Met) cytidine acetyltransferase	tRNA	NA	NA	NA	NA
WP_002913800.1|2098095_2098971_-	neutral zinc metallopeptidase	NA	NA	NA	NA	NA
WP_002913801.1|2099090_2099804_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A127KMU1	Cyanophage	35.7	1.1e-38
WP_002913802.1|2100019_2101054_-	outer membrane protein assembly factor BamC	NA	NA	NA	NA	NA
WP_002913803.1|2101070_2101949_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
2101724:2101741	attL	CAGCGATAACCGGAATAC	NA	NA	NA	NA
WP_002913804.1|2102102_2102669_+	glycine cleavage system transcriptional repressor	NA	NA	NA	NA	NA
WP_002913805.1|2102672_2103143_+	thioredoxin-dependent thiol peroxidase	NA	NA	NA	NA	NA
WP_002913806.1|2103204_2104266_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_004221267.1|2104320_2104437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002913807.1|2104488_2105952_+|protease	beta-barrel assembly-enhancing protease	protease	NA	NA	NA	NA
WP_002913810.1|2105961_2106321_+	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
WP_002913812.1|2106448_2107360_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	58.8	3.5e-74
WP_020947395.1|2107356_2108058_-	DnaA inactivator Hda	NA	NA	NA	NA	NA
WP_002913824.1|2108156_2109443_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	38.1	1.9e-65
WP_002913827.1|2109538_2110165_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_002913829.1|2110382_2111816_-	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_002913833.1|2111825_2112719_-	ROK family protein	NA	NA	NA	NA	NA
WP_002913836.1|2112982_2114020_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.5	8.2e-72
WP_004152007.1|2114016_2114658_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	41.1	1.2e-28
WP_002913838.1|2114838_2116899_+	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_002913839.1|2116902_2118435_+	exopolyphosphatase	NA	NA	NA	NA	NA
WP_002913841.1|2118488_2120717_-	sensor domain-containing phosphodiesterase	NA	NA	NA	NA	NA
WP_004174861.1|2121087_2121261_+	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	78.8	1.4e-16
WP_004221278.1|2121357_2122269_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002913847.1|2122342_2123575_+	MFS transporter	NA	NA	NA	NA	NA
WP_004162150.1|2123868_2125047_+	anaerobic sulfatase maturase	NA	NA	NA	NA	NA
WP_004152009.1|2125030_2126899_+	sulfatase-like hydrolase/transferase	NA	A0A2P0VMN7	Tetraselmis_virus	22.6	2.6e-07
WP_004152707.1|2127118_2127601_-	DUF2514 domain-containing protein	NA	Q858E9	Salmonella_phage	80.6	3.0e-61
WP_004152706.1|2127597_2128227_-	glycoside hydrolase family 19 protein	NA	Q858F0	Salmonella_phage	76.4	3.1e-90
WP_004146393.1|2128216_2128522_-|holin	phage holin family protein	holin	A0A193GYK3	Enterobacter_phage	82.4	2.7e-39
WP_004146394.1|2128508_2128913_-	membrane protein	NA	T1SA79	Salmonella_phage	84.1	9.3e-56
WP_004229092.1|2129036_2129189_-	hypothetical protein	NA	A0A2H5BN82	Klebsiella_phage	54.3	1.9e-06
WP_004221284.1|2129197_2131567_-|tail	phage tail fibers	tail	A0A2H5BN49	Klebsiella_phage	79.5	9.1e-268
WP_004152452.1|2131718_2132015_+	hypothetical protein	NA	T1SA06	Salmonella_phage	65.5	6.2e-25
WP_004152453.1|2132105_2132363_+	DUF1902 domain-containing protein	NA	A0A0M4R2Z9	Salmonella_phage	54.1	2.3e-12
WP_004152454.1|2132366_2132564_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0M4RCZ9	Salmonella_phage	69.8	2.0e-19
WP_157833602.1|2132672_2132861_+	ash family protein	NA	NA	NA	NA	NA
WP_004152455.1|2132944_2133640_+	hypothetical protein	NA	A0A193GYJ9	Enterobacter_phage	52.7	4.4e-61
WP_004152456.1|2133830_2134013_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152457.1|2134017_2134416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152458.1|2134690_2135305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152459.1|2135314_2138704_-	hypothetical protein	NA	G9L6D4	Escherichia_phage	42.0	6.3e-121
WP_004152460.1|2138703_2141448_-	hypothetical protein	NA	A0A193GYI3	Enterobacter_phage	39.2	9.1e-94
WP_004152461.1|2141460_2141958_-	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	40.5	5.7e-23
WP_004152462.1|2141950_2142421_-	hypothetical protein	NA	Q858G2	Salmonella_phage	55.3	7.3e-44
WP_004152463.1|2142422_2144900_-	hypothetical protein	NA	G9L6D0	Escherichia_phage	56.5	3.6e-267
WP_004153043.1|2144899_2145511_-	hypothetical protein	NA	T1SAQ2	Salmonella_phage	48.8	1.2e-46
WP_004152465.1|2145559_2145838_-	hypothetical protein	NA	T1SA01	Salmonella_phage	58.9	6.7e-21
WP_004152466.1|2145830_2146223_-	hypothetical protein	NA	T1SA71	Salmonella_phage	89.9	1.5e-55
WP_004152467.1|2146232_2147240_-|capsid	phage capsid protein	capsid	T1S9H9	Salmonella_phage	92.5	2.7e-181
WP_019404949.1|2147252_2147930_-	peptidase	NA	T1SAP9	Salmonella_phage	63.6	2.0e-50
WP_004152470.1|2147932_2148238_-	hypothetical protein	NA	Q2A090	Sodalis_phage	51.3	1.1e-16
WP_004152471.1|2148234_2149914_-|tail	tail protein	tail	T1S9Z7	Salmonella_phage	58.9	3.4e-192
WP_004152472.1|2149917_2150121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152473.1|2150826_2151348_+	DUF2829 domain-containing protein	NA	A0A1B0VMG3	Pseudomonas_phage	55.2	7.8e-47
WP_004164044.1|2151391_2152867_-	hypothetical protein	NA	Q858H3	Salmonella_phage	92.9	1.9e-279
WP_004152523.1|2152863_2153448_-|terminase	terminase small subunit	terminase	T1SBI8	Salmonella_phage	88.1	2.4e-89
WP_004152524.1|2153525_2153783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152525.1|2153857_2154196_-	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	80.0	4.7e-45
WP_004152526.1|2154195_2154435_-	hypothetical protein	NA	G8C7S3	Escherichia_phage	48.0	4.6e-10
WP_004152527.1|2154427_2155096_-	DUF551 domain-containing protein	NA	Q6UAT8	Klebsiella_phage	52.5	1.5e-05
WP_004141386.1|2155092_2155305_-	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	45.5	8.1e-11
WP_004152528.1|2155305_2155476_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	69.6	2.5e-15
WP_004152529.1|2155475_2156219_-	hypothetical protein	NA	A6N3G8	Burkholderia_virus	59.5	1.5e-19
WP_004152530.1|2156215_2156641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152531.1|2156637_2156829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152532.1|2156812_2157223_-	hypothetical protein	NA	A0A2P1MXC5	Escherichia_phage	42.2	3.1e-14
WP_004152534.1|2157415_2157763_-	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	82.6	5.0e-50
WP_004152535.1|2157882_2158668_-	replication protein	NA	A0A193GYX1	Enterobacter_phage	87.4	8.2e-133
WP_004152536.1|2158664_2159432_-	primosomal protein	NA	A0A193GZ86	Enterobacter_phage	91.0	3.4e-139
WP_004152537.1|2159431_2159641_-	hypothetical protein	NA	A0A193GYW4	Enterobacter_phage	78.3	1.8e-26
WP_004152538.1|2159788_2160022_-	hypothetical protein	NA	T1SAR5	Salmonella_phage	66.2	9.2e-24
WP_004152539.1|2160175_2160757_+	helix-turn-helix transcriptional regulator	NA	Q858D7	Salmonella_phage	64.8	1.9e-65
WP_004164037.1|2160977_2161127_+	hypothetical protein	NA	G9L6A5	Escherichia_phage	84.2	7.9e-13
WP_004164029.1|2161123_2161423_+	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	54.5	2.1e-20
WP_004152541.1|2161419_2162319_+	YqaJ viral recombinase family protein	NA	Q858E0	Salmonella_phage	93.0	1.5e-159
WP_004152542.1|2162328_2163351_+	recombination protein RecT	NA	Q858E1	Salmonella_phage	95.3	2.4e-180
WP_004152543.1|2163402_2163651_+	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	69.5	1.1e-27
WP_004153052.1|2163760_2164054_+	PerC family transcriptional regulator	NA	T1S9J5	Salmonella_phage	71.1	8.9e-32
WP_004152545.1|2164046_2164205_+	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	78.8	1.9e-17
WP_004152546.1|2164201_2164795_+	adenine methylase	NA	T1SA14	Salmonella_phage	92.4	4.3e-110
WP_004152547.1|2164791_2164974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152548.1|2164970_2165162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152549.1|2165178_2166429_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1X9TCT6	Enterobacter_phage	85.3	1.4e-206
WP_004151979.1|2166621_2168199_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_004151980.1|2168266_2169733_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	1.2e-87
2168722:2168739	attR	CAGCGATAACCGGAATAC	NA	NA	NA	NA
>prophage 8
NZ_CP015822	Klebsiella pneumoniae isolate blood sample 2 chromosome, complete genome	5452045	2241083	2320693	5452045	terminase,tRNA,capsid,lysis,tail,head,integrase,portal,plate	Salmonella_phage(72.0%)	87	2285787:2285833	2322354:2322400
WP_002914079.1|2241083_2241821_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_002914082.1|2241952_2243284_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.9	6.2e-48
WP_002914084.1|2243329_2243713_-	autonomous glycyl radical cofactor GrcA	NA	A0A193GZ98	Escherichia_phage	79.3	4.0e-32
WP_002914088.1|2244026_2244716_+	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	53.0	1.3e-57
WP_002914089.1|2244773_2245859_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_002914091.1|2246062_2246488_+	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	40.2	6.0e-13
WP_002914092.1|2246557_2247256_+|tRNA	tRNA-uridine aminocarboxypropyltransferase	tRNA	NA	NA	NA	NA
WP_004151994.1|2247290_2249951_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_002914094.1|2250071_2251427_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_002914095.1|2251468_2251792_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_002914097.1|2251795_2253094_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	31.5	3.1e-44
WP_004150973.1|2259059_2261633_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.4	6.9e-128
WP_002914109.1|2261762_2262494_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_002914110.1|2262490_2263471_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_004145664.1|2263602_2264340_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_002914111.1|2264610_2264946_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_100250063.1|2265052_2265100_+	pheA operon leader peptide PheL	NA	NA	NA	NA	NA
WP_004150975.1|2265200_2266361_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_002914112.1|2266357_2267230_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_002914113.1|2267292_2268414_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_002914114.1|2268423_2269494_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.5	1.8e-90
WP_004174804.1|2269836_2270346_+	YfiR family protein	NA	NA	NA	NA	NA
WP_002914116.1|2270338_2271562_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_002914117.1|2271575_2272058_+	OmpA family protein	NA	NA	NA	NA	NA
WP_002914118.1|2272066_2273437_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_002914119.1|2273493_2273952_-	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_002914145.1|2274071_2274419_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_002914147.1|2274458_2275226_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_004150977.1|2275257_2275806_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_002914149.1|2275824_2276073_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_002914152.1|2276332_2277697_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_002914153.1|2277860_2278652_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_004149392.1|2278671_2279958_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_002914155.1|2280077_2280668_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_002914158.1|2280792_2281671_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_002914159.1|2281757_2283419_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_002914160.1|2283566_2283908_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_002914161.1|2283974_2284265_-	RnfH family protein	NA	NA	NA	NA	NA
WP_004188817.1|2284254_2284731_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_002914164.1|2284841_2285324_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
2285787:2285833	attL	ATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCAAA	NA	NA	NA	NA
WP_004150980.1|2285927_2286305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150981.1|2286332_2286551_-	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	72.2	1.9e-26
WP_004150982.1|2286617_2287712_-	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	83.6	2.4e-170
WP_004150983.1|2287708_2288194_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.1	5.2e-61
WP_004150984.1|2288190_2290821_-|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	41.9	8.9e-115
WP_002896220.1|2290813_2290933_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_004150985.1|2290947_2291247_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	78.0	8.2e-33
WP_004150986.1|2291299_2291815_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	84.2	1.4e-80
WP_004150987.1|2291824_2292997_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	91.5	3.4e-207
WP_004150988.1|2293145_2294219_-|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	53.6	6.6e-40
WP_004200602.1|2294270_2295389_-	hypothetical protein	NA	A0A248XD67	Klebsiella_phage	38.0	4.4e-55
WP_004150990.1|2295398_2297348_-	CotH kinase family protein	NA	Q6QI97	Burkholderia_phage	38.9	1.0e-06
WP_004152935.1|2297349_2298021_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	58.9	3.2e-61
WP_004150992.1|2298013_2298922_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	68.9	1.9e-109
WP_004150993.1|2298908_2299271_-	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	85.6	8.4e-48
WP_004150994.1|2299267_2299840_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	70.8	1.4e-76
WP_004150995.1|2299934_2300801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150996.1|2300823_2301270_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	72.3	2.5e-54
WP_004150997.1|2301262_2301685_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	83.2	8.2e-63
WP_072093160.1|2301647_2301806_-	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	75.0	9.0e-15
WP_004150998.1|2301780_2302209_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	82.5	7.1e-54
WP_004150999.1|2302205_2302589_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	45.4	1.9e-18
WP_004151000.1|2302593_2303103_-	lysozyme	NA	E5G6N1	Salmonella_phage	85.2	1.6e-81
WP_004134639.1|2303083_2303299_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	88.7	6.1e-30
WP_004151001.1|2303302_2303506_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	89.6	9.8e-30
WP_004151002.1|2303505_2303970_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	85.7	1.5e-73
WP_004134644.1|2304065_2304719_-|terminase	terminase endonuclease subunit	terminase	A0A1S6KZX1	Salmonella_phage	80.0	1.9e-90
WP_004151003.1|2304722_2305775_-|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	91.0	6.8e-175
WP_004151004.1|2305791_2306625_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	77.6	4.4e-100
WP_019405037.1|2306765_2308529_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	91.8	0.0e+00
WP_004151006.1|2308528_2309572_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	85.6	3.1e-172
WP_024940854.1|2309628_2309898_-	hypothetical protein	NA	D2IZW1	Enterococcus_phage	41.3	1.4e-15
WP_004151007.1|2310419_2311421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151008.1|2311420_2312500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151009.1|2312486_2313170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151010.1|2313265_2313499_-	DinI family protein	NA	A0A0M4S6H1	Salmonella_phage	96.1	2.0e-34
WP_004151011.1|2313510_2313699_-	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	90.3	2.2e-23
WP_004151012.1|2313861_2316246_-	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	87.9	0.0e+00
WP_004151013.1|2316242_2317094_-	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	75.4	2.2e-115
WP_004151014.1|2317090_2317318_-	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	92.0	5.1e-35
WP_004151016.1|2317317_2317551_-	DUF2732 family protein	NA	A0A1S6L021	Salmonella_phage	90.9	6.0e-31
WP_004144796.1|2317618_2317957_-	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	58.0	6.2e-29
WP_004151017.1|2317920_2318121_-	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	68.8	4.5e-19
WP_004151018.1|2318128_2318638_-	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	85.8	1.1e-77
WP_001397669.1|2318670_2318913_-	hypothetical protein	NA	A0A1S6KZZ6	Salmonella_phage	98.8	4.0e-38
WP_004151019.1|2319035_2319665_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	54.5	1.4e-61
WP_004151020.1|2319667_2320693_+|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	93.8	1.5e-190
2322354:2322400	attR	ATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCAAA	NA	NA	NA	NA
>prophage 9
NZ_CP015822	Klebsiella pneumoniae isolate blood sample 2 chromosome, complete genome	5452045	3041044	3091193	5452045	terminase,tRNA,transposase,tail,capsid,head,portal,protease	uncultured_Caudovirales_phage(62.5%)	56	NA	NA
WP_002918465.1|3041044_3041539_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	1.5e-26
WP_002918467.1|3041542_3042181_-	stringent starvation protein A	NA	NA	NA	NA	NA
WP_135801240.1|3042150_3042435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000829818.1|3042492_3042885_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_002918559.1|3042900_3043329_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_004144945.1|3043594_3044722_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_002918565.1|3044912_3045311_+	DUF1043 family protein	NA	NA	NA	NA	NA
WP_002918566.1|3045484_3046852_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.3	6.0e-22
WP_002918568.1|3046939_3047998_+	outer membrane-stress sensor serine endopeptidase DegS	NA	NA	NA	NA	NA
WP_002918570.1|3048134_3049073_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_002918625.1|3049487_3049958_+	transcriptional regulator ArgR	NA	NA	NA	NA	NA
WP_002918626.1|3050333_3050597_+	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_002918627.1|3050695_3050962_+	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_002918629.1|3051012_3051288_-	barstar family protein	NA	NA	NA	NA	NA
WP_002918632.1|3051367_3053335_-	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
WP_002918639.1|3053340_3054273_-	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
WP_002918640.1|3054280_3054484_-	AaeX family protein	NA	NA	NA	NA	NA
WP_002918641.1|3054615_3055545_+	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
WP_002918642.1|3055580_3057026_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_004150952.1|3057114_3060912_-	AsmA2 domain-containing protein YhdP	NA	NA	NA	NA	NA
WP_002918644.1|3060949_3062419_-	ribonuclease G	NA	NA	NA	NA	NA
WP_002918646.1|3062421_3063003_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_002918648.1|3063010_3063499_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_004149974.1|3063498_3064491_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_002918653.1|3064561_3065605_-	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
WP_002918686.1|3065910_3067851_-	RNase E specificity factor CsrD	NA	NA	NA	NA	NA
WP_002918687.1|3067930_3068122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002918688.1|3068350_3069352_+	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_002918689.1|3069351_3069960_+	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_002918732.1|3070183_3070636_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_002918736.1|3070658_3071126_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_002918738.1|3071136_3072486_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_002918740.1|3072596_3072839_+	YhdT family protein	NA	NA	NA	NA	NA
WP_004150953.1|3072828_3074280_+	sodium/pantothenate symporter	NA	NA	NA	NA	NA
WP_002918745.1|3074291_3075173_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_004144972.1|3075530_3076496_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_000462905.1|3076520_3076817_+	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
WP_004150954.1|3076970_3077162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150955.1|3077164_3078826_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	98.0	0.0e+00
WP_085955245.1|3079194_3080387_-|transposase	IS3-like element ISKpn18 family transposase	transposase	U5P429	Shigella_phage	43.5	3.5e-50
WP_004150957.1|3080602_3080755_-	hypothetical protein	NA	A0A2H4JCY9	uncultured_Caudovirales_phage	88.0	2.4e-17
WP_004150959.1|3080747_3081191_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	91.8	2.8e-77
WP_001547824.1|3081190_3081490_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	80.8	3.4e-39
WP_004150961.1|3081486_3081822_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	57.8	3.7e-26
WP_004150962.1|3081818_3083060_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	96.5	1.0e-230
WP_001547826.1|3083061_3083622_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	95.7	1.2e-98
WP_001549743.1|3083673_3084840_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	95.9	9.8e-207
WP_004150963.1|3085103_3085616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150964.1|3085664_3086000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150965.1|3086342_3088478_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	62.4	3.4e-205
WP_001549749.1|3088477_3088843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150966.1|3088839_3089208_-	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	81.1	3.7e-51
WP_004150967.1|3089204_3089519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001549752.1|3089511_3089700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106918304.1|3089692_3089962_-	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	94.4	2.4e-44
WP_004150969.1|3090413_3091193_-	phage antirepressor KilAC domain-containing protein	NA	Q8HA02	Enterobacteria_phage	51.5	6.2e-40
>prophage 10
NZ_CP015822	Klebsiella pneumoniae isolate blood sample 2 chromosome, complete genome	5452045	4184261	4190086	5452045		Enterobacteria_phage(100.0%)	8	NA	NA
WP_004152202.1|4184261_4184828_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.8	9.7e-59
WP_004152203.1|4184845_4185091_-	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	56.8	5.5e-19
WP_004152204.1|4185087_4185825_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	59.4	1.1e-70
WP_000556592.1|4186385_4186652_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.0e-30
WP_004153681.1|4186648_4187197_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	69.4	1.1e-30
WP_004152205.1|4187193_4187421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152206.1|4187417_4187738_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_004152207.1|4187752_4190086_+	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	83.9	0.0e+00
>prophage 11
NZ_CP015822	Klebsiella pneumoniae isolate blood sample 2 chromosome, complete genome	5452045	4658332	4669986	5452045	integrase	Enterobacteria_phage(70.0%)	13	4646466:4646480	4669523:4669537
4646466:4646480	attL	AGCGCGGAGAGATTG	NA	NA	NA	NA
WP_002889890.1|4658332_4660666_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	82.2	0.0e+00
WP_002889897.1|4660677_4660998_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_002889911.1|4660994_4661222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024940872.1|4661218_4661776_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	70.4	1.8e-33
WP_002889915.1|4661772_4662039_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
WP_002889917.1|4662580_4663318_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	60.7	9.0e-73
WP_002889919.1|4663314_4663560_+	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	58.0	1.9e-19
WP_002889930.1|4663577_4664144_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.3	1.5e-59
WP_004152979.1|4664712_4665138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152029.1|4665137_4666088_-	AAA family ATPase	NA	A0A1X9IGI7	Lactococcus_phage	27.1	1.2e-13
WP_002889938.1|4666075_4667266_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	62.7	6.4e-145
WP_002889940.1|4667618_4668872_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	44.9	8.9e-89
WP_004144574.1|4668882_4669986_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.5	4.8e-62
4669523:4669537	attR	AGCGCGGAGAGATTG	NA	NA	NA	NA
>prophage 12
NZ_CP015822	Klebsiella pneumoniae isolate blood sample 2 chromosome, complete genome	5452045	4879541	4924816	5452045	holin,head,tRNA,lysis	Escherichia_phage(25.0%)	65	NA	NA
WP_004143010.1|4879541_4880927_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
WP_004143016.1|4880972_4881185_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_004143017.1|4881186_4882053_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
WP_004151317.1|4883523_4883859_-	excisionase family DNA-binding protein	NA	NA	NA	NA	NA
WP_004151316.1|4883860_4884076_-	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	52.9	4.0e-13
WP_004151314.1|4884077_4884296_-	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	47.2	1.2e-09
WP_004151312.1|4884292_4885060_-	hypothetical protein	NA	D5LH17	Escherichia_phage	53.4	1.7e-66
WP_004151310.1|4885056_4885713_-	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	87.5	2.7e-113
WP_004151308.1|4885709_4885868_-	DUF1317 family protein	NA	A0A0N7CHV0	Escherichia_phage	60.8	3.0e-10
WP_004151306.1|4885864_4886545_-	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	93.4	7.9e-124
WP_004151305.1|4886541_4887387_-	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	6.9e-69
WP_004151304.1|4887402_4887687_-	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	62.8	8.0e-30
WP_004151303.1|4887775_4887970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151302.1|4887962_4888073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151301.1|4888069_4888285_-	hypothetical protein	NA	B5WZV1	Pseudomonas_phage	48.6	1.6e-09
WP_004151300.1|4888635_4889325_-	helix-turn-helix transcriptional regulator	NA	G8C7U1	Escherichia_phage	52.2	4.3e-61
WP_004151299.1|4889452_4889686_+	helix-turn-helix domain-containing protein	NA	G8C7U2	Escherichia_phage	50.7	4.3e-13
WP_001548453.1|4889726_4889948_+	hypothetical protein	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
WP_004151298.1|4890033_4890180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004230546.1|4890220_4891072_+	hypothetical protein	NA	F1C5C3	Cronobacter_phage	56.3	5.3e-85
WP_004230547.1|4891076_4892492_+	AAA family ATPase	NA	Q9MCT4	Escherichia_phage	67.1	1.8e-183
WP_004151295.1|4892491_4892785_+	protein ren	NA	O48423	Enterobacteria_phage	65.6	3.3e-26
WP_004151294.1|4892781_4893288_+	hypothetical protein	NA	A0A0A6Z565	Enterobacter_phage	59.6	3.0e-27
WP_004151293.1|4893394_4894237_+	ead/Ea22-like family protein	NA	A0A2H4FRZ0	Salmonella_phage	60.8	1.8e-29
WP_004151292.1|4894236_4894413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151291.1|4894409_4895057_+	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	32.6	4.5e-12
WP_004151288.1|4895557_4896013_+	hypothetical protein	NA	K7P7B8	Enterobacteria_phage	69.5	8.0e-56
WP_004151287.1|4896012_4896183_+	NinE family protein	NA	G8C7V4	Escherichia_phage	73.2	1.3e-14
WP_004151286.1|4896175_4896811_+	recombination protein NinG	NA	M9NYX8	Enterobacteria_phage	77.9	2.7e-81
WP_004151285.1|4896807_4896945_+	YlcG family protein	NA	NA	NA	NA	NA
WP_004151284.1|4896937_4897468_+	HNH endonuclease	NA	A0A193GYW9	Enterobacter_phage	43.1	5.2e-30
WP_004151283.1|4897464_4898154_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.5	1.4e-56
WP_004151282.1|4899063_4899312_+|holin	class II holin family protein	holin	NA	NA	NA	NA
WP_004151281.1|4899314_4899845_+	lysozyme	NA	G9L6J6	Escherichia_phage	78.5	6.0e-79
WP_004151280.1|4899841_4900306_+|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	73.2	2.4e-55
WP_004151279.1|4900411_4900741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151277.1|4901111_4901714_+	hypothetical protein	NA	G8C7P2	Escherichia_phage	80.9	5.4e-76
WP_004151276.1|4901713_4903186_+	hypothetical protein	NA	A0A1W6JNY3	Morganella_phage	82.5	1.3e-248
WP_004151275.1|4903198_4904620_+	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	57.1	9.6e-148
WP_004151274.1|4904594_4905599_+|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	69.7	9.0e-116
WP_004151273.1|4905640_4906117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151272.1|4906189_4907575_+	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	60.0	2.3e-154
WP_004151271.1|4907578_4908007_+	hypothetical protein	NA	F1C5E0	Cronobacter_phage	60.8	1.6e-42
WP_004151270.1|4908018_4909113_+	hypothetical protein	NA	F1C5E1	Cronobacter_phage	62.8	1.7e-123
WP_004151269.1|4909123_4909363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151268.1|4909365_4909746_+	hypothetical protein	NA	F1C5E2	Cronobacter_phage	55.3	5.3e-29
WP_004151267.1|4909745_4909919_+	hypothetical protein	NA	I6R0P9	Salmonella_phage	56.1	1.4e-13
WP_004151266.1|4909918_4910281_+	hypothetical protein	NA	A0A173GCE0	Salmonella_phage	45.0	1.8e-18
WP_004151265.1|4910283_4910709_+	hypothetical protein	NA	R9TPP7	Aeromonas_phage	47.9	5.1e-28
WP_004151264.1|4910705_4911098_+	hypothetical protein	NA	G0ZNE4	Cronobacter_phage	52.7	5.1e-35
WP_004151263.1|4911166_4911919_+	Ig domain-containing protein	NA	G0ZNE6	Cronobacter_phage	42.1	5.8e-43
WP_004151262.1|4911971_4912649_+	hypothetical protein	NA	F1C5E8	Cronobacter_phage	57.9	4.8e-73
WP_004151261.1|4912824_4913580_+	KilA-N domain-containing protein	NA	K7PGT4	Enterobacteria_phage	51.0	2.4e-60
WP_004151260.1|4913582_4913837_+	hypothetical protein	NA	K7PM89	Enterobacteria_phage	73.0	6.7e-20
WP_004151259.1|4914130_4914601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151258.1|4914617_4914977_-	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	47.5	3.8e-16
WP_004151257.1|4915076_4915247_+	Arc family DNA-binding protein	NA	I6R9A8	Salmonella_phage	87.0	6.1e-17
WP_004151256.1|4915236_4915950_+	hypothetical protein	NA	H6WRU8	Salmonella_phage	50.2	3.9e-49
WP_004151255.1|4916015_4916801_+	phage repressor protein	NA	A0A2L1IV39	Escherichia_phage	59.7	1.9e-84
WP_004151254.1|4916928_4917432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151253.1|4917524_4920971_+	tape measure protein	NA	Q5G8W8	Enterobacteria_phage	48.6	1.4e-163
WP_004151252.1|4921013_4921490_+	hypothetical protein	NA	A0A2P1MXB5	Escherichia_phage	49.7	3.0e-37
WP_004199076.1|4921489_4921960_+	hypothetical protein	NA	R9TPR6	Aeromonas_phage	41.0	2.5e-28
WP_004151250.1|4921956_4922352_+	C40 family peptidase	NA	F1C5F2	Cronobacter_phage	54.0	8.0e-36
WP_004151249.1|4922338_4924816_+	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	45.6	2.7e-198
>prophage 13
NZ_CP015822	Klebsiella pneumoniae isolate blood sample 2 chromosome, complete genome	5452045	5369925	5407261	5452045	terminase,capsid,tail,lysis,head,integrase,portal,plate	Salmonella_phage(87.18%)	47	5369833:5369851	5407333:5407351
5369833:5369851	attL	CAGGCAACAAAAAACCCAT	NA	NA	NA	NA
WP_014342959.1|5369925_5370906_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.2	1.4e-97
WP_004178082.1|5371393_5372881_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004150866.1|5372979_5373924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152885.1|5373935_5374814_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	39.9	1.7e-30
WP_000188448.1|5374959_5375181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460893.1|5375213_5375723_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_000956179.1|5375730_5375931_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	97.0	1.6e-32
WP_000963473.1|5375894_5376236_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
WP_004150864.1|5376303_5376537_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	4.1e-32
WP_000752622.1|5376536_5376764_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	6.0e-36
WP_004150863.1|5376760_5377618_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.4	2.0e-156
WP_004150862.1|5377614_5380029_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
WP_001154434.1|5380182_5380371_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_001217575.1|5380381_5380615_+	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_000700647.1|5380729_5381407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004199124.1|5381682_5383425_+	AIPR family protein	NA	NA	NA	NA	NA
WP_002895959.1|5383486_5384512_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.7	7.6e-171
WP_004150858.1|5384511_5386278_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.0	0.0e+00
WP_002895967.1|5386420_5387254_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	88.8	6.3e-123
WP_002895972.1|5387270_5388329_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.1e-180
WP_000059191.1|5388332_5388983_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_002896151.1|5389078_5389543_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	8.4e-77
WP_002896155.1|5389542_5389746_+|tail	tail protein X	tail	A0A1S6KZY4	Salmonella_phage	88.1	1.3e-29
WP_002896158.1|5389749_5389965_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	90.1	3.6e-30
WP_002896161.1|5389945_5390455_+	lysozyme	NA	E5G6N1	Salmonella_phage	83.4	2.1e-81
WP_002896163.1|5390459_5390843_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	42.0	2.1e-17
WP_002896168.1|5390839_5391268_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	77.9	9.6e-51
WP_002896170.1|5391254_5391401_+	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	76.1	6.0e-13
WP_002896172.1|5391363_5391795_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	82.5	9.9e-64
WP_002896175.1|5391787_5392234_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	71.2	2.2e-50
WP_004150857.1|5392230_5392923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002896177.1|5393017_5393590_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	72.3	4.7e-77
WP_002896179.1|5393586_5393949_+	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	84.7	5.8e-49
WP_002896182.1|5393935_5394844_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	66.9	7.6e-106
WP_004150856.1|5394836_5395436_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	60.5	1.3e-58
WP_019724930.1|5397654_5398389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002896186.1|5398392_5399124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002896188.1|5399120_5399324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002896191.1|5399353_5400430_+|tail	phage tail protein	tail	Q37842	Escherichia_phage	44.8	1.2e-25
WP_002896193.1|5400568_5401741_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	93.3	1.9e-210
WP_002896201.1|5401750_5402266_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	85.4	1.3e-81
WP_002896204.1|5402318_5402618_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	79.0	3.7e-33
WP_002896220.1|5402632_5402752_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_002896222.1|5402744_5405372_+|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	42.0	5.6e-117
WP_002896224.1|5405368_5405854_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	75.6	7.2e-63
WP_002896225.1|5405850_5406951_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.4	4.9e-176
WP_000972391.1|5407042_5407261_+	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
5407333:5407351	attR	CAGGCAACAAAAAACCCAT	NA	NA	NA	NA
>prophage 1
NZ_CP015823	Klebsiella pneumoniae isolate blood sample 2 plasmid 1, complete sequence	205221	4901	133325	205221	integrase,protease,bacteriocin,transposase	Escherichia_phage(15.38%)	116	98324:98341	136460:136477
WP_085955172.1|4901_6109_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	63.2	1.7e-100
WP_004178091.1|7537_7969_-	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_003032875.1|8219_9695_-	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
WP_001572351.1|9687_10368_-	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	35.6	2.1e-31
WP_000475512.1|10557_11943_+	Cu(+)/Ag(+) efflux RND transporter outer membrane channel SilC	NA	NA	NA	NA	NA
WP_001246153.1|11971_12325_+	cation efflux system protein CusF	NA	NA	NA	NA	NA
WP_004152079.1|12438_13731_+	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit SilB	NA	NA	NA	NA	NA
WP_004098958.1|13741_16888_+	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	S5VTK5	Leptospira_phage	22.5	4.0e-61
WP_000758228.1|16974_17415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004098955.1|17541_19989_+	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	35.8	7.6e-84
WP_000843497.1|20029_20227_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_004118669.1|20260_20998_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	32.5	1.2e-11
WP_001023257.1|21286_21736_-	copper resistance protein	NA	NA	NA	NA	NA
WP_004152083.1|21969_23787_+	multicopper oxidase PcoA	NA	NA	NA	NA	NA
WP_001378118.1|23792_24683_+	copper resistance outer membrane transporter PcoB	NA	NA	NA	NA	NA
WP_000025662.1|24722_25103_+	copper resistance system metallochaperone PcoC	NA	NA	NA	NA	NA
WP_004118344.1|25107_26037_+	copper resistance inner membrane protein PcoD	NA	NA	NA	NA	NA
WP_001188930.1|26091_26772_+	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
WP_004152084.1|26768_28169_+	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.3	4.1e-18
WP_004152085.1|28385_28820_+	copper resistance system metallochaperone PcoE	NA	NA	NA	NA	NA
WP_004152086.1|29051_29231_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_031944101.1|30973_31483_+	aquaporin	NA	NA	NA	NA	NA
WP_004152091.1|31532_32030_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_004152092.1|32361_32688_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004152093.1|32684_33398_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	77.0	2.9e-92
WP_004182005.1|33406_33952_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_004152095.1|34027_34390_+	arsenic metallochaperone ArsD family protein	NA	NA	NA	NA	NA
WP_004152096.1|36286_36823_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_004152097.1|36855_37281_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	72.9	2.3e-52
WP_004152098.1|37293_38583_-	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	74.0	1.9e-171
WP_004152099.1|38630_40382_-	arsenite efflux transporter ATPase subunit ArsA	NA	NA	NA	NA	NA
WP_004152100.1|40399_40762_-	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_004152101.1|40811_41162_-	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	1.4e-23
WP_004152102.1|41519_41789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152103.1|41776_42352_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152104.1|42382_42877_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_004152105.1|42920_43289_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152106.1|43322_43526_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_004152107.1|43574_43832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152108.1|43907_44162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003026799.1|44337_44604_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_003026803.1|44591_45074_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_020314316.1|45285_46632_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_004152113.1|48474_49437_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_009483782.1|49423_50173_-	phosphate-starvation-inducible PsiE family protein	NA	NA	NA	NA	NA
WP_004152115.1|50410_50608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152116.1|50607_53403_-	heat shock survival AAA family ATPase ClpK	NA	K4FB40	Cronobacter_phage	41.0	5.2e-129
WP_004152117.1|53517_54087_-	small heat shock protein sHSP20	NA	NA	NA	NA	NA
WP_004152118.1|54121_54403_-	helix-turn-helix domain-containing protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	38.2	5.2e-05
WP_004118208.1|54646_54910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004118209.1|54924_55188_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000019473.1|56389_57370_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_004152692.1|58578_59448_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004152693.1|59441_60452_-	phosphonate dehydrogenase PtxD	NA	A0A1V0SBV6	Catovirus	25.1	1.4e-15
WP_004152694.1|60460_61288_-	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_004152695.1|61296_62160_-	phosphate/phosphite/phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004153729.1|62156_62984_-	phosphonate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.6	2.6e-20
WP_004217321.1|63839_64544_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_044503635.1|65847_66516_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	99.1	3.3e-130
WP_000018329.1|66705_67521_-	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
WP_001067855.1|67671_68376_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000219391.1|68497_69403_+	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_000004159.1|69399_70638_+	MFS transporter	NA	NA	NA	NA	NA
WP_001137892.1|70637_71222_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001389365.1|71714_72479_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_000130000.1|72705_73011_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000184001.1|73021_74227_-	chromate efflux transporter	NA	NA	NA	NA	NA
WP_000376616.1|74382_74586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000259031.1|74713_75553_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|75546_75894_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001206356.1|76057_76849_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_001336345.1|76854_77145_-	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001083725.1|77256_77754_-	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_000845039.1|77898_78912_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_000454193.1|79114_79465_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000147567.1|79590_80151_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_001138064.1|80153_83120_+|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
WP_000656305.1|83186_83564_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000412211.1|83764_84424_-	type A-1 chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
WP_176716597.1|85392_85632_+	His-Xaa-Ser system protein HxsD	NA	NA	NA	NA	NA
WP_004152560.1|85631_87020_+	His-Xaa-Ser system radical SAM maturase HxsB	NA	S5VT21	Leptospira_phage	29.0	1.1e-50
WP_000005560.1|87012_88125_+	His-Xaa-Ser system radical SAM maturase HxsC	NA	S5WIP3	Leptospira_phage	33.8	1.5e-47
WP_004118217.1|88121_88757_+	His-Xaa-Ser repeat protein HxsA	NA	NA	NA	NA	NA
WP_020956879.1|89304_89691_+|transposase	transposase	transposase	B6DZU5	Stx2-converting_phage	90.7	1.1e-58
WP_004152557.1|89687_90035_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	95.7	2.0e-59
WP_004118832.1|93857_95591_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.6	6.9e-15
WP_004118225.1|95598_96546_-	acetamidase/formamidase family protein	NA	A0A1V0S8X7	Catovirus	22.7	9.6e-11
WP_004152278.1|96590_98195_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004118227.1|98207_99128_-	ABC transporter permease	NA	NA	NA	NA	NA
98324:98341	attL	CCACCTGTTGAATCGCCT	NA	NA	NA	NA
WP_004152279.1|99127_99976_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_004118229.1|99972_100566_-	ANTAR domain-containing protein	NA	NA	NA	NA	NA
WP_004118840.1|100562_101690_-	transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004118231.1|101974_102142_-|integrase	integrase	integrase	NA	NA	NA	NA
WP_161989521.1|102070_102283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004118235.1|103244_103766_+	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
WP_004118237.1|103762_104716_+	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_004152280.1|104801_107126_+	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
WP_004118241.1|107170_108073_+	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_004118243.1|108069_109068_+	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_004152281.1|109064_110021_+	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	NA	NA	NA	NA
WP_004152282.1|110021_110789_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	25.2	9.8e-14
WP_004118251.1|110887_111181_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	96.9	2.7e-49
WP_165765869.1|111511_111799_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004152284.1|112132_113143_-	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_004152286.1|113603_114686_+	DNA-binding transcriptional repressor LacI	NA	C6ZCU4	Enterobacteria_phage	96.4	6.8e-186
WP_004152287.1|114807_117882_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	96.7	0.0e+00
WP_003846917.1|117933_119187_+	lactose permease	NA	NA	NA	NA	NA
WP_004152290.1|120892_123202_+	TerB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_004152291.1|123205_124522_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_000093087.1|124518_126714_+	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_004152292.1|128160_129018_-	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_004171457.1|129010_129088_-	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_004199332.1|129304_129583_-	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_009485932.1|129903_130383_-	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	35.2	9.8e-20
WP_004152296.1|130723_131002_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_004178051.1|131003_133325_-|bacteriocin	klebicin B-related nuclease bacteriocin	bacteriocin	NA	NA	NA	NA
136460:136477	attR	CCACCTGTTGAATCGCCT	NA	NA	NA	NA
>prophage 1
NZ_CP015824	Klebsiella pneumoniae isolate blood sample 2 plasmid 2, complete sequence	103147	44209	63042	103147	integrase,transposase	Escherichia_phage(28.57%)	20	50702:50719	72240:72257
WP_004152392.1|44209_47239_+|transposase	Tn3-like element Tn4401 family transposase	transposase	NA	NA	NA	NA
WP_004199214.1|47345_48371_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	50.3	1.4e-87
WP_004152394.1|48367_49147_+	IS21-like element ISKpn7 family helper ATPase IstB	NA	A0A2L1IVB6	Escherichia_phage	61.8	2.5e-89
WP_004152396.1|49434_50316_+	carbapenem-hydrolyzing class A beta-lactamase KPC-3	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.8e-73
WP_004152397.1|50565_51885_-|transposase	IS1182-like element ISKpn6 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
50702:50719	attL	ATCGACTTGCGCCGGCGG	NA	NA	NA	NA
WP_004152398.1|52161_53346_-|transposase	ISAs1-like element ISKpn31 family transposase	transposase	NA	NA	NA	NA
WP_004152400.1|53849_54209_+	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	62.0	3.6e-19
WP_004152334.1|55424_56135_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_001044770.1|56208_56625_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_001261282.1|56621_56852_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_072093212.1|56808_57270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004153649.1|57504_57711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152336.1|57756_58065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152337.1|58092_58422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004171440.1|58447_58846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152339.1|58852_59185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152340.1|59184_59967_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	90.2	4.6e-51
WP_011977773.1|60858_61089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152341.1|61180_61654_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_004152342.1|61773_63042_-|transposase	ISL3-like element ISKpn25 family transposase	transposase	Q6V7R1	Burkholderia_virus	34.7	5.2e-60
72240:72257	attR	ATCGACTTGCGCCGGCGG	NA	NA	NA	NA
>prophage 2
NZ_CP015824	Klebsiella pneumoniae isolate blood sample 2 plasmid 2, complete sequence	103147	67617	79709	103147		Enterobacteria_phage(25.0%)	12	NA	NA
WP_004152345.1|67617_69645_-	SAM-dependent DNA methyltransferase	NA	A0A220A2U5	Liberibacter_phage	26.6	2.1e-26
WP_004227314.1|69756_69972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152347.1|70196_70529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152348.1|70905_71880_-	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	62.3	1.4e-105
WP_004152349.1|71876_73082_-	AAA family ATPase	NA	Q1MVJ3	Enterobacteria_phage	89.0	7.3e-205
WP_004152350.1|73403_74300_-	replication initiation protein	NA	Q71TL8	Escherichia_phage	53.8	3.3e-69
WP_004152351.1|74700_75972_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.7	3.6e-154
WP_004152352.1|75971_76403_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	52.5	1.0e-28
WP_004152353.1|76634_77606_+	mediator of plasmid stability	NA	A0A222YXF2	Escherichia_phage	46.8	1.1e-73
WP_004152354.1|77608_78280_+	plasmid partitioning/stability family protein	NA	NA	NA	NA	NA
WP_001568040.1|78340_78571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152355.1|79007_79709_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.7	7.1e-27
>prophage 1
NZ_CP015825	Klebsiella pneumoniae isolate blood sample 2 plasmid 3, complete sequence	43322	19040	29338	43322	transposase	Escherichia_phage(50.0%)	8	NA	NA
WP_004199413.1|19040_22058_+|transposase	Tn3-like element IS3000 family transposase	transposase	A0A125RQ78	Bacillus_phage	24.7	5.5e-52
WP_002903955.1|23266_24169_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_002210513.1|24430_25192_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_004176269.1|25212_26073_-	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_004217321.1|26209_26914_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_001549892.1|27306_27546_-	hypothetical protein	NA	I6PD82	Cronobacter_phage	55.1	4.4e-21
WP_001549893.1|27632_28295_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	29.1	9.7e-10
WP_000516402.1|28675_29338_+	peptidyl-arginine deiminase	NA	E5FFJ3	Burkholderia_phage	25.2	2.6e-07
