The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP012396	Salmonella enterica strain FORC_019 chromosome, complete genome	4680751	1414852	1420905	4680751		Salmonella_virus(50.0%)	6	NA	NA
WP_105789229.1|1414852_1415020_+	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	63.5	1.3e-11
WP_105789228.1|1415035_1415179_+	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	82.9	1.7e-12
WP_000400616.1|1416168_1418091_-	acyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	77.3	5.6e-300
WP_000703599.1|1418108_1418363_-	glycosyltransferase	NA	A8CG95	Salmonella_phage	79.5	3.1e-25
WP_001576268.1|1418331_1418721_-	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	85.6	1.1e-50
WP_000377779.1|1419963_1420905_-	membrane protein	NA	E7DYY8	Enterobacteria_phage	87.8	1.6e-146
>prophage 2
NZ_CP012396	Salmonella enterica strain FORC_019 chromosome, complete genome	4680751	1657338	1666509	4680751	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569168.1|1657338_1658286_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	2.8e-10
WP_000824854.1|1658269_1659001_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1658981_1659089_-	protein YohO	NA	NA	NA	NA	NA
WP_001240420.1|1659148_1659880_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	86.9	2.5e-99
WP_000272845.1|1660102_1661788_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_000598637.1|1661784_1662504_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950414.1|1662550_1663018_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	89.7	4.3e-73
WP_001197951.1|1663074_1663605_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703145.1|1663776_1664235_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	6.4e-53
WP_000195340.1|1664475_1666509_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
>prophage 3
NZ_CP012396	Salmonella enterica strain FORC_019 chromosome, complete genome	4680751	1733707	1744214	4680751		Enterobacteria_phage(37.5%)	10	NA	NA
WP_001144948.1|1733707_1735111_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	4.0e-21
WP_000981469.1|1735288_1736182_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697846.1|1736558_1737644_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
WP_001023658.1|1737643_1738543_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.0	5.1e-30
WP_000857535.1|1738590_1739469_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	2.1e-108
WP_000973709.1|1739469_1740021_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	1.3e-52
WP_066038535.1|1740026_1741001_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000648783.1|1741016_1741790_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000565913.1|1741794_1742874_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.5	1.7e-16
WP_000126349.1|1742900_1744214_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
>prophage 4
NZ_CP012396	Salmonella enterica strain FORC_019 chromosome, complete genome	4680751	1857137	1904633	4680751	holin,portal,integrase,head,capsid,tail,plate,transposase,terminase,protease	Salmonella_phage(77.78%)	60	1860038:1860052	1908228:1908242
WP_001680077.1|1857137_1858412_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	39.9	2.4e-73
WP_001675175.1|1859075_1859366_-	DUF4102 domain-containing protein	NA	H2BDA3	Pseudomonas_phage	49.1	1.2e-07
WP_000598920.1|1859737_1860535_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
1860038:1860052	attL	AGGGATGCCGCTGGC	NA	NA	NA	NA
WP_000532847.1|1860826_1861816_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	100.0	8.6e-196
WP_000414876.1|1861817_1862060_-	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	100.0	9.5e-40
WP_001061370.1|1862084_1862654_-	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	99.5	9.3e-110
WP_000208076.1|1862650_1863514_-	DUF551 domain-containing protein	NA	S4TSR6	Salmonella_phage	49.2	5.2e-64
WP_000267991.1|1863510_1863804_-	hypothetical protein	NA	A0A1V0E5L2	Salmonella_phage	100.0	1.5e-50
WP_000065085.1|1864075_1864435_-	Eaf protein	NA	T1SA95	Salmonella_phage	89.9	1.0e-58
WP_000071068.1|1864431_1864947_-	DUF262 domain-containing protein	NA	A0A2H4FWH2	Salmonella_phage	96.5	1.3e-94
WP_000764235.1|1864943_1865174_-	hypothetical protein	NA	Q8HAA4	Salmonella_phage	100.0	2.0e-34
WP_000008351.1|1865244_1865784_-	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	100.0	2.6e-98
WP_000551790.1|1865878_1866796_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	59.7	1.3e-97
WP_000078504.1|1867365_1867617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067433.1|1867692_1867878_-	hypothetical protein	NA	A0A1C9II97	Salmonella_phage	73.3	1.2e-13
WP_001020644.1|1868083_1868779_-	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	99.6	2.7e-127
WP_001191666.1|1868876_1869101_+	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_000509728.1|1869129_1869684_+	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	98.9	3.4e-101
WP_001087406.1|1869680_1870838_+	peptidase	NA	Q8HA97	Salmonella_phage	98.4	2.8e-214
WP_000620702.1|1870834_1871059_+	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
WP_000096529.1|1871055_1872030_+	hypothetical protein	NA	A0A1C9IHW0	Salmonella_phage	97.8	1.2e-165
WP_000054227.1|1872026_1872500_+	PerC family transcriptional regulator	NA	A0A1C9IHW0	Salmonella_phage	94.6	3.9e-53
WP_000200166.1|1872496_1873378_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	96.2	8.3e-166
WP_000779149.1|1873386_1873776_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	99.2	1.9e-69
WP_001061459.1|1873792_1874653_+	KilA-N domain-containing protein	NA	A0A192Y6F8	Salmonella_phage	98.3	1.5e-159
WP_012543375.1|1874660_1875650_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.6	1.9e-190
WP_001047141.1|1875663_1876416_+	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.0	1.9e-134
WP_000357930.1|1876465_1877539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000765639.1|1877551_1878124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001294874.1|1878212_1878602_+	membrane protein	NA	K7PHB9	Enterobacterial_phage	71.0	1.8e-40
WP_000226304.1|1878588_1878870_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	80.6	3.3e-36
WP_001075993.1|1878869_1879487_+	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	78.9	3.2e-92
WP_000127618.1|1879483_1880023_+	DUF2514 domain-containing protein	NA	A0A0A0P0G7	Enterobacteria_phage	37.2	5.3e-06
WP_001135228.1|1880046_1880397_+	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	95.7	3.1e-63
WP_000501481.1|1880543_1880981_+|terminase	phage terminase small subunit P27 family	terminase	A0A1J0GV10	Halomonas_phage	63.7	1.6e-32
WP_000257219.1|1880980_1882711_+|terminase	terminase large subunit	terminase	Q8W631	Enterobacteria_phage	58.9	3.2e-198
WP_077905357.1|1882982_1884077_+|portal	phage portal protein	portal	A0A1W6JP33	Morganella_phage	82.7	7.3e-180
WP_000003793.1|1884069_1884672_+|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	91.5	2.0e-99
WP_000766103.1|1884681_1885911_+|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	90.9	1.8e-206
WP_000927251.1|1885990_1886314_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	72.0	2.6e-40
WP_000776844.1|1886310_1886715_+|head	phage head closure protein	head	A0A192Y6C2	Salmonella_phage	96.3	1.5e-69
WP_001135695.1|1886686_1887199_+	hypothetical protein	NA	Q8HAC8	Salmonella_phage	93.5	1.4e-85
WP_000779215.1|1887195_1887756_+	hypothetical protein	NA	A0A192Y5U4	Salmonella_phage	99.5	3.0e-105
WP_000497739.1|1887759_1887924_+	DUF2635 domain-containing protein	NA	Q8HAC6	Salmonella_phage	100.0	1.0e-24
WP_001007993.1|1887913_1889410_+|tail	tail sheath protein	tail	Q8HAC5	Salmonella_phage	99.2	3.0e-277
WP_000515952.1|1889409_1889766_+|tail	tail protein	tail	A0A192Y8K0	Salmonella_phage	100.0	2.6e-62
WP_000588852.1|1889762_1890089_+|tail	phage tail assembly protein	tail	Q8HAC3	Salmonella_phage	99.1	2.3e-52
WP_000785387.1|1890173_1892102_+|tail	phage tail tape measure protein	tail	Q8HAC2	Salmonella_phage	99.5	0.0e+00
WP_000863817.1|1892135_1893476_+	DNA circularization protein	NA	A0A192Y5U9	Salmonella_phage	99.1	1.1e-249
WP_001066630.1|1893472_1894531_+|plate	baseplate protein	plate	A0A192Y7L7	Salmonella_phage	100.0	1.3e-202
WP_001273650.1|1894530_1895064_+|plate	phage baseplate assembly protein	plate	Q8HAB9	Salmonella_phage	99.4	2.1e-95
WP_000605050.1|1895068_1895482_+	hypothetical protein	NA	Q8HAB8	Salmonella_phage	100.0	1.1e-75
WP_001699732.1|1895474_1896554_+|plate	baseplate J/gp47 family protein	plate	A0A192Y6E4	Salmonella_phage	99.4	5.5e-204
WP_001207832.1|1896556_1897144_+	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	100.0	2.9e-114
WP_000554738.1|1897130_1898693_+	hypothetical protein	NA	Q8HAB4	Salmonella_phage	99.8	9.8e-287
WP_015701331.1|1898662_1899262_+|tail	tail fiber assembly protein	tail	Q8HAB3	Salmonella_phage	100.0	5.9e-107
WP_000492926.1|1899546_1900554_-	type III secretion system effector arginine glycosyltransferase	NA	Q8HAB2	Salmonella_phage	100.0	7.9e-197
WP_001526483.1|1900766_1900988_+	helix-turn-helix domain-containing protein	NA	Q8HAB1	Salmonella_phage	100.0	1.2e-36
WP_001176778.1|1902330_1903149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001028172.1|1903610_1904633_+|transposase	IS110-like element ISSaen1 family transposase	transposase	NA	NA	NA	NA
1908228:1908242	attR	AGGGATGCCGCTGGC	NA	NA	NA	NA
>prophage 5
NZ_CP012396	Salmonella enterica strain FORC_019 chromosome, complete genome	4680751	2436819	2452763	4680751	holin,tRNA	Escherichia_phage(62.5%)	21	NA	NA
WP_001082296.1|2436819_2437254_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.1	9.4e-30
WP_000159240.1|2437303_2437642_-	EamA family transporter	NA	NA	NA	NA	NA
WP_000802786.1|2438487_2439033_-	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	83.4	2.3e-89
WP_000445513.1|2439029_2439311_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	49.4	1.3e-16
WP_001688615.1|2439300_2439489_-	hypothetical protein	NA	Q8W636	Enterobacteria_phage	57.4	9.4e-11
WP_000900605.1|2439410_2439806_-	tellurite resistance TerB family protein	NA	Q71TK7	Escherichia_phage	88.9	4.7e-44
WP_000640113.1|2441976_2442513_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	70.9	1.4e-70
WP_000774470.1|2442509_2442800_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	76.0	5.1e-40
WP_000940751.1|2442799_2443399_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	82.9	5.5e-97
WP_000882662.1|2443922_2444135_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	2.5e-28
WP_000556390.1|2444504_2445437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001033796.1|2445433_2445988_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001676916.1|2446149_2446479_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.7	6.5e-23
WP_001227859.1|2446751_2447219_+	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	66.9	1.0e-53
WP_085981757.1|2447603_2447759_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	48.9	2.6e-06
WP_000004762.1|2447866_2448388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000560208.1|2448825_2449047_+	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	83.6	7.9e-33
WP_000800272.1|2449131_2449449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001676915.1|2449476_2450094_+	exodeoxyribonuclease	NA	A0A088CD28	Shigella_phage	41.9	2.5e-36
WP_001156217.1|2450410_2451346_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	97.3	7.2e-144
WP_000123686.1|2451389_2452763_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	2.1e-51
>prophage 6
NZ_CP012396	Salmonella enterica strain FORC_019 chromosome, complete genome	4680751	2644053	2693303	4680751	lysis,holin,integrase,tail,protease	Enterobacteria_phage(26.09%)	48	2673818:2673847	2693439:2693468
WP_000984498.1|2644053_2644935_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_001091237.1|2645128_2647177_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	8.0e-87
WP_000431401.1|2647196_2647883_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_000145727.1|2647980_2648565_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_001207294.1|2648606_2649890_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_001529852.1|2649858_2652492_+	PqiB family protein	NA	NA	NA	NA	NA
WP_001531515.1|2652569_2654009_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_024131108.1|2654126_2654363_+	DUF1480 family protein	NA	NA	NA	NA	NA
WP_000457838.1|2654473_2654665_+	YebW family protein	NA	NA	NA	NA	NA
WP_000986173.1|2654683_2655334_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.9	7.2e-58
WP_001134856.1|2655557_2655722_-	membrane protein	NA	NA	NA	NA	NA
WP_000182071.1|2656006_2656729_-	SPI-1 type III secretion system guanine nucleotide exchange factor SopE2	NA	NA	NA	NA	NA
WP_000422882.1|2657412_2657808_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	32.8	9.2e-16
WP_000030934.1|2658137_2658614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001025515.1|2658986_2659406_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001576019.1|2659778_2660048_+	hypothetical protein	NA	B6SCX2	Bacteriophage	47.9	3.1e-07
WP_001576018.1|2660213_2660354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001233445.1|2663492_2664407_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000480735.1|2664539_2664698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000848072.1|2664707_2665322_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_000457876.1|2666456_2666582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012543349.1|2667151_2667352_+	phage encoded PagK	NA	NA	NA	NA	NA
WP_001687735.1|2667448_2667949_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	77.4	1.5e-63
WP_000348541.1|2670053_2670545_-	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	56.2	7.1e-42
WP_001576014.1|2670599_2670788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000789530.1|2670852_2671020_+	lytic enzyme	NA	NA	NA	NA	NA
WP_001050883.1|2671276_2671810_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	43.0	5.4e-11
WP_001013467.1|2671863_2672094_-	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
WP_077681935.1|2672283_2672778_+	RecE	NA	A0A0U2I1R6	Escherichia_phage	70.3	3.7e-22
WP_000622159.1|2673421_2673691_+|integrase	tyrosine-type recombinase/integrase	integrase	K7PHK0	Enterobacteria_phage	47.8	2.7e-11
2673818:2673847	attL	AAATAAAAAGAGACCGAATACGATTCCTGT	NA	NA	NA	NA
WP_001536069.1|2674635_2675436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000161704.1|2675915_2676638_+	SPI-1 type III secretion system guanine nucleotide exchange factor SopE	NA	NA	NA	NA	NA
WP_072100756.1|2677188_2678052_-	DUF1983 domain-containing protein	NA	K7PKJ2	Enterobacteria_phage	78.9	9.0e-48
WP_001152416.1|2680692_2681388_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.0e-89
WP_000877926.1|2681477_2682011_+	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_001541990.1|2682905_2683385_-|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
WP_000984586.1|2683402_2683855_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	2.3e-79
WP_001574216.1|2683838_2684168_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_001574215.1|2684443_2685130_+	PipA/GogA/GtgA family type III secretion system effector	NA	Q9MBM0	Phage_Gifsy-2	99.6	1.8e-131
WP_000798708.1|2685490_2685940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001574213.1|2686313_2686838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097218.1|2686934_2687624_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.9	2.1e-60
WP_000784710.1|2687753_2687981_-	DNA breaking-rejoining protein	NA	A0A0M4RU10	Salmonella_phage	66.7	2.2e-14
WP_000940753.1|2687977_2688577_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	82.9	4.7e-96
WP_000972675.1|2688640_2688946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001237395.1|2689577_2691557_-	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	46.3	1.9e-162
WP_001575998.1|2691970_2692249_+	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	37.5	1.4e-10
WP_000087636.1|2692223_2693303_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.5	3.0e-101
2693439:2693468	attR	AAATAAAAAGAGACCGAATACGATTCCTGT	NA	NA	NA	NA
>prophage 7
NZ_CP012396	Salmonella enterica strain FORC_019 chromosome, complete genome	4680751	2865695	2906393	4680751	tail,protease	Salmonella_phage(28.57%)	40	NA	NA
WP_000938186.1|2865695_2866376_+|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	71.0	2.2e-81
WP_000374046.1|2866994_2867654_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
WP_000904449.1|2867740_2868070_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000072884.1|2868066_2868348_-	acylphosphatase	NA	NA	NA	NA	NA
WP_000548080.1|2868396_2869176_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000859416.1|2869201_2869750_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000140478.1|2869964_2871176_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000561983.1|2871233_2871551_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_001676378.1|2871595_2872009_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_000847719.1|2872182_2872845_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000424187.1|2872939_2873398_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000420505.1|2873433_2875488_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_001261222.1|2875611_2876058_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000950876.1|2876076_2878230_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_066038538.1|2878216_2878822_-	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000288733.1|2879038_2879548_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001674965.1|2879904_2880957_+	porin OmpA	NA	NA	NA	NA	NA
WP_000877172.1|2881028_2881481_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000156448.1|2881666_2883427_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000227928.1|2883495_2884014_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_001537784.1|2884113_2884281_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000759136.1|2884536_2885100_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_000433414.1|2885096_2886737_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000333139.1|2886741_2887995_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000053044.1|2888009_2889917_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
WP_001086485.1|2889929_2892038_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000224079.1|2892136_2893246_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001574119.1|2893242_2893785_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000291723.1|2893950_2894961_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_000193790.1|2895168_2897781_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	6.3e-20
WP_000497441.1|2898207_2898399_+	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_001525490.1|2898669_2899356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000334547.1|2899715_2900342_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_001674638.1|2900989_2901958_-	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.4	3.0e-193
WP_072100753.1|2902183_2902432_+|tail	phage tail protein	tail	A0A1B0VCD0	Salmonella_phage	66.2	2.1e-18
WP_000143167.1|2902435_2903017_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_000583382.1|2903016_2904726_-|tail	tail fiber protein	tail	A0A0U2SAV1	Escherichia_phage	66.0	1.5e-91
WP_000729406.1|2904722_2905349_-	hypothetical protein	NA	A0A0U2RK03	Escherichia_phage	71.6	3.3e-92
WP_000274547.1|2905332_2905962_-	hypothetical protein	NA	A0A0U2RJZ0	Escherichia_phage	65.9	1.6e-75
WP_001676370.1|2905982_2906393_+	enterohemolysin	NA	H6WRX0	Salmonella_phage	100.0	5.0e-33
>prophage 8
NZ_CP012396	Salmonella enterica strain FORC_019 chromosome, complete genome	4680751	2977672	2984985	4680751	integrase,protease	Ralstonia_phage(16.67%)	7	2972469:2972483	2983721:2983735
2972469:2972483	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
WP_001539594.1|2977672_2978050_+|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
WP_001117984.1|2978211_2978409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000934064.1|2978621_2980898_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000520789.1|2980928_2981249_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000447499.1|2981572_2981794_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000125875.1|2981923_2983870_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
2983721:2983735	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
WP_001201751.1|2983866_2984985_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
>prophage 1
NZ_CP012397	Salmonella enterica strain FORC_019 plasmid pFORC19, complete sequence	116939	2659	47362	116939	transposase	Escherichia_phage(21.43%)	52	NA	NA
WP_001067855.1|2659_3364_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000018329.1|3514_4330_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
WP_001067855.1|4519_5224_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_014837927.1|5260_6388_-	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
WP_000248278.1|6438_6666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000951934.1|6689_6881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000587837.1|7362_7905_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000557454.1|7917_8778_-	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
WP_077951587.1|8920_9256_+	hypothetical protein	NA	A4KWT9	Enterobacteria_phage	100.0	2.8e-37
WP_001067858.1|9201_9906_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000077926.1|10060_10342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000398480.1|10391_10583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001371937.1|10674_11046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000341066.1|11388_11781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024136327.1|12412_12706_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000088046.1|12710_14036_+	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_000134171.1|14096_14303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985911.1|14404_14815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001572439.1|14827_15643_+	HNH endonuclease	NA	G0X580	Salmonella_phage	36.5	1.1e-15
WP_001043843.1|15896_16322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001572440.1|17066_17366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032192809.1|17678_19718_-	ATP-dependent helicase	NA	E3T5J8	Cafeteria_roenbergensis_virus	24.8	2.5e-24
WP_001572342.1|19714_20701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001194555.1|21731_21935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001287392.1|22276_22681_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_000175476.1|23178_23415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001572344.1|23456_23912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000490638.1|23971_24637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001426317.1|24694_25075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000193209.1|25717_26536_+	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_001572381.1|26532_27738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001201739.1|28559_28943_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	36.3	4.1e-13
WP_000609174.1|28939_29287_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	95.7	2.7e-59
WP_001000406.1|29336_30872_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	88.1	4.8e-262
WP_000833382.1|32032_33460_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	52.3	3.4e-100
WP_001572389.1|33674_34190_+	thermonuclease family protein	NA	A0A1X6WF84	Pacmanvirus	38.6	2.1e-07
WP_000975182.1|34192_35089_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015059496.1|35310_35544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001572393.1|36205_36436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000185304.1|36772_37234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000074418.1|37263_37671_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062873134.1|37721_38015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066038544.1|38007_38250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000608644.1|38473_39736_+|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_000239590.1|39991_40867_+	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
WP_001393253.1|40913_41246_-	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
WP_031613424.1|41471_41822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001351729.1|43686_44079_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_000058717.1|44216_45101_+	EamA family transporter	NA	NA	NA	NA	NA
WP_000804064.1|45132_46332_-	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_000164043.1|46437_47088_+	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_000844627.1|47119_47362_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP012397	Salmonella enterica strain FORC_019 plasmid pFORC19, complete sequence	116939	52853	70517	116939	transposase,integrase	Escherichia_phage(40.0%)	19	57115:57127	70734:70746
WP_000935452.1|52853_54158_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_001067855.1|54204_54909_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000098781.1|55211_56876_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_077907510.1|56808_57834_+	AAA family ATPase	NA	NA	NA	NA	NA
57115:57127	attL	CGGCTCGCCACGC	NA	NA	NA	NA
WP_001121400.1|58022_59060_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_000346690.1|59667_60561_+	virulence genes transcriptional activator SpvR	NA	NA	NA	NA	NA
WP_001576629.1|60734_60899_+	glycoside hydrolase family protein	NA	A0A0M4R365	Salmonella_phage	63.0	3.3e-12
WP_001676649.1|61072_61840_+	virulence protein SpvA	NA	NA	NA	NA	NA
WP_001676648.1|62021_63797_+	SPI-2 type III secretion system effector NAD(+)--protein-arginine ADP-ribosyltransferase SpvB	NA	NA	NA	NA	NA
WP_001122242.1|64077_64803_+	type III secretion system effector phosphothreonine lyase SpvC	NA	NA	NA	NA	NA
WP_001676646.1|65064_65715_+	SPI-2 type III secretion system effector cysteine hydrolase SpvD	NA	NA	NA	NA	NA
WP_000064919.1|65841_66267_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	50.4	3.4e-24
WP_001541541.1|66323_66674_+	helix-turn-helix domain-containing protein	NA	A0A077SLN2	Escherichia_phage	80.5	1.9e-44
WP_000900095.1|66740_67301_-	inverse autotransporter beta domain-containing protein	NA	NA	NA	NA	NA
WP_071530243.1|67456_67744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000905606.1|68020_68506_-	membrane protein	NA	NA	NA	NA	NA
WP_001541544.1|68499_69009_-	CaiF/GrlA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000545756.1|69012_69726_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000082169.1|69734_70517_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	91.1	1.6e-51
70734:70746	attR	GCGTGGCGAGCCG	NA	NA	NA	NA
>prophage 3
NZ_CP012397	Salmonella enterica strain FORC_019 plasmid pFORC19, complete sequence	116939	103583	110491	116939	transposase	Escherichia_phage(33.33%)	8	NA	NA
WP_000925628.1|103583_104006_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	52.4	2.0e-29
WP_000457542.1|104005_105280_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	64.5	3.9e-156
WP_000064277.1|105361_106336_-	ParB/RepB/Spo0J family partition protein	NA	A0A1B0V750	Salmonella_phage	53.5	5.1e-84
WP_000427676.1|106335_107541_-	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.3	1.5e-162
WP_000728919.1|107955_108897_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	54.7	4.7e-74
WP_000176303.1|108893_109499_-	DUF2913 family protein	NA	NA	NA	NA	NA
WP_001527010.1|109555_109891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001541564.1|110074_110491_-	hypothetical protein	NA	O64348	Escherichia_phage	42.9	8.2e-07
