The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP013753	Lactiplantibacillus plantarum strain DF chromosome, complete genome	3423963	2460	45890	3423963	tRNA,integrase,capsid,portal,terminase,tail,head,protease	Lactobacillus_phage(77.78%)	60	24148:24161	41452:41465
WP_016058335.1|2460_2652_-	hypothetical protein	NA	E9LUR0	Lactobacillus_phage	100.0	1.5e-27
WP_016058334.1|2648_3032_-	hypothetical protein	NA	E9LUQ9	Lactobacillus_phage	100.0	3.9e-64
WP_021732001.1|3233_3872_-|tail	phage tail protein	tail	E9LUQ8	Lactobacillus_phage	92.9	3.7e-107
WP_022638398.1|3872_4256_-	DUF806 family protein	NA	E9LUQ7	Lactobacillus_phage	96.9	1.0e-64
WP_021732003.1|4252_4693_-	hypothetical protein	NA	E9LUQ6	Lactobacillus_phage	97.9	3.2e-78
WP_021732004.1|4682_5045_-|head	phage head closure protein	head	E9LUQ5	Lactobacillus_phage	99.2	1.5e-65
WP_016058329.1|5028_5367_-|head,tail	phage gp6-like head-tail connector protein	head,tail	E9LUQ4	Lactobacillus_phage	100.0	7.0e-57
WP_022638399.1|5439_6672_-|capsid	phage major capsid protein	capsid	E9LUQ3	Lactobacillus_phage	88.0	8.5e-201
WP_022638400.1|6671_7430_-|protease	Clp protease ClpP	protease	E9LUQ2	Lactobacillus_phage	96.0	1.2e-128
WP_022638401.1|7407_8601_-|portal	phage portal protein	portal	E9LUQ1	Lactobacillus_phage	98.7	6.9e-224
WP_022638402.1|8603_8798_-	DUF1056 family protein	NA	E9LUQ0	Lactobacillus_phage	93.8	5.3e-25
WP_063491136.1|8787_10686_-|terminase	terminase large subunit	terminase	E9LUP9	Lactobacillus_phage	92.6	0.0e+00
WP_016511011.1|10695_11151_-|terminase	phage terminase small subunit P27 family	terminase	E9LUP8	Lactobacillus_phage	96.7	3.0e-79
WP_050578353.1|11328_11868_-	HNH endonuclease	NA	A0A2D1GPF4	Lactobacillus_phage	48.4	6.9e-30
WP_022638404.1|11870_12341_-	HNH endonuclease	NA	E9LUP7	Lactobacillus_phage	75.2	1.5e-65
WP_022638405.1|12351_12531_-	hypothetical protein	NA	E9LUP6	Lactobacillus_phage	67.8	4.3e-13
WP_022638406.1|12733_13285_-	hypothetical protein	NA	A8ASQ2	Listeria_phage	38.3	1.6e-21
WP_022638818.1|13820_14246_-	phage transcriptional activator RinA	NA	E9LUP5	Lactobacillus_phage	81.6	3.1e-62
WP_033607948.1|14427_14622_-	hypothetical protein	NA	E9LUP4	Lactobacillus_phage	52.7	8.0e-05
WP_054598401.1|14618_15035_-	hypothetical protein	NA	E9LUP3	Lactobacillus_phage	54.9	4.2e-35
WP_022638825.1|15031_15229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054598400.1|15301_15736_-	hypothetical protein	NA	Q5ULS7	Lactobacillus_virus	53.2	7.2e-14
WP_022638755.1|15719_15896_-	hypothetical protein	NA	E9LUP2	Lactobacillus_phage	81.0	8.8e-19
WP_155118607.1|15925_16093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022638754.1|16267_16426_-	hypothetical protein	NA	A0A2P0ZLB5	Lactobacillus_phage	92.3	3.9e-18
WP_022638753.1|16418_16727_-	hypothetical protein	NA	E9LUN7	Lactobacillus_phage	96.1	1.7e-49
WP_022638752.1|16862_17648_-	ATP-binding protein	NA	E9LUN6	Lactobacillus_phage	90.0	2.2e-130
WP_022638751.1|17647_18355_-	conserved phage C-terminal domain-containing protein	NA	A0A0P0I7Q1	Lactobacillus_phage	59.3	1.8e-33
WP_022638750.1|18396_19095_-	DUF968 domain-containing protein	NA	E9LUU3	Lactobacillus_phage	92.2	3.4e-122
WP_022638749.1|19141_19813_-	DUF669 domain-containing protein	NA	E9LUU2	Lactobacillus_phage	87.9	2.8e-81
WP_022638748.1|19814_20477_-	AAA family ATPase	NA	E9LUU1	Lactobacillus_phage	97.7	1.5e-119
WP_022638747.1|20477_21338_-	DUF1351 domain-containing protein	NA	A0A2D1GPE4	Lactobacillus_phage	36.1	3.4e-31
WP_022638746.1|21337_21484_-	hypothetical protein	NA	E9LUT9	Lactobacillus_phage	87.2	1.3e-15
WP_022638745.1|21766_22006_-	hypothetical protein	NA	E9LUT6	Lactobacillus_phage	82.4	5.9e-34
WP_033607908.1|22467_22749_+	CRISPR-associated endonuclease Cas2	NA	A0A2H4JEH2	uncultured_Caudovirales_phage	42.9	1.9e-15
WP_022638743.1|22742_22889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022638742.1|22957_23446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022638741.1|23423_23630_-	hypothetical protein	NA	A0A182BQC3	Lactococcus_phage	57.4	6.0e-11
WP_022638740.1|23659_24412_-	phage antirepressor KilAC domain-containing protein	NA	E9LUT0	Lactobacillus_phage	96.5	6.4e-58
24148:24161	attL	AACGATTAAATCGT	NA	NA	NA	NA
WP_022638739.1|24424_24640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022638738.1|24899_25229_+	helix-turn-helix transcriptional regulator	NA	A0A0P0IZG9	Lactobacillus_phage	38.7	1.8e-12
WP_033607910.1|25259_25649_+	ImmA/IrrE family metallo-endopeptidase	NA	D6PSS8	Lactobacillus_phage	55.8	7.1e-37
WP_022638736.1|25712_26288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022638735.1|26293_26494_+	hypothetical protein	NA	E9LUS6	Lactobacillus_phage	98.5	3.2e-25
WP_022638734.1|26944_28126_+|integrase	site-specific integrase	integrase	B4XYR4	Lactobacillus_phage	37.4	1.2e-58
WP_003641354.1|28367_29702_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	30.9	2.9e-37
WP_003644135.1|29714_30722_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_003638174.1|30908_31109_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	71.4	3.1e-20
WP_003641352.1|31452_31818_+	DUF4828 domain-containing protein	NA	NA	NA	NA	NA
WP_013355365.1|31973_32750_-	lysozyme	NA	A0A141HSE6	Bacillus_phage	31.1	2.6e-06
WP_003644133.1|32774_33653_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_022638540.1|33777_34662_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003644132.1|34654_35971_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_003646275.1|36210_38550_-	cation-translocating P-type ATPase	NA	M1HI01	Paramecium_bursaria_Chlorella_virus	24.8	7.1e-39
WP_003641346.1|38816_39395_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_022638541.1|39848_41222_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	F5CA72	Streptococcus_phi-m46.1-like_phage	52.2	5.5e-124
WP_003641344.1|41555_42578_-	diacylglycerol kinase	NA	A0A1V0SBJ0	Catovirus	26.5	2.6e-17
41452:41465	attR	AACGATTAAATCGT	NA	NA	NA	NA
WP_003641343.1|42682_44107_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_003644129.1|44106_45570_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_003641341.1|45569_45890_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
>prophage 2
NZ_CP013753	Lactiplantibacillus plantarum strain DF chromosome, complete genome	3423963	427352	518693	3423963	holin,tRNA,integrase,capsid,portal,terminase,tail,protease	Lactobacillus_phage(54.39%)	112	479366:479382	527094:527110
WP_011101144.1|427352_427997_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003640983.1|428161_428839_-	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_013355247.1|429007_430990_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	29.2	4.4e-50
WP_011101143.1|431876_432923_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	41.4	1.0e-61
WP_003640979.1|432927_433383_-	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_011101142.1|433375_433954_-	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_003640977.1|433937_434663_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_003640976.1|434942_435995_+	PhnD/SsuA/transferrin family substrate-binding protein	NA	NA	NA	NA	NA
WP_022638340.1|436032_436803_+	phosphonate ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	31.8	4.9e-13
WP_022638341.1|436792_437596_+	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_003640973.1|437592_438447_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_013355242.1|438471_439269_+	phosphonoacetaldehyde hydrolase	NA	NA	NA	NA	NA
WP_013355241.1|439290_440391_+	2-aminoethylphosphonate--pyruvate transaminase	NA	NA	NA	NA	NA
WP_013355240.1|440524_441520_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.5	2.0e-51
WP_003640969.1|441658_442444_-	acyl-ACP thioesterase	NA	NA	NA	NA	NA
WP_013355239.1|442447_443344_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	55.7	4.4e-82
WP_003640967.1|443442_443790_-	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	33.3	2.4e-12
WP_003640966.1|443814_444834_-	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	33.5	2.1e-32
WP_003640965.1|444850_445180_-	cyclic-di-AMP receptor	NA	NA	NA	NA	NA
WP_003643941.1|445176_445842_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	52.7	1.4e-53
WP_003640957.1|446239_446491_-	YaaL family protein	NA	NA	NA	NA	NA
WP_003637790.1|446505_447105_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_003640956.1|447120_447429_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_003643940.1|447450_449148_-	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	37.0	3.9e-55
WP_003640954.1|449673_450180_-	nucleoside deaminase	NA	NA	NA	NA	NA
WP_003640953.1|450182_450791_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003640952.1|451013_451244_+	redoxin NrdH	NA	X2KRY7	Enterococcus_phage	40.0	2.8e-09
WP_013355235.1|451382_453548_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	63.3	2.2e-268
WP_003640950.1|453575_454586_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A096XT60	Enterococcus_phage	60.5	3.1e-108
WP_003640949.1|454667_455243_+	TIGR00730 family Rossman fold protein	NA	A0A1G5S9X4	Enterococcus_phage	41.7	6.4e-26
WP_022638342.1|455417_458021_-	bifunctional lysylphosphatidylglycerol flippase/synthetase MprF	NA	NA	NA	NA	NA
WP_013355233.1|458324_458993_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022638343.1|459005_459935_+	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
WP_063491215.1|460736_461615_+	Abi family protein	NA	NA	NA	NA	NA
WP_080476963.1|461700_461910_+	hypothetical protein	NA	O48431	Lactobacillus_phage	44.8	1.7e-05
WP_063491216.1|461961_462588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063491217.1|462587_462779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063491218.1|462967_463345_-|holin	holin	holin	A0A2H4PBB2	Lactobacillus_phage	85.4	2.8e-14
WP_063491219.1|463331_463628_-	hypothetical protein	NA	A0A1I9KK55	Lactobacillus_phage	76.5	9.9e-39
WP_187337720.1|463628_464741_-	LysM peptidoglycan-binding domain-containing protein	NA	O03950	Lactobacillus_phage	33.5	2.5e-34
WP_063491221.1|464794_465007_-	hypothetical protein	NA	A0A0A1ENR9	Lactobacillus_phage	85.2	2.1e-19
WP_063491222.1|465003_466098_-	hypothetical protein	NA	A0A1I9KKB6	Lactobacillus_phage	57.6	3.4e-36
WP_134901158.1|466115_466265_-	XkdX family protein	NA	U5U4L4	Lactobacillus_phage	56.8	3.6e-05
WP_063491223.1|466264_466576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_187337719.1|466587_468747_-	hypothetical protein	NA	M4ZSB3	Bacillus_phage	32.9	1.5e-38
WP_022638353.1|468747_469038_-	hypothetical protein	NA	O03939	Lactobacillus_phage	53.9	2.2e-11
WP_076637296.1|469015_469309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022638355.1|469301_470420_-|tail	phage tail protein	tail	O03938	Lactobacillus_phage	93.8	1.5e-199
WP_022638356.1|470432_471242_-|tail	phage tail family protein	tail	D2KRB8	Lactobacillus_phage	41.2	9.6e-52
WP_063491224.1|471241_476098_-	peptidoglycan DD-metalloendopeptidase family protein	NA	O03937	Lactobacillus_phage	66.8	0.0e+00
WP_063491225.1|476101_476725_-	hypothetical protein	NA	O03936	Lactobacillus_phage	94.4	1.2e-102
WP_063491226.1|476730_477162_-	hypothetical protein	NA	O03935	Lactobacillus_phage	97.2	2.4e-73
WP_063491227.1|477211_477748_-	hypothetical protein	NA	O03972	Lactobacillus_phage	98.9	8.8e-94
WP_022638361.1|477780_478185_-|capsid	phage capsid protein	capsid	O03934	Lactobacillus_phage	96.3	9.0e-67
WP_022638362.1|478184_478532_-|capsid	minor capsid protein	capsid	O03933	Lactobacillus_phage	77.1	4.1e-44
WP_022638363.1|478531_478882_-|capsid	phage capsid protein	capsid	O03932	Lactobacillus_phage	92.2	1.1e-55
WP_022638364.1|478881_479310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022638365.1|479330_480218_-	hypothetical protein	NA	U3PDP8	Lactobacillus_phage	59.4	6.1e-92
479366:479382	attL	CAGGCGTAGCGGCTACG	NA	NA	NA	NA
WP_022638367.1|480911_481175_-	hypothetical protein	NA	O03930	Lactobacillus_phage	48.1	3.4e-14
WP_022638368.1|481181_482342_-|capsid	phage capsid protein	capsid	O03929	Lactobacillus_phage	90.2	2.5e-162
WP_033607818.1|482338_483865_-|portal	phage portal protein	portal	O03928	Lactobacillus_phage	96.3	7.6e-284
WP_068874229.1|483874_485218_-|terminase	PBSX family phage terminase large subunit	terminase	O03927	Lactobacillus_phage	96.0	5.2e-260
WP_080476964.1|485198_485675_-	hypothetical protein	NA	Q597W0	Lactobacillus_virus	58.5	2.1e-38
WP_068874232.1|485820_486009_-	hypothetical protein	NA	E9LUP6	Lactobacillus_phage	85.1	2.0e-16
WP_003642805.1|487064_487526_-	transcriptional regulator	NA	D6PSV8	Lactobacillus_phage	57.0	1.1e-39
WP_022638180.1|487653_487821_-	hypothetical protein	NA	E9LUP4	Lactobacillus_phage	87.2	1.8e-13
WP_022638179.1|487817_488165_-	hypothetical protein	NA	A0A142F1A4	Bacillus_phage	43.4	4.9e-13
WP_187326027.1|488161_488527_-	hypothetical protein	NA	Q5ULS7	Lactobacillus_virus	51.9	1.0e-13
WP_022638177.1|488547_488721_-	hypothetical protein	NA	A0A2K9VC41	Lactobacillus_phage	87.7	4.7e-25
WP_022638176.1|488713_488932_-	hypothetical protein	NA	A0A2P0ZLC3	Lactobacillus_phage	90.2	1.1e-13
WP_022638175.1|488977_489373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022638173.1|489509_489740_-	hypothetical protein	NA	O03916	Lactobacillus_phage	56.6	1.0e-19
WP_022638172.1|489736_490156_-	RusA family crossover junction endodeoxyribonuclease	NA	A8YQM5	Lactobacillus_phage	42.3	1.3e-23
WP_022638171.1|490148_490682_-	hypothetical protein	NA	O03915	Lactobacillus_phage	54.3	2.1e-39
WP_022638170.1|490678_490966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022638169.1|490962_491847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022638168.1|491928_492894_-	hypothetical protein	NA	A6M982	Geobacillus_virus	53.6	1.0e-63
WP_022638167.1|492896_493409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027821907.1|493861_494149_+	hypothetical protein	NA	A0A2H4JEH2	uncultured_Caudovirales_phage	48.9	1.3e-22
WP_063491234.1|494399_494687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011101088.1|494692_495247_-	hypothetical protein	NA	O03909	Lactobacillus_phage	100.0	3.6e-98
WP_060417488.1|495307_495490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062688295.1|495569_495848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154698910.1|495844_495985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062688292.1|496042_496264_+	DUF2188 domain-containing protein	NA	E8ZD70	Streptococcus_phage	66.2	5.0e-19
WP_061468338.1|496260_496461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061468339.1|496457_496685_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011101778.1|496813_497176_+	helix-turn-helix domain-containing protein	NA	A0A2R2ZGJ3	Clostridioides_phage	48.4	1.7e-08
WP_033608843.1|497187_497601_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0M4RD70	Bacillus_phage	32.1	1.5e-05
WP_068874234.1|497627_498500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003644972.1|499012_500215_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A126GGK4	Streptococcus_phage	29.5	2.6e-37
WP_003637775.1|500366_500735_-	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_003643933.1|500796_501300_-	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_003640943.1|501498_502188_-	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_003640942.1|502288_502714_-	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_022638154.1|502815_503703_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003643932.1|503730_504279_-	transcription termination/antitermination protein NusG	NA	NA	NA	NA	NA
WP_003640939.1|504383_504569_-	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_003637768.1|504580_504730_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_050578344.1|504791_505394_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_003640936.1|505900_506446_-	NYN domain-containing protein	NA	NA	NA	NA	NA
WP_003640935.1|506447_507233_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_003640934.1|507204_507615_-	Mini-ribonuclease 3	NA	NA	NA	NA	NA
WP_013355229.1|507616_509029_-|tRNA	cysteine--tRNA ligase	tRNA	F1C979	Terra1_virus	27.7	1.5e-44
WP_003640932.1|509306_510797_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003640931.1|511122_512298_-	PIN/TRAM domain-containing protein	NA	NA	NA	NA	NA
WP_003643928.1|512313_513693_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_011101073.1|514740_515277_-	dUTP diphosphatase	NA	J9PV85	Bacillus_phage	46.4	1.1e-35
WP_003640927.1|515415_515712_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_003640926.1|515720_516404_+	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_003643927.1|516479_517811_+	C1 family peptidase	NA	R4TV59	Phaeocystis_globosa_virus	33.3	5.4e-68
WP_033607779.1|518000_518693_-|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
527094:527110	attR	CAGGCGTAGCGGCTACG	NA	NA	NA	NA
>prophage 3
NZ_CP013753	Lactiplantibacillus plantarum strain DF chromosome, complete genome	3423963	630376	691236	3423963	protease,tRNA,bacteriocin	uncultured_Mediterranean_phage(22.22%)	55	NA	NA
WP_003643835.1|630376_631648_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	43.4	8.4e-95
WP_003642042.1|632116_633730_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	49.9	1.2e-143
WP_003642041.1|633902_634511_-	DNA-directed RNA polymerase subunit delta	NA	NA	NA	NA	NA
WP_003642040.1|634555_634996_-	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
WP_003643833.1|635358_636291_+	lipoate--protein ligase family protein	NA	NA	NA	NA	NA
WP_169484456.1|636299_637658_+	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	32.9	5.2e-26
WP_003642037.1|637677_638487_+	sugar-phosphatase	NA	NA	NA	NA	NA
WP_022638206.1|640421_641408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003642034.1|641490_642513_-	YdcF family protein	NA	NA	NA	NA	NA
WP_003643830.1|642801_643782_-	ribose-phosphate diphosphokinase	NA	A0A2K9L8D8	Tupanvirus	36.3	4.9e-42
WP_022638207.1|644147_644972_-	serine hydrolase	NA	NA	NA	NA	NA
WP_022638208.1|645207_646590_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A2K9L140	Tupanvirus	33.2	5.7e-28
WP_003642030.1|646658_647495_-	pur operon repressor	NA	NA	NA	NA	NA
WP_003642029.1|647987_648251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022638209.1|648265_648808_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_003642026.1|649356_649518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068874482.1|649886_650684_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_003642023.1|650676_651375_-	ABC transporter ATP-binding protein	NA	A0A1V0SGN0	Hokovirus	27.8	1.2e-15
WP_003642022.1|651641_652586_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003643828.1|652895_653762_-	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_003642020.1|653894_654146_-	Veg family protein	NA	NA	NA	NA	NA
WP_003642019.1|654250_655141_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_022638211.1|655137_655701_-	ribonuclease M5	NA	NA	NA	NA	NA
WP_003643825.1|655687_656464_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_022638212.1|656586_657771_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_003643823.1|658003_660055_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	35.8	2.7e-90
WP_003646492.1|660376_660766_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_003642012.1|661362_662205_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_003642011.1|662204_662909_-	NAD-dependent protein deacylase	NA	NA	NA	NA	NA
WP_068874235.1|662930_663890_-	IpaB/EvcA family protein	NA	NA	NA	NA	NA
WP_003642009.1|663882_665157_-	hydroxymethylglutaryl-CoA reductase, degradative	NA	NA	NA	NA	NA
WP_003642008.1|665202_666120_-	Ppx/GppA family phosphatase	NA	NA	NA	NA	NA
WP_003643820.1|666288_667083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003642006.1|667087_668221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003643818.1|668674_669688_-|tRNA	tRNA-dihydrouridine synthase family protein	tRNA	NA	NA	NA	NA
WP_003642004.1|669800_670547_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003642003.1|670696_671593_-	ROK family protein	NA	NA	NA	NA	NA
WP_022638214.1|671713_673150_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	25.8	1.7e-30
WP_003643816.1|673167_674523_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_003642000.1|674745_675168_-	DUF3284 domain-containing protein	NA	NA	NA	NA	NA
WP_003641999.1|675157_675346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003641998.1|675352_676714_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_003641997.1|676786_677497_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003643815.1|677904_678921_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003643814.1|679359_680136_-	carbon-nitrogen family hydrolase	NA	NA	NA	NA	NA
WP_022638217.1|680394_682704_+	ATP-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003641993.1|682798_683002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003641992.1|683139_683826_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003641991.1|683919_684600_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003641990.1|684686_685355_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003641987.1|686201_687578_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_003641986.1|687593_689744_-	peptide cleavage/export ABC transporter	NA	W8CYL7	Bacillus_phage	27.9	6.1e-45
WP_003641985.1|690010_690181_+|bacteriocin	two-peptide bacteriocin plantaricin EF subunit PlnE	bacteriocin	NA	NA	NA	NA
WP_003643811.1|690205_690364_+|bacteriocin	two-peptide bacteriocin plantaricin EF subunit PlnF	bacteriocin	NA	NA	NA	NA
WP_003646470.1|690462_691236_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 4
NZ_CP013753	Lactiplantibacillus plantarum strain DF chromosome, complete genome	3423963	694665	739982	3423963	protease,bacteriocin	Paramecium_bursaria_Chlorella_virus(50.0%)	43	NA	NA
WP_003641979.1|694665_694812_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_003641977.1|695689_696436_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003641976.1|696466_697666_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_003641975.1|697783_697951_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_003641974.1|698078_698279_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_003641973.1|699140_699308_+|bacteriocin	two-peptide bacteriocin plantaricin JK subunit PlnJ	bacteriocin	NA	NA	NA	NA
WP_003641972.1|699338_699512_+|bacteriocin	two-peptide bacteriocin plantaricin JK subunit PlnK	bacteriocin	NA	NA	NA	NA
WP_003641971.1|699508_700177_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_003641969.1|700588_700792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011100995.1|701176_702361_-	cation:proton antiporter	NA	NA	NA	NA	NA
WP_011100994.1|702405_703782_-	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_003641966.1|704307_705123_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_003641965.1|705282_706155_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_022638220.1|706225_707017_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_022638221.1|707020_708175_+	MFS transporter	NA	NA	NA	NA	NA
WP_003641962.1|708178_708796_+	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_003641960.1|709177_709453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003641956.1|710723_711131_-	immunity 63 family protein	NA	NA	NA	NA	NA
WP_114071742.1|711207_711354_-	glycohydrolase toxin TNT-related protein	NA	NA	NA	NA	NA
WP_003641952.1|712197_712584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003641950.1|712963_713242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003641949.1|713353_713617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003641948.1|713660_714578_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068874237.1|714574_716374_-	pre-toxin TG domain-containing protein	NA	NA	NA	NA	NA
WP_003641946.1|716375_720059_-	MucBP domain-containing protein	NA	NA	NA	NA	NA
WP_003641945.1|720645_721368_-	aquaporin family protein	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	31.9	3.2e-30
WP_022638505.1|721382_723212_-	type 1 glycerol-3-phosphate oxidase	NA	NA	NA	NA	NA
WP_003643773.1|723226_724744_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_022638504.1|725209_726541_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003641941.1|726618_727590_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.7	1.7e-23
WP_003641940.1|727590_729117_-	ABC transporter permease/substrate-binding protein	NA	NA	NA	NA	NA
WP_003646442.1|729354_729801_+	ribonuclease H	NA	NA	NA	NA	NA
WP_013355178.1|730547_731459_-	oxidoreductase	NA	NA	NA	NA	NA
WP_003646441.1|731595_732516_+	ribonucleoside hydrolase RihC	NA	NA	NA	NA	NA
WP_013355176.1|732681_733254_-	acetyl-CoA carboxylase biotin carboxyl carrier protein subunit	NA	NA	NA	NA	NA
WP_003641935.1|733357_733813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003646440.1|733831_734302_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_013355174.1|734411_735608_+	DUF2075 domain-containing protein	NA	NA	NA	NA	NA
WP_003641932.1|735638_736148_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_013355173.1|736260_736629_-	DUF1304 domain-containing protein	NA	NA	NA	NA	NA
WP_022638503.1|736893_738399_-	multicopper oxidase domain-containing protein	NA	NA	NA	NA	NA
WP_022638502.1|738556_739225_-	ribose 5-phosphate isomerase A	NA	NA	NA	NA	NA
WP_003643762.1|739418_739982_+|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
>prophage 5
NZ_CP013753	Lactiplantibacillus plantarum strain DF chromosome, complete genome	3423963	1024000	1031021	3423963	capsid,portal,terminase,head,tail	Staphylococcus_phage(40.0%)	7	NA	NA
WP_022638531.1|1024000_1024267_-|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_022638530.1|1024677_1026261_-|capsid	phage major capsid protein	capsid	A0A1J0MFW8	Staphylococcus_phage	34.3	2.5e-40
WP_022638529.1|1026250_1027357_-|portal	phage portal protein	portal	A0A2H4J9Q5	uncultured_Caudovirales_phage	33.6	3.2e-50
WP_022638527.1|1027511_1029215_-|terminase	terminase large subunit	terminase	A0A2H4JBN3	uncultured_Caudovirales_phage	41.3	4.4e-123
WP_022638526.1|1029211_1029685_-|terminase	phage terminase small subunit P27 family	terminase	NA	NA	NA	NA
WP_033607857.1|1030300_1030690_-	HNH endonuclease	NA	A0A1J0MFT4	Staphylococcus_phage	45.2	1.0e-19
WP_033607856.1|1030682_1031021_-|head	phage head closure protein	head	A0A2P0ZLF0	Lactobacillus_phage	34.7	7.9e-08
>prophage 6
NZ_CP013753	Lactiplantibacillus plantarum strain DF chromosome, complete genome	3423963	1935553	1944064	3423963		Synechococcus_phage(33.33%)	9	NA	NA
WP_003645861.1|1935553_1936036_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	41.0	2.3e-16
WP_011101896.1|1936019_1937150_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_003642587.1|1937152_1937884_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4SM18	Cyanophage	37.3	1.6e-37
WP_003642588.1|1937885_1938140_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_022638052.1|1938139_1938820_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_003645864.1|1938812_1941032_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	39.3	4.5e-144
WP_003642591.1|1941016_1942471_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.0	2.5e-50
WP_013355836.1|1942467_1943493_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	40.7	5.4e-60
WP_003645867.1|1943485_1944064_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	33.9	1.3e-21
>prophage 7
NZ_CP013753	Lactiplantibacillus plantarum strain DF chromosome, complete genome	3423963	2105021	2170819	3423963	holin,integrase,portal,capsid,terminase,head,transposase,tail	Lactobacillus_phage(56.41%)	79	2119272:2119287	2140582:2140597
WP_013355194.1|2105021_2106284_-|transposase	ISL3-like element ISP1 family transposase	transposase	NA	NA	NA	NA
WP_011101813.1|2106438_2106888_-	VOC family protein	NA	NA	NA	NA	NA
WP_003642738.1|2107948_2108536_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003642739.1|2108620_2110174_+	ABC-F family ATP-binding cassette domain-containing protein	NA	Q6DMX7	Streptococcus_phage	27.0	1.2e-39
WP_003644673.1|2110434_2111625_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_003642741.1|2111848_2112079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003642742.1|2112104_2112326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003642743.1|2112472_2112937_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_003642744.1|2113158_2114052_+	C40 family peptidase	NA	NA	NA	NA	NA
WP_003644672.1|2114118_2114982_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003642746.1|2115543_2115708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003642747.1|2115766_2116510_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_022638136.1|2116615_2117803_+	MFS transporter	NA	NA	NA	NA	NA
WP_003644671.1|2118016_2118334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003642750.1|2118409_2118970_+	ECF transporter S component	NA	NA	NA	NA	NA
2119272:2119287	attL	ATAATGGAGATGGCGA	NA	NA	NA	NA
WP_011101810.1|2119726_2120665_-	EamA family transporter	NA	NA	NA	NA	NA
WP_003646616.1|2120861_2121131_+	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_003642754.1|2121140_2122484_+	PFL family protein	NA	NA	NA	NA	NA
WP_003646617.1|2122856_2123585_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.1	2.1e-34
WP_068874294.1|2123581_2125105_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_003642757.1|2125400_2126582_+	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	30.1	1.0e-46
WP_003642758.1|2126816_2127674_+	GRP family sugar transporter	NA	NA	NA	NA	NA
WP_068874296.1|2127894_2129247_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_063491282.1|2129359_2130628_-|integrase	site-specific integrase	integrase	A0A0P0I3D2	Lactobacillus_phage	42.7	4.3e-91
WP_063491281.1|2130976_2131687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080474029.1|2131852_2132278_-	ImmA/IrrE family metallo-endopeptidase	NA	D6PSS8	Lactobacillus_phage	46.8	6.2e-26
WP_063491280.1|2132274_2132622_-	helix-turn-helix domain-containing protein	NA	A8ASM2	Listeria_phage	38.7	1.7e-10
WP_063491279.1|2132779_2132983_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011101087.1|2133050_2133233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063491278.1|2133293_2133848_+	hypothetical protein	NA	O03909	Lactobacillus_phage	98.9	2.3e-97
WP_063491277.1|2133854_2134100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024002536.1|2134494_2135025_+	host-nuclease inhibitor Gam family protein	NA	E9LUU0	Lactobacillus_phage	59.2	6.1e-55
WP_063491276.1|2135036_2136002_+	hypothetical protein	NA	A6M982	Geobacillus_virus	53.6	1.3e-63
WP_063491275.1|2136081_2136870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063491274.1|2136850_2137693_+	ATP-binding protein	NA	O03914	Lactobacillus_phage	97.9	4.8e-155
WP_063491273.1|2137825_2138326_+	hypothetical protein	NA	O03915	Lactobacillus_phage	89.7	3.4e-84
WP_134901162.1|2138367_2138748_+	VRR-NUC domain-containing protein	NA	A0A0M7RDN7	Lactobacillus_phage	58.6	4.4e-23
WP_063491272.1|2138747_2138978_+	hypothetical protein	NA	O03916	Lactobacillus_phage	57.9	1.1e-21
WP_063491271.1|2138980_2139616_+	hypothetical protein	NA	E9LUN9	Lactobacillus_phage	38.6	6.4e-35
WP_134901160.1|2139628_2139808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063491269.1|2139947_2140343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022638176.1|2140388_2140607_+	hypothetical protein	NA	A0A2P0ZLC3	Lactobacillus_phage	90.2	1.1e-13
2140582:2140597	attR	ATAATGGAGATGGCGA	NA	NA	NA	NA
WP_022638177.1|2140599_2140773_+	hypothetical protein	NA	A0A2K9VC41	Lactobacillus_phage	87.7	4.7e-25
WP_187326027.1|2140793_2141159_+	hypothetical protein	NA	Q5ULS7	Lactobacillus_virus	51.9	1.0e-13
WP_022638179.1|2141155_2141503_+	hypothetical protein	NA	A0A142F1A4	Bacillus_phage	43.4	4.9e-13
WP_022638180.1|2141499_2141667_+	hypothetical protein	NA	E9LUP4	Lactobacillus_phage	87.2	1.8e-13
WP_003642805.1|2141794_2142256_+	transcriptional regulator	NA	D6PSV8	Lactobacillus_phage	57.0	1.1e-39
WP_022638374.1|2143169_2143721_+	hypothetical protein	NA	A8ASQ2	Listeria_phage	38.9	3.2e-22
WP_022638373.1|2143925_2144105_+	hypothetical protein	NA	E9LUP6	Lactobacillus_phage	56.4	1.4e-08
WP_022638372.1|2144073_2144352_+	hypothetical protein	NA	C9E2J2	Enterococcus_phage	59.8	3.1e-26
WP_063491267.1|2144405_2144933_+|terminase	terminase small subunit	terminase	O03926	Lactobacillus_phage	64.2	3.2e-48
WP_063491266.1|2144916_2146203_+|terminase	PBSX family phage terminase large subunit	terminase	B7T0C6	Staphylococcus_virus	49.9	2.2e-114
WP_080476969.1|2146192_2147851_+|portal	phage portal protein	portal	D2IZF6	Enterococcus_phage	32.8	9.1e-65
WP_063491265.1|2147850_2148795_+|capsid	minor capsid protein	capsid	NA	NA	NA	NA
WP_063491264.1|2148892_2149543_+	DUF4355 domain-containing protein	NA	NA	NA	NA	NA
WP_063491263.1|2149556_2150627_+	hypothetical protein	NA	A0A0S0N2Q7	Pseudomonas_phage	30.8	2.7e-33
WP_063491262.1|2150641_2151016_+|head,tail	phage head-tail connector protein	head,tail	H9A0V3	Staphylococcus_phage	38.2	9.0e-05
WP_187337711.1|2150969_2151344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063491261.1|2151333_2151888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080476970.1|2151889_2152276_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_063491259.1|2152286_2152877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063491258.1|2152894_2153407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063491257.1|2153475_2153712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068893437.1|2153711_2157947_+	tape measure protein	NA	E9LUR1	Lactobacillus_phage	31.1	6.8e-64
WP_063491256.1|2157956_2158853_+|tail	phage tail family protein	tail	A8ATA8	Listeria_phage	28.2	1.0e-17
WP_187337712.1|2158852_2160031_+|tail	phage tail protein	tail	Q9T1A5	Listeria_phage	24.5	6.3e-20
WP_063491254.1|2160027_2160285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063491253.1|2160274_2160565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_187337713.1|2160565_2162725_+	hypothetical protein	NA	M4ZSB3	Bacillus_phage	34.0	1.3e-39
WP_063491252.1|2162736_2163048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_134901158.1|2163047_2163197_+	XkdX family protein	NA	U5U4L4	Lactobacillus_phage	56.8	3.6e-05
WP_063491251.1|2163214_2164222_+	hypothetical protein	NA	A0A2K9VCK7	Lactobacillus_phage	62.0	1.7e-37
WP_063491250.1|2164218_2164461_+	hypothetical protein	NA	A0A0A1ENR9	Lactobacillus_phage	86.4	2.2e-12
WP_063491249.1|2164472_2165645_+	LysM peptidoglycan-binding domain-containing protein	NA	E9LUR8	Lactobacillus_phage	91.3	1.0e-203
WP_063491248.1|2165645_2165942_+	hypothetical protein	NA	A0A2K9VCD4	Lactobacillus_phage	71.4	1.2e-36
WP_063491247.1|2165928_2166303_+|holin	holin	holin	A0A2K9VCG4	Lactobacillus_phage	63.8	3.3e-15
WP_063491246.1|2166534_2167449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003646619.1|2168228_2168420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003642761.1|2168824_2170819_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	41.3	7.2e-32
>prophage 8
NZ_CP013753	Lactiplantibacillus plantarum strain DF chromosome, complete genome	3423963	2191853	2279535	3423963	holin,integrase,capsid,portal,terminase,head,tail,transposase,protease	Lactobacillus_phage(44.78%)	115	2186463:2186522	2203443:2203515
2186463:2186522	attL	TAAGCGAGTGACGGGAATCGGACCCGCGACTACAGCTTGGAAGGCTGTCGTTTTACCACT	NA	NA	NA	NA
WP_013355755.1|2191853_2192276_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0S2SXM3	Bacillus_phage	35.1	3.0e-12
WP_013355754.1|2192290_2192794_-	helix-turn-helix transcriptional regulator	NA	S6C481	Thermus_phage	42.6	1.7e-22
WP_033099030.1|2192939_2193194_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_013355753.1|2193250_2193565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011101085.1|2193602_2193839_-	helix-turn-helix transcriptional regulator	NA	A0A0K2CNE2	Brevibacillus_phage	30.7	8.5e-09
WP_011101086.1|2193985_2194186_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003642792.1|2194344_2194515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003642793.1|2194526_2194832_+	DUF771 domain-containing protein	NA	NA	NA	NA	NA
WP_022638124.1|2194899_2195412_+	helix-turn-helix transcriptional regulator	NA	D6PST4	Lactobacillus_phage	39.4	2.0e-23
WP_022638122.1|2195782_2196163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022638121.1|2196165_2197053_+	recombinase RecT	NA	E9LUM3	Lactobacillus_phage	53.3	4.6e-63
WP_161325284.1|2197084_2197837_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A0P0IZH9	Lactobacillus_phage	52.2	6.3e-74
WP_003642799.1|2197915_2198824_+	DnaD domain protein	NA	NA	NA	NA	NA
WP_022638119.1|2198820_2199108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022638118.1|2199104_2199623_+	hypothetical protein	NA	O03915	Lactobacillus_phage	68.4	1.9e-53
WP_022638117.1|2199619_2200000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021356389.1|2199992_2200133_+	hypothetical protein	NA	E9LUN8	Lactobacillus_phage	96.3	3.4e-05
WP_022638116.1|2200210_2200672_+	hypothetical protein	NA	D6PSV8	Lactobacillus_phage	57.0	4.1e-39
WP_155118608.1|2201192_2201744_+	abortive infection family protein	NA	NA	NA	NA	NA
WP_063491238.1|2201895_2203098_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A126GGK4	Streptococcus_phage	29.5	1.5e-37
WP_063491237.1|2203167_2203374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161324305.1|2203545_2204250_-	Ltp family lipoprotein	NA	V9QJ01	Oenococcus_phage	41.0	3.0e-09
2203443:2203515	attR	TAAGCGAGTGACGGGAATCGGACCCGCGACTACAGCTTGGAAGGCTGTCGTTTTACCACTAAACTACACTCGC	NA	NA	NA	NA
WP_063491236.1|2204859_2205282_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0S2SXM3	Bacillus_phage	34.4	3.0e-12
WP_063204180.1|2205296_2205815_-	helix-turn-helix domain-containing protein	NA	S6C481	Thermus_phage	34.1	3.5e-15
WP_068874298.1|2205956_2206211_+	helix-turn-helix transcriptional regulator	NA	A0A2H4JFN1	uncultured_Caudovirales_phage	41.3	1.1e-06
WP_155118609.1|2206207_2206366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155118610.1|2206355_2206520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154698910.1|2206578_2206719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062688295.1|2206715_2206994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060417488.1|2207073_2207256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011101088.1|2207316_2207871_+	hypothetical protein	NA	O03909	Lactobacillus_phage	100.0	3.6e-98
WP_033607781.1|2207876_2208164_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_022638167.1|2208658_2209171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068874300.1|2209173_2210139_+	hypothetical protein	NA	A6M982	Geobacillus_virus	56.2	3.9e-60
WP_068874308.1|2210218_2211124_+	DnaD domain protein	NA	NA	NA	NA	NA
WP_068874313.1|2211137_2211653_+	hypothetical protein	NA	O03915	Lactobacillus_phage	68.3	3.1e-56
WP_068874316.1|2211645_2212065_+	RusA family crossover junction endodeoxyribonuclease	NA	A8YQM5	Lactobacillus_phage	43.1	4.4e-24
WP_068874318.1|2212061_2212292_+	hypothetical protein	NA	O03916	Lactobacillus_phage	60.5	1.7e-22
WP_068874488.1|2213179_2213443_+	DUF3310 domain-containing protein	NA	A0A2P0ZL48	Lactobacillus_phage	82.3	1.4e-31
WP_068874320.1|2213542_2214139_+	hypothetical protein	NA	E9LUN9	Lactobacillus_phage	87.1	8.5e-98
WP_155118611.1|2214212_2214362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_187337714.1|2214379_2214529_+	hypothetical protein	NA	O03920	Lactobacillus_phage	68.1	2.2e-10
WP_068874322.1|2214553_2214970_+	hypothetical protein	NA	A0A1I9KKG9	Lactobacillus_phage	60.9	1.0e-41
WP_068874325.1|2215042_2215288_+	DUF3850 domain-containing protein	NA	C9E2N9	Enterococcus_phage	54.1	2.0e-13
WP_068874328.1|2215515_2215824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068874330.1|2215853_2216045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068874332.1|2216126_2216594_+	hypothetical protein	NA	B4XYT9	Lactobacillus_phage	40.8	1.3e-16
WP_068874335.1|2217649_2217853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155118612.1|2217900_2218062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068874337.1|2218048_2218312_+	hypothetical protein	NA	A0A1S5RCN3	Lactobacillus_phage	69.8	4.8e-29
WP_068874340.1|2218351_2218867_+|terminase	terminase small subunit	terminase	O03926	Lactobacillus_phage	71.1	1.5e-50
WP_068874342.1|2218859_2220173_+|terminase	PBSX family phage terminase large subunit	terminase	D2IYW1	Enterococcus_phage	54.3	1.2e-125
WP_068874344.1|2220187_2221924_+|portal	phage portal protein	portal	D2IZF6	Enterococcus_phage	34.8	2.4e-76
WP_068874346.1|2221923_2222835_+|capsid	minor capsid protein	capsid	NA	NA	NA	NA
WP_068874348.1|2222945_2223605_+	DUF4355 domain-containing protein	NA	NA	NA	NA	NA
WP_060418034.1|2223618_2223990_+	hypothetical protein	NA	A0A0K2CNR0	Brevibacillus_phage	34.4	1.3e-08
WP_068874350.1|2224005_2225115_+|capsid	major capsid protein	capsid	A0A2H4J022	uncultured_Caudovirales_phage	40.1	3.1e-61
WP_068874352.1|2225132_2225501_+|head,tail	phage head-tail connector protein	head,tail	NA	NA	NA	NA
WP_068874354.1|2225497_2225830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068874357.1|2225830_2226322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068874360.1|2226324_2226720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068874362.1|2226768_2227422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027821926.1|2227450_2227969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143143016.1|2228058_2228301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080476979.1|2228525_2232314_+	tape measure protein	NA	A0A0A7DMV4	Lactobacillus_phage	58.6	1.4e-39
WP_068874366.1|2232339_2232606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068874367.1|2232679_2233591_+|tail	phage tail family protein	tail	Q9T1A6	Listeria_phage	30.3	1.2e-18
WP_061871752.1|2233583_2234771_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_068874373.1|2234745_2235111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068874376.1|2235103_2235379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_187337715.1|2235379_2237539_+	hypothetical protein	NA	M4ZSB3	Bacillus_phage	34.0	1.3e-39
WP_063491252.1|2237550_2237862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_134901158.1|2237861_2238011_+	XkdX family protein	NA	U5U4L4	Lactobacillus_phage	56.8	3.6e-05
WP_063491251.1|2238028_2239036_+	hypothetical protein	NA	A0A2K9VCK7	Lactobacillus_phage	62.0	1.7e-37
WP_068874378.1|2239032_2239245_+	hypothetical protein	NA	A0A0A1ENR9	Lactobacillus_phage	83.6	1.8e-18
WP_068874490.1|2239308_2240421_+	LysM peptidoglycan-binding domain-containing protein	NA	O03950	Lactobacillus_phage	59.5	5.9e-44
WP_015380597.1|2240421_2240718_+	hypothetical protein	NA	A0A1I9KK55	Lactobacillus_phage	77.6	1.2e-39
WP_068874385.1|2240704_2241079_+|holin	holin	holin	A0A2H4PBB2	Lactobacillus_phage	87.8	4.6e-25
WP_063486137.1|2241489_2241756_+	hypothetical protein	NA	A9D9X7	Lactobacillus_prophage	47.1	3.9e-10
WP_068874386.1|2241794_2242169_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_187337716.1|2242479_2242734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033607771.1|2242843_2243023_+	hypothetical protein	NA	E9LUP6	Lactobacillus_phage	56.9	4.6e-07
WP_022638114.1|2243200_2243728_+|terminase	terminase small subunit	terminase	O03926	Lactobacillus_phage	73.1	5.0e-41
WP_022638113.1|2243717_2244956_+|terminase	PBSX family phage terminase large subunit	terminase	M1PG09	Streptococcus_phage	61.0	7.1e-139
WP_022638112.1|2244967_2246476_+|portal	phage portal protein	portal	V5US18	Oenococcus_phage	52.0	3.1e-136
WP_024971552.1|2246405_2246702_+|protease	ribosomal-processing cysteine protease Prp	protease	D2J003	Enterococcus_phage	40.2	1.1e-10
WP_013355736.1|2246848_2248534_+|capsid	minor capsid protein	capsid	V5US81	Oenococcus_phage	58.0	6.5e-119
WP_003642815.1|2248508_2248787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013355734.1|2248838_2249045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013355733.1|2249217_2249895_+	DUF4355 domain-containing protein	NA	Q6SE80	Lactobacillus_prophage	32.1	6.0e-15
WP_013355732.1|2249909_2250257_+	hypothetical protein	NA	V5UTH9	Oenococcus_phage	63.8	4.4e-30
WP_022638111.1|2250276_2251299_+|capsid	major capsid protein	capsid	V5US24	Oenococcus_phage	62.8	7.5e-118
WP_003642820.1|2251311_2251488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013355731.1|2251499_2251832_+|head,tail	phage head-tail connector protein	head,tail	V9QJ97	Oenococcus_phage	45.3	1.8e-12
WP_003642822.1|2251831_2252179_+	hypothetical protein	NA	V5US85	Oenococcus_phage	62.3	3.2e-36
WP_013355730.1|2252180_2252732_+	HK97 gp10 family phage protein	NA	V5URV0	Oenococcus_phage	62.3	2.0e-64
WP_013355729.1|2252731_2253097_+	hypothetical protein	NA	V5UQS4	Oenococcus_phage	53.4	3.0e-29
WP_099447638.1|2253198_2253582_+|tail	phage tail protein	tail	V5USQ9	Oenococcus_phage	58.4	1.8e-37
WP_003642826.1|2253681_2254080_+	hypothetical protein	NA	V9QJA0	Oenococcus_phage	74.8	3.0e-46
WP_031275283.1|2254187_2254451_+	hypothetical protein	NA	V9QKH3	Oenococcus_phage	65.4	2.3e-23
WP_022638110.1|2254466_2260298_+|tail	phage tail protein	tail	V5URV5	Oenococcus_phage	40.9	5.0e-227
WP_099739626.1|2260341_2260674_+	hypothetical protein	NA	V5UQS8	Oenococcus_phage	73.4	2.2e-42
WP_022638109.1|2260688_2265944_+	hypothetical protein	NA	Q6SE68	Lactobacillus_prophage	59.6	1.3e-144
WP_022638108.1|2265965_2266415_+	DUF1617 family protein	NA	A0A2P0ZLE0	Lactobacillus_phage	39.9	1.8e-20
WP_021732622.1|2266417_2266852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050578343.1|2267030_2268146_+	LysM peptidoglycan-binding domain-containing protein	NA	O03950	Lactobacillus_phage	77.4	3.1e-32
WP_022638106.1|2268146_2268443_+	hypothetical protein	NA	A0A2K9VCD4	Lactobacillus_phage	74.5	6.4e-38
WP_022638105.1|2268429_2268807_+	hypothetical protein	NA	A0A2K9VCG4	Lactobacillus_phage	67.5	7.9e-17
WP_022638104.1|2269903_2270749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022638794.1|2271317_2272169_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_003641420.1|2272391_2272784_+	YxeA family protein	NA	NA	NA	NA	NA
WP_003644665.1|2273007_2274738_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.6	2.6e-46
WP_003641422.1|2274737_2276627_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	32.1	9.4e-58
WP_003641423.1|2276641_2277613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013355994.1|2277882_2279535_+|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	41.3	1.8e-92
>prophage 9
NZ_CP013753	Lactiplantibacillus plantarum strain DF chromosome, complete genome	3423963	3105249	3118027	3423963		Lactobacillus_phage(70.0%)	11	NA	NA
WP_013355474.1|3105249_3106194_-	glycosyltransferase family 2 protein	NA	V5USA4	Oenococcus_phage	45.5	2.0e-72
WP_013355473.1|3106218_3106884_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_021356352.1|3107593_3108286_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.6	5.3e-35
WP_022638019.1|3108278_3109646_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	31.0	3.4e-25
WP_013355470.1|3110036_3110477_+	nucleoside 2-deoxyribosyltransferase	NA	A0A2P0ZL88	Lactobacillus_phage	97.9	1.2e-75
WP_013355469.1|3110547_3111108_-	hypothetical protein	NA	A0A2P0ZL75	Lactobacillus_phage	98.4	6.5e-100
WP_022638021.1|3111195_3113634_-	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	99.6	0.0e+00
WP_003643097.1|3113636_3114251_-	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	100.0	6.3e-112
WP_003643099.1|3114593_3115541_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	100.0	2.7e-178
WP_013355468.1|3115726_3116698_+	peptidase S41	NA	A0A2P0ZL68	Lactobacillus_phage	98.5	3.5e-181
WP_013355467.1|3116788_3118027_-	hypothetical protein	NA	A0A2P0ZL72	Lactobacillus_phage	98.7	2.4e-219
>prophage 10
NZ_CP013753	Lactiplantibacillus plantarum strain DF chromosome, complete genome	3423963	3144131	3210922	3423963	holin,tRNA,integrase,capsid,portal,terminase,tail,head,protease	Lactobacillus_phage(79.49%)	72	3165698:3165714	3205195:3205211
WP_003643128.1|3144131_3145820_-|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	32.9	1.2e-75
WP_013355456.1|3146091_3146538_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003643130.1|3146926_3147172_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003643131.1|3147298_3148690_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_013355455.1|3148965_3150741_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_013355454.1|3151246_3152986_-	aryl-sulfate sulfotransferase	NA	NA	NA	NA	NA
WP_013355453.1|3153206_3154163_-	bifunctional oligoribonuclease/PAP phosphatase NrnA	NA	NA	NA	NA	NA
WP_013355452.1|3154152_3154776_-	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	40.6	6.3e-27
WP_134901165.1|3154778_3155879_-	sulfate adenylyltransferase	NA	A0A2P1ELS9	Moumouvirus	32.9	6.1e-49
WP_022638032.1|3155911_3157549_-	sulfotransferase family protein	NA	NA	NA	NA	NA
WP_013355448.1|3158437_3160744_+	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_003643140.1|3160757_3162614_+	bifunctional homocysteine S-methyltransferase/methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_003645248.1|3162686_3163046_+	YisL family protein	NA	NA	NA	NA	NA
WP_003643142.1|3163145_3163667_-	GtrA family protein	NA	NA	NA	NA	NA
WP_003643143.1|3163772_3164786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003645249.1|3164950_3165376_+	hypothetical protein	NA	NA	NA	NA	NA
3165698:3165714	attL	CTGCCTGGGGCATAATT	NA	NA	NA	NA
WP_068874417.1|3166432_3166963_-|holin	holin	holin	E9LUS0	Lactobacillus_phage	98.9	8.5e-41
WP_003644510.1|3166974_3167238_-	hemolysin XhlA family protein	NA	E9LUR9	Lactobacillus_phage	100.0	2.0e-38
WP_068874418.1|3168277_3168637_-	hypothetical protein	NA	A0A2P0ZLF6	Lactobacillus_phage	79.0	5.0e-45
WP_181815834.1|3168620_3168782_-	hypothetical protein	NA	A0A2P0ZLG1	Lactobacillus_phage	96.2	6.8e-18
WP_068874420.1|3168785_3169028_-	hypothetical protein	NA	A0A2K9VDF6	Lactobacillus_phage	94.7	2.4e-30
WP_068874422.1|3172126_3174541_-	hypothetical protein	NA	A0A2P0ZLF8	Lactobacillus_phage	90.5	0.0e+00
WP_068874425.1|3174609_3176385_-|tail	phage tail family protein	tail	A0A2P0ZLH2	Lactobacillus_phage	96.8	0.0e+00
WP_068874427.1|3176463_3181212_-	C40 family peptidase	NA	A0A2P0ZLG0	Lactobacillus_phage	73.6	0.0e+00
WP_015640500.1|3181243_3181429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068874429.1|3181473_3181848_-|tail	phage tail assembly chaperone	tail	A0A2P0ZLH4	Lactobacillus_phage	95.2	3.5e-57
WP_068874433.1|3181920_3182574_-|tail	phage tail protein	tail	A0A2P0ZLH1	Lactobacillus_phage	95.4	5.4e-114
WP_068874435.1|3182590_3182971_-	DUF806 family protein	NA	A0A2P0ZLF4	Lactobacillus_phage	95.2	4.8e-62
WP_068874437.1|3182970_3183378_-	HK97 gp10 family phage protein	NA	A0A2P0ZLE6	Lactobacillus_phage	93.1	2.2e-65
WP_061812664.1|3183380_3183728_-|head	phage head closure protein	head	A0A2P0ZLF0	Lactobacillus_phage	73.9	4.1e-44
WP_068874440.1|3183717_3184050_-|head,tail	phage gp6-like head-tail connector protein	head,tail	E9LUQ4	Lactobacillus_phage	86.1	6.1e-45
WP_068874442.1|3184122_3185355_-|capsid	phage major capsid protein	capsid	E9LUQ3	Lactobacillus_phage	91.6	5.5e-208
WP_022638400.1|3185354_3186113_-|protease	Clp protease ClpP	protease	E9LUQ2	Lactobacillus_phage	96.0	1.2e-128
WP_068874444.1|3186090_3187284_-|portal	phage portal protein	portal	E9LUQ1	Lactobacillus_phage	98.5	3.4e-223
WP_063722563.1|3187286_3187481_-	DUF1056 family protein	NA	E9LUQ0	Lactobacillus_phage	95.3	1.8e-25
WP_068874448.1|3187470_3189369_-|terminase	terminase large subunit	terminase	E9LUP9	Lactobacillus_phage	92.6	0.0e+00
WP_016511011.1|3189378_3189834_-|terminase	phage terminase small subunit P27 family	terminase	E9LUP8	Lactobacillus_phage	96.7	3.0e-79
WP_013355635.1|3190023_3190275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068874450.1|3190292_3190562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080476972.1|3190567_3191038_-	HNH endonuclease	NA	E9LUP7	Lactobacillus_phage	94.2	1.6e-83
WP_013355638.1|3191048_3191219_-	hypothetical protein	NA	E9LUP6	Lactobacillus_phage	96.4	3.3e-23
WP_033098961.1|3191378_3192191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021732015.1|3192769_3193195_-	RinA family transcriptional regulator	NA	E9LUP5	Lactobacillus_phage	87.2	7.2e-67
WP_022638825.1|3193352_3193550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054598400.1|3193622_3194057_-	hypothetical protein	NA	Q5ULS7	Lactobacillus_virus	53.2	7.2e-14
WP_022638755.1|3194040_3194217_-	hypothetical protein	NA	E9LUP2	Lactobacillus_phage	81.0	8.8e-19
WP_155118607.1|3194246_3194414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022638754.1|3194588_3194747_-	hypothetical protein	NA	A0A2P0ZLB5	Lactobacillus_phage	92.3	3.9e-18
WP_022638753.1|3194739_3195048_-	hypothetical protein	NA	E9LUN7	Lactobacillus_phage	96.1	1.7e-49
WP_068874453.1|3195183_3195969_-	ATP-binding protein	NA	E9LUN6	Lactobacillus_phage	90.8	1.4e-132
WP_068874454.1|3195968_3196685_-	helix-turn-helix domain-containing protein	NA	A0A0P0I7Q1	Lactobacillus_phage	39.3	1.2e-32
WP_068874456.1|3196779_3197037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_187337717.1|3197036_3197207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003644546.1|3197692_3197947_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003644547.1|3197959_3198163_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_033615377.1|3198328_3198619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068874458.1|3199159_3199489_-	DUF771 domain-containing protein	NA	E9LUT3	Lactobacillus_phage	88.1	4.6e-53
WP_068874460.1|3199581_3199791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155118613.1|3199787_3199949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003641364.1|3199961_3200171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068874462.1|3200182_3200917_-	ORF6C domain-containing protein	NA	A0A1P8BM06	Lactococcus_phage	45.2	1.4e-49
WP_063845781.1|3200932_3201136_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_068874463.1|3201392_3201812_+	helix-turn-helix transcriptional regulator	NA	A0A0M4QX29	Bacillus_phage	47.9	5.3e-30
WP_068874464.1|3201823_3202261_+	ImmA/IrrE family metallo-endopeptidase	NA	Q9T201	Bacillus_phage	35.2	2.3e-07
WP_068874466.1|3202318_3203068_+	ion transporter	NA	A0A1B0Y2S3	Lactobacillus_phage	53.1	1.3e-39
WP_068874469.1|3203070_3203289_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068874471.1|3203941_3205078_+|integrase	site-specific integrase	integrase	E9LUS1	Lactobacillus_phage	97.6	1.4e-210
WP_022638033.1|3205724_3207992_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	31.4	2.0e-118
3205195:3205211	attR	CTGCCTGGGGCATAATT	NA	NA	NA	NA
WP_003643147.1|3208056_3208344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013355446.1|3208458_3208971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003643149.1|3209087_3209564_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003645251.1|3210235_3210922_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 11
NZ_CP013753	Lactiplantibacillus plantarum strain DF chromosome, complete genome	3423963	3370585	3423810	3423963	integrase,capsid,portal,terminase,tail,head,protease	Lactobacillus_phage(77.78%)	54	3364501:3364516	3402285:3402300
3364501:3364516	attL	ACGTGCCATATATTGA	NA	NA	NA	NA
WP_072533917.1|3370585_3371188_+|integrase	tyrosine-type recombinase/integrase	integrase	D2XR58	Bacillus_phage	41.3	4.8e-32
WP_013355383.1|3371236_3372253_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	42.0	2.3e-66
WP_022638386.1|3372345_3373551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013355381.1|3373677_3374073_-	glycerol-3-phosphate cytidylyltransferase	NA	A0A1V0SGE7	Hokovirus	42.2	1.7e-17
WP_022638387.1|3374092_3375508_-	flippase	NA	NA	NA	NA	NA
WP_013355379.1|3375577_3376462_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_033098981.1|3376479_3377604_-	CDP-glycerol--glycerophosphate glycerophosphotransferase	NA	NA	NA	NA	NA
WP_013355377.1|3377593_3378658_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_013355376.1|3378702_3379479_-	DUF4422 domain-containing protein	NA	NA	NA	NA	NA
WP_022638388.1|3379487_3380768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033607823.1|3380792_3381932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013355374.1|3381918_3382521_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_013355373.1|3382544_3383180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013355372.1|3383303_3384422_-	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	79.8	4.0e-173
WP_003643315.1|3384571_3385288_-	aquaporin family protein	NA	A0A1J0F964	Only_Syngen_Nebraska_virus	32.7	5.6e-19
WP_003643314.1|3385477_3386407_-	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_003646267.1|3386783_3387902_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A0N9R0B2	Chrysochromulina_ericina_virus	31.2	2.7e-20
WP_171831422.1|3389513_3390869_+	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_003646269.1|3390951_3391515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003643305.1|3391948_3392389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003643304.1|3392588_3392789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003643303.1|3392938_3393805_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_013355368.1|3393797_3395105_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_003643301.1|3395238_3395679_+	universal stress protein	NA	NA	NA	NA	NA
WP_022638390.1|3396221_3396755_-	hypothetical protein	NA	E9LUS0	Lactobacillus_phage	97.6	1.4e-35
WP_003644510.1|3396766_3397030_-	hemolysin XhlA family protein	NA	E9LUR9	Lactobacillus_phage	100.0	2.0e-38
WP_022638392.1|3398060_3398420_-	hypothetical protein	NA	A0A2P0ZLF6	Lactobacillus_phage	80.7	1.0e-45
WP_003644513.1|3398403_3398565_-	hypothetical protein	NA	A0A2P0ZLG1	Lactobacillus_phage	100.0	9.5e-20
WP_022638393.1|3398568_3398811_-	hypothetical protein	NA	A0A2P0ZLG3	Lactobacillus_phage	100.0	3.4e-29
WP_022638394.1|3398803_3401443_-	hypothetical protein	NA	A0A2P0ZLG5	Lactobacillus_phage	64.5	1.2e-130
WP_022638395.1|3401459_3403874_-|tail	phage tail protein	tail	A0A2P0ZLF8	Lactobacillus_phage	92.4	0.0e+00
3402285:3402300	attR	ACGTGCCATATATTGA	NA	NA	NA	NA
WP_022638396.1|3403940_3405716_-|tail	phage tail family protein	tail	A0A2P0ZLH2	Lactobacillus_phage	90.3	1.4e-300
WP_022638397.1|3405788_3410696_-	tape measure protein	NA	E9LUR1	Lactobacillus_phage	62.9	0.0e+00
WP_016058335.1|3410708_3410900_-	hypothetical protein	NA	E9LUR0	Lactobacillus_phage	100.0	1.5e-27
WP_016058334.1|3410896_3411280_-	hypothetical protein	NA	E9LUQ9	Lactobacillus_phage	100.0	3.9e-64
WP_021732001.1|3411481_3412120_-|tail	phage tail protein	tail	E9LUQ8	Lactobacillus_phage	92.9	3.7e-107
WP_022638398.1|3412120_3412504_-	DUF806 family protein	NA	E9LUQ7	Lactobacillus_phage	96.9	1.0e-64
WP_021732003.1|3412500_3412941_-	hypothetical protein	NA	E9LUQ6	Lactobacillus_phage	97.9	3.2e-78
WP_021732004.1|3412930_3413293_-|head	phage head closure protein	head	E9LUQ5	Lactobacillus_phage	99.2	1.5e-65
WP_016058329.1|3413276_3413615_-|head,tail	phage gp6-like head-tail connector protein	head,tail	E9LUQ4	Lactobacillus_phage	100.0	7.0e-57
WP_022638399.1|3413687_3414920_-|capsid	phage major capsid protein	capsid	E9LUQ3	Lactobacillus_phage	88.0	8.5e-201
WP_022638400.1|3414919_3415678_-|protease	Clp protease ClpP	protease	E9LUQ2	Lactobacillus_phage	96.0	1.2e-128
WP_022638401.1|3415655_3416849_-|portal	phage portal protein	portal	E9LUQ1	Lactobacillus_phage	98.7	6.9e-224
WP_022638402.1|3416851_3417046_-	DUF1056 family protein	NA	E9LUQ0	Lactobacillus_phage	93.8	5.3e-25
WP_063491136.1|3417035_3418934_-|terminase	terminase large subunit	terminase	E9LUP9	Lactobacillus_phage	92.6	0.0e+00
WP_016511011.1|3418943_3419399_-|terminase	phage terminase small subunit P27 family	terminase	E9LUP8	Lactobacillus_phage	96.7	3.0e-79
WP_050578353.1|3419575_3420115_-	HNH endonuclease	NA	A0A2D1GPF4	Lactobacillus_phage	48.4	6.9e-30
WP_022638404.1|3420117_3420588_-	HNH endonuclease	NA	E9LUP7	Lactobacillus_phage	75.2	1.5e-65
WP_022638405.1|3420598_3420778_-	hypothetical protein	NA	E9LUP6	Lactobacillus_phage	67.8	4.3e-13
WP_068893440.1|3421027_3421531_-	hypothetical protein	NA	A8ASQ2	Listeria_phage	38.3	1.4e-21
WP_022638818.1|3422064_3422490_-	phage transcriptional activator RinA	NA	E9LUP5	Lactobacillus_phage	81.6	3.1e-62
WP_033607948.1|3422670_3422865_-	hypothetical protein	NA	E9LUP4	Lactobacillus_phage	52.7	8.0e-05
WP_054598401.1|3422861_3423278_-	hypothetical protein	NA	E9LUP3	Lactobacillus_phage	54.9	4.2e-35
WP_080477606.1|3423543_3423810_-	hypothetical protein	NA	Q5ULS7	Lactobacillus_virus	53.2	3.4e-14
>prophage 1
NZ_CP013754	Lactiplantibacillus plantarum strain DF plasmid unnamed1, complete sequence	127132	40885	82464	127132	transposase,holin,protease	Streptococcus_phage(33.33%)	37	NA	NA
WP_063485943.1|40885_41521_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_068874499.1|42788_44942_+	type IA DNA topoisomerase	NA	A0A1X9I6W8	Streptococcus_phage	46.9	5.2e-105
WP_063491173.1|44960_45422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068874505.1|45411_45819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068874506.1|45928_46894_+	DUF3991 and TOPRIM domain-containing protein	NA	NA	NA	NA	NA
WP_063493016.1|46890_47085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068874507.1|47087_47693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068874509.1|47695_49480_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A2C9CXH0	Yersinia_phage	35.9	1.8e-82
WP_062690082.1|49545_49860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068874510.1|49953_52056_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063489405.1|52065_52845_+	class A sortase	NA	NA	NA	NA	NA
WP_063489404.1|52873_55861_+	isopeptide-forming domain-containing fimbrial protein	NA	NA	NA	NA	NA
WP_063489403.1|55937_56234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068874511.1|56335_57250_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_021353390.1|58309_58399_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_068874513.1|58696_59851_-	S-adenosyl-L-homocysteine hydrolase	NA	NA	NA	NA	NA
WP_014940864.1|59840_60503_-	HD domain-containing protein	NA	A0A1Q1PP35	Noumeavirus	31.4	5.0e-14
WP_063489446.1|60502_61894_-	MFS transporter	NA	NA	NA	NA	NA
WP_021731144.1|62172_62286_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_063489400.1|62518_63667_+	FRG domain-containing protein	NA	NA	NA	NA	NA
WP_063489399.1|63834_64329_-	HXXEE domain-containing protein	NA	NA	NA	NA	NA
WP_063489398.1|64418_64979_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_080476989.1|65557_65665_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_063489397.1|66793_67309_-	HXXEE domain-containing protein	NA	NA	NA	NA	NA
WP_063489396.1|67400_67727_-	DUF4828 domain-containing protein	NA	NA	NA	NA	NA
WP_068874514.1|67732_69568_-	DHA2 family efflux MFS transporter permease subunit	NA	A0A0M3UL24	Mycobacterium_phage	25.4	3.5e-25
WP_050676723.1|69739_70291_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016526703.1|71671_71971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013356270.1|71972_72833_-	ParA family protein	NA	F0PIG8	Enterococcus_phage	40.2	1.7e-43
WP_010014534.1|75513_75795_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_033098918.1|75784_76291_+	mRNA interferase PemK	NA	NA	NA	NA	NA
WP_013356307.1|76280_76559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003555660.1|76581_76809_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068874515.1|77060_79121_+	MobA/MobL family protein	NA	NA	NA	NA	NA
WP_080476987.1|79240_80752_+	topoisomerase C-terminal repeat-containing protein	NA	A0A1X9I6W8	Streptococcus_phage	46.0	2.0e-106
WP_057138795.1|80873_81089_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021353390.1|82374_82464_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
>prophage 1
NZ_CP013755	Lactiplantibacillus plantarum strain DF plasmid unnamed2, complete sequence	83144	16138	79131	83144	holin,transposase,protease	Streptococcus_phage(50.0%)	55	NA	NA
WP_022638657.1|16138_16996_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_022638658.1|17105_17681_-	recombinase family protein	NA	A0A1J1J8Z4	Escherichia_phage	44.6	1.6e-32
WP_063485848.1|18058_18496_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_187337721.1|18507_27939_-	KxYKxGKxW signal peptide domain-containing protein	NA	NA	NA	NA	NA
WP_022638676.1|28380_28677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022638677.1|28752_31746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022638678.1|31776_32517_-	class A sortase	NA	NA	NA	NA	NA
WP_022638679.1|32526_34620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022638680.1|34715_35030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068874555.1|35095_36880_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	33.4	1.3e-80
WP_063485949.1|36882_37485_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063485948.1|37487_37682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063492928.1|37678_38644_-	DUF3991 and TOPRIM domain-containing protein	NA	NA	NA	NA	NA
WP_063491172.1|38753_39161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063491173.1|39150_39612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068874553.1|39630_41784_-	type IA DNA topoisomerase	NA	A0A1X9I6W8	Streptococcus_phage	47.9	9.6e-107
WP_063491175.1|42825_43734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063491176.1|43752_43992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_187337722.1|44344_44422_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_063491178.1|44633_45266_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_063491179.1|45267_47457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068874551.1|47428_47896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063491181.1|47913_48414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063491182.1|48415_48706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080476990.1|49017_49926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022638817.1|50284_51514_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	48.8	1.9e-88
WP_063491319.1|51668_52094_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_063491317.1|52083_52389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063491315.1|52388_52604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022638631.1|52605_52818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063491314.1|52814_53774_-	DUF3102 domain-containing protein	NA	A0A2H4JAH5	uncultured_Caudovirales_phage	39.7	2.0e-32
WP_068874561.1|54331_55060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063491310.1|55085_55325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022638636.1|55442_55598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063491308.1|55618_56248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063491307.1|56260_57424_-	CHAP domain-containing protein	NA	A0A0A0RSI6	Bacillus_phage	35.5	4.5e-10
WP_063491305.1|57424_57631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022638640.1|57632_59585_-	conjugation-related ATPase	NA	NA	NA	NA	NA
WP_022638641.1|59600_60260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022638642.1|60231_60615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022638643.1|60899_61463_+	cadmium resistance transporter	NA	NA	NA	NA	NA
WP_022638644.1|61540_61867_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_068874559.1|62192_64814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022638646.1|65122_66655_-	primase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_099735248.1|67394_68348_+	AAA family ATPase	NA	A0A1X9I765	Streptococcus_phage	28.3	3.5e-21
WP_022638648.1|68331_68619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022638649.1|68899_70201_+	Y-family DNA polymerase	NA	M1Q231	Streptococcus_phage	39.3	8.4e-82
WP_022638650.1|70193_70514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022638651.1|70506_70905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068874557.1|70986_72798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022638653.1|72798_73017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063492998.1|73146_75861_-	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_022638655.1|76043_76325_-	BRCT domain-containing protein	NA	NA	NA	NA	NA
WP_033607892.1|76917_77391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022638657.1|78273_79131_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
