The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP011533	Streptomyces noursei ATCC 11455 chromosome, complete genome	9815884	5846	53663	9815884	transposase	Streptomyces_phage(50.0%)	44	NA	NA
WP_067342802.1|5846_6680_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_067342803.1|7110_7359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_067342805.1|7615_7996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_067342807.1|8453_8867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079141892.1|9107_9596_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_159425702.1|9768_9993_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159425703.1|10300_10789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_067342810.1|10801_11119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_067342812.1|11121_11349_+	hypothetical protein	NA	A0A2P1JTX6	Streptomyces_phage	54.7	3.4e-15
WP_067342813.1|11439_12276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_067342815.1|12338_12851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159425704.1|12898_13357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_067357440.1|13482_14265_+	hypothetical protein	NA	NA	NA	NA	NA
WP_067342820.1|14251_14731_+	hypothetical protein	NA	NA	NA	NA	NA
WP_067342822.1|14855_15461_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159425705.1|15457_15730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_067342824.1|15737_16625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_067342826.1|16635_17325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_067342830.1|17332_18079_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_067342831.1|18397_19267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_067342833.1|19301_19562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_067342835.1|19561_20179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_067342837.1|20291_20747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_067342839.1|20746_22477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_067342840.1|22672_23266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_067342842.1|23586_24171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_067342844.1|24249_24552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_067342845.1|24644_24926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_067342847.1|24928_25147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_067342849.1|25253_29711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167739084.1|29850_31473_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_174717825.1|32225_34013_-	maturase	NA	A0A0U4J920	Pseudomonas_phage	28.3	2.7e-22
WP_067342852.1|34915_38518_+	hypothetical protein	NA	NA	NA	NA	NA
WP_067342854.1|39155_39884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_067342856.1|40994_42203_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_159425706.1|43320_43905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159425707.1|44165_44726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159425708.1|45011_45170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159425709.1|45690_46530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_067342861.1|46725_47625_+	replication-relaxation family protein	NA	NA	NA	NA	NA
WP_067342863.1|48045_48513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107407272.1|49498_50146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_067342866.1|50218_51907_+|transposase	ISAzo13 family transposase	transposase	NA	NA	NA	NA
WP_067342868.1|51977_53663_+|transposase	ISAzo13 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP011533	Streptomyces noursei ATCC 11455 chromosome, complete genome	9815884	89728	152921	9815884	transposase	Enterobacteria_phage(33.33%)	51	NA	NA
WP_067342910.1|89728_90613_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_099055615.1|90667_92404_-	acyl-CoA oxidase	NA	NA	NA	NA	NA
WP_067342912.1|92661_93705_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_159425717.1|93701_94931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_067342915.1|94918_96247_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_067342917.1|96246_97554_-	MFS transporter	NA	NA	NA	NA	NA
WP_159425718.1|98095_98815_-	sortase	NA	NA	NA	NA	NA
WP_159425719.1|99017_100274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159425720.1|100605_100920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159425721.1|102065_103982_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_079141913.1|104825_105659_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_159425722.1|106092_107022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159425723.1|107412_108846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_067342927.1|109183_109744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_067342931.1|111471_112257_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_159425724.1|112409_113213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159425725.1|114976_115132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_067342938.1|115262_115484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159425726.1|115563_116127_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_067342944.1|116632_117274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159426079.1|117383_117956_+	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_079143289.1|117871_118438_+|transposase	transposase	transposase	S5VXX4	Leptospira_phage	31.9	2.5e-06
WP_067342950.1|118645_120766_-	Helicase associated domain protein	NA	NA	NA	NA	NA
WP_067342952.1|120937_121627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_067357458.1|121623_123852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079143290.1|123857_124154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_067342956.1|124875_126327_-	transcriptional regulator	NA	K4IBI5	Streptomyces_phage	30.5	2.6e-39
WP_159425727.1|126565_126721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099055776.1|126817_128569_+	asparagine synthase	NA	NA	NA	NA	NA
WP_159425728.1|128562_128859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079143291.1|128864_129284_+	lasso peptide biosynthesis B2 protein	NA	NA	NA	NA	NA
WP_079141921.1|129444_130959_+	ABC transporter ATP-binding protein/permease	NA	NA	NA	NA	NA
WP_099055773.1|131846_132470_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	46.2	7.7e-09
WP_079141925.1|132556_133147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_067342968.1|134045_134291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_067342970.1|134435_135359_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_067342972.1|135584_136439_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_067357464.1|136420_136609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_067342974.1|137127_137655_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_159425729.1|138590_139067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079141929.1|139190_140036_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_079141931.1|140032_140242_+	DUF397 domain-containing protein	NA	NA	NA	NA	NA
WP_159425730.1|140430_141861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_067342910.1|142928_143813_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_159425731.1|144154_145339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_067342984.1|145794_146622_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	43.0	2.6e-52
WP_174717939.1|146621_147860_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	37.1	1.1e-30
WP_159425732.1|148300_148711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_067342987.1|148825_149617_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.8	2.6e-25
WP_067342988.1|149616_151155_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_079143292.1|151352_152921_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP011533	Streptomyces noursei ATCC 11455 chromosome, complete genome	9815884	157891	361288	9815884	transposase	Bacillus_phage(20.69%)	164	NA	NA
WP_067342992.1|157891_159139_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_067342866.1|159192_160881_-|transposase	ISAzo13 family transposase	transposase	NA	NA	NA	NA
WP_159425733.1|161138_161702_-	DUF4142 domain-containing protein	NA	NA	NA	NA	NA
WP_079141939.1|163389_163602_-|transposase	transposase	transposase	A0A160DCU2	Gordonia_phage	50.0	1.3e-11
WP_067342997.1|163768_164515_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_067342999.1|164603_165956_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.5	3.6e-27
WP_159425735.1|166219_166999_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_079141943.1|167068_167401_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	53.5	1.2e-21
WP_067343002.1|167538_167865_-|transposase	transposase	transposase	A0A2P1JR43	Mycobacterium_phage	44.0	2.8e-10
WP_067343004.1|167954_168920_-	isopenicillin N synthase family oxygenase	NA	NA	NA	NA	NA
WP_067343006.1|169118_169454_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_099055777.1|169597_169942_-	transglycosylase family protein	NA	A0A1J0GVU2	Streptomyces_phage	61.4	2.8e-21
WP_067343008.1|170869_171679_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_107407328.1|171925_173584_-|transposase	ISAzo13 family transposase	transposase	NA	NA	NA	NA
WP_079141947.1|174625_174955_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_067343012.1|175162_175702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_067343013.1|176214_176436_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_167739031.1|176572_176782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_067357427.1|176795_177158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079141951.1|177216_177597_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_159425737.1|178910_180083_+	family 2 glycosyl transferase	NA	NA	NA	NA	NA
WP_099055617.1|180268_180841_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_079141953.1|180936_181797_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_174717826.1|181793_182192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_067343018.1|182199_183072_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_067343020.1|183068_183974_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_067343022.1|183977_185168_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_099055618.1|187336_188537_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	34.7	6.2e-31
WP_067343027.1|188621_189368_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_079141957.1|189537_190638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079141959.1|190871_191402_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_079141961.1|192411_193344_-	arylamine N-acetyltransferase	NA	NA	NA	NA	NA
WP_067357482.1|193594_194929_-	MFS transporter	NA	NA	NA	NA	NA
WP_067343034.1|195685_196072_+|transposase	transposase domain-containing protein	transposase	NA	NA	NA	NA
WP_159425738.1|196129_196507_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_159425739.1|196942_197563_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_067343040.1|197487_198027_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_107407328.1|198199_199858_+|transposase	ISAzo13 family transposase	transposase	NA	NA	NA	NA
WP_099055619.1|200018_201187_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	36.3	3.7e-44
WP_067343045.1|203968_204889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_067343047.1|205306_205903_-	helix-turn-helix domain-containing protein	NA	I3VYZ1	Thermoanaerobacterium_phage	44.1	6.5e-05
WP_067343049.1|206470_207748_+	MFS transporter	NA	NA	NA	NA	NA
WP_067343050.1|208507_208957_+|transposase	transposase domain-containing protein	transposase	NA	NA	NA	NA
WP_067342997.1|208944_209691_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_099055621.1|210828_212082_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_067343054.1|212280_213516_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_159425740.1|214416_215916_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_067343055.1|216580_218032_-	MFS transporter	NA	NA	NA	NA	NA
WP_067357493.1|218059_219073_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_067343058.1|219164_219788_+	helix-turn-helix domain-containing protein	NA	I3VYZ1	Thermoanaerobacterium_phage	42.4	8.8e-05
WP_079141966.1|221544_222846_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_079143292.1|222917_224486_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_067343064.1|224570_224969_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_067357496.1|225228_225735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159425741.1|226282_226693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159425742.1|226748_227429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159425743.1|229645_230437_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_159425744.1|230595_231219_-|transposase	transposase	transposase	A0A0M5M147	Mycobacterium_phage	57.7	1.0e-56
WP_067343070.1|231399_232260_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_067343072.1|232310_233708_-	Camphene synthase	NA	NA	NA	NA	NA
WP_067343074.1|233746_235162_-	cyclic nucleotide-binding domain-containing protein	NA	NA	NA	NA	NA
WP_099055622.1|237003_238205_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	35.1	1.6e-31
WP_067357498.1|240045_240354_+|transposase	transposase	transposase	A0A1B3AZF8	Gordonia_phage	52.0	1.0e-17
WP_099055623.1|240350_241052_+|transposase	IS3 family transposase	transposase	A0A1B3AZE5	Gordonia_phage	39.6	2.1e-31
WP_099055624.1|241048_241237_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_099055625.1|241553_242063_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_067357500.1|243571_244585_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_159425745.1|244775_245153_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_079141980.1|245451_245814_+	redoxin family protein	NA	NA	NA	NA	NA
WP_079141982.1|247596_248013_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_159425746.1|248699_248987_-	hypothetical protein	NA	A0A2P1JQX9	Mycobacterium_phage	77.2	2.6e-28
WP_067357503.1|248988_249225_+|transposase	transposase	transposase	Q9ETV7	Enterobacteria_phage	41.8	8.8e-06
WP_067343085.1|249961_250726_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_159425747.1|250848_251007_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_067343086.1|251196_252351_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_159425748.1|252454_252625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079141990.1|253796_254414_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_099055628.1|256619_257820_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	35.1	1.3e-31
WP_067343103.1|259436_259670_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_067343104.1|259681_259993_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_079143300.1|260074_260293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159425749.1|260293_260866_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_159425750.1|261037_262135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159425751.1|262560_263280_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_099055629.1|263581_264750_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	37.1	2.5e-45
WP_067343027.1|264901_265648_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_067342830.1|265877_266624_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_099055778.1|266763_269157_-	discoidin domain-containing protein	NA	NA	NA	NA	NA
WP_079143302.1|270441_272838_+	bifunctional glycosyltransferase family 2 protein/CDP-glycerol:glycerophosphate glycerophosphotransferase	NA	NA	NA	NA	NA
WP_067343112.1|273794_277211_-	laminin G domain-containing protein	NA	NA	NA	NA	NA
WP_159425752.1|277317_278109_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_079142002.1|278090_281783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_067343008.1|281948_282758_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_067357507.1|284588_285836_-	serine hydrolase	NA	NA	NA	NA	NA
WP_067343123.1|286072_286816_+	TetR/AcrR family transcriptional regulator C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_159425753.1|288434_288902_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_067343124.1|288898_289186_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_067343125.1|289329_290595_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_159425754.1|291047_291437_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_099055779.1|291321_292584_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	39.8	1.5e-35
WP_168409271.1|293393_293720_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_079141953.1|293825_294686_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_174717826.1|294682_295081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_067343130.1|295690_296770_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_159425755.1|296908_297988_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_159425756.1|298212_299898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_067342830.1|299905_300652_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_067343133.1|300805_301552_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_099055632.1|301939_303141_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	35.1	9.6e-32
WP_159425757.1|303181_304273_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_159425758.1|304723_305296_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_079143304.1|305296_305524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099055633.1|305487_306537_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_067343027.1|306701_307448_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_079143306.1|307476_308511_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	29.4	2.7e-35
WP_159425759.1|308706_310320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174717827.1|310773_311040_+	hypothetical protein	NA	NA	NA	NA	NA
WP_067343140.1|311057_311867_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_067343133.1|311985_312732_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_067343142.1|312891_313473_+	Uma2 family endonuclease	NA	NA	NA	NA	NA
WP_159425760.1|314043_314901_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	35.7	7.1e-29
WP_099055779.1|314955_316218_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	39.8	1.5e-35
WP_159425761.1|316273_316426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_067343078.1|316422_316728_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_159425762.1|317248_318028_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_067343144.1|318796_319081_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_079143300.1|319189_319408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159425758.1|319408_319981_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_159425763.1|320113_320482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079142024.1|321128_322475_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_067343146.1|322736_324161_-	glutamate decarboxylase	NA	NA	NA	NA	NA
WP_067343144.1|324426_324711_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_099055635.1|325753_326922_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	36.7	9.6e-45
WP_159425764.1|326987_327080_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_159425765.1|327328_327889_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_079143300.1|327889_328108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159425766.1|328324_329608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159425767.1|329779_330463_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_099055636.1|330722_331924_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	35.5	1.9e-32
WP_079142032.1|332101_332848_-	DUF4239 domain-containing protein	NA	NA	NA	NA	NA
WP_079142034.1|333032_333338_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_067343125.1|333345_334611_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_067343154.1|334675_334990_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_067343157.1|334986_335439_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_174717826.1|335486_335885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_067343159.1|336490_336997_+	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_099055779.1|337103_338366_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	39.8	1.5e-35
WP_079143300.1|340232_340451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159425768.1|340451_341012_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_099055637.1|343198_344367_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	36.7	3.7e-44
WP_067343163.1|344490_344682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079141959.1|345642_346173_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_079143310.1|346440_347019_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_099055779.1|347178_348441_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	39.8	1.5e-35
WP_067342992.1|349278_350526_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_079142038.1|350588_351233_-	polyketide synthase	NA	NA	NA	NA	NA
WP_159425769.1|351246_351969_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_067343170.1|352147_352576_-	MMPL family transporter	NA	NA	NA	NA	NA
WP_079142042.1|352713_353070_+	DUF1266 domain-containing protein	NA	NA	NA	NA	NA
WP_067343174.1|353308_354733_-	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	34.0	8.4e-51
WP_159425771.1|357053_357548_+	DUF1269 domain-containing protein	NA	NA	NA	NA	NA
WP_067343179.1|357991_358807_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_067342987.1|358958_359750_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.8	2.6e-25
WP_067343181.1|359749_361288_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP011533	Streptomyces noursei ATCC 11455 chromosome, complete genome	9815884	1275327	1332548	9815884	integrase,protease,transposase	Streptomyces_phage(25.0%)	60	1272048:1272107	1296503:1296596
1272048:1272107	attL	CAGGGGCCCTGCGCTAGCGGATCGGCATCCCCGACAGCGTGCGGGCGATGACCAGCCGCT	NA	NA	NA	NA
WP_079142230.1|1275327_1276365_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_174717845.1|1276633_1277191_+	class IV adenylate cyclase	NA	Q1WDJ9	Streptomyces_phage	66.7	3.6e-58
WP_162494987.1|1277219_1277528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_067344238.1|1278252_1278594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_067344239.1|1278661_1278961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079142232.1|1278957_1279806_-	collagen-like protein	NA	NA	NA	NA	NA
WP_159425797.1|1279715_1280024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174717838.1|1280325_1281519_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_159425798.1|1281506_1281893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_067344242.1|1281889_1282162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159425799.1|1282593_1283403_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_067344246.1|1283523_1283766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_067344248.1|1284009_1284363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_067344249.1|1285126_1286137_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_067344251.1|1286203_1287940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_067344253.1|1287936_1288257_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_067344254.1|1288400_1288862_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_067344256.1|1291284_1291638_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_079143351.1|1291654_1292191_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_099055654.1|1292304_1293081_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_159425800.1|1293019_1293388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_067344257.1|1294372_1295008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_067344261.1|1296515_1297739_-	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
1296503:1296596	attR	CAGGGGCCCTGCGCTAGCGGATCGGCATCCCCGACAGCGTGCGGGCGATGACCAGCCGCTGGATCTCGCTGGTGCCTTCGAAGATGGTGTAGAT	NA	NA	NA	NA
WP_067357721.1|1298030_1298618_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_067344263.1|1298634_1299204_-	peptide deformylase	NA	K4JRM9	Caulobacter_phage	38.0	3.2e-17
WP_039629912.1|1299391_1300630_+	DUF1727 domain-containing protein	NA	NA	NA	NA	NA
WP_067344264.1|1300668_1301397_+	glutamine amidotransferase	NA	NA	NA	NA	NA
WP_067344266.1|1301583_1302609_+	6-phosphofructokinase	NA	H8ZJH0	Ostreococcus_tauri_virus	26.4	1.4e-07
WP_067344268.1|1302725_1303685_+	cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
WP_159425801.1|1303837_1303996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_067344270.1|1304050_1304464_-|protease	protease inhibitor	protease	NA	NA	NA	NA
WP_067344272.1|1304753_1305476_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_107407286.1|1305512_1305701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_067344276.1|1305751_1306249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_067344277.1|1306315_1307923_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_067344279.1|1308407_1308791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_067344281.1|1308800_1309679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_067344282.1|1309749_1310175_+	roadblock/LC7 domain-containing protein	NA	NA	NA	NA	NA
WP_067344283.1|1310333_1310708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_067344285.1|1310714_1311566_-	urease accessory protein UreD	NA	NA	NA	NA	NA
WP_067344286.1|1311562_1312258_-	urease accessory protein UreG	NA	NA	NA	NA	NA
WP_067344288.1|1312316_1312991_-	urease accessory protein UreF	NA	NA	NA	NA	NA
WP_067344290.1|1313129_1314851_-	urease subunit alpha	NA	NA	NA	NA	NA
WP_079142238.1|1314843_1315272_-	urease subunit beta	NA	NA	NA	NA	NA
WP_039629940.1|1315289_1315592_-	urease subunit gamma	NA	NA	NA	NA	NA
WP_067344292.1|1316123_1317071_+	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_039629944.1|1317126_1317441_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_159425802.1|1317738_1317885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167739090.1|1317992_1318187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_067344294.1|1318738_1319983_-	serine hydrolase	NA	NA	NA	NA	NA
WP_067344295.1|1320060_1320723_-	DUF4097 family beta strand repeat protein	NA	NA	NA	NA	NA
WP_067344297.1|1323436_1323847_+	RidA family protein	NA	NA	NA	NA	NA
WP_159425803.1|1324087_1324693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_067344301.1|1324719_1324953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_067357723.1|1325101_1326022_+	immunity 49 family protein	NA	NA	NA	NA	NA
WP_067344303.1|1326115_1327513_-	serine hydrolase	NA	NA	NA	NA	NA
WP_067344304.1|1327678_1328389_+	TetR/AcrR family transcriptional regulator C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_067344306.1|1328426_1328696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_067344308.1|1328654_1330241_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_067344313.1|1331912_1332548_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A248SJ97	Salicola_phage	37.8	2.4e-26
>prophage 5
NZ_CP011533	Streptomyces noursei ATCC 11455 chromosome, complete genome	9815884	3937641	4003011	9815884	plate,tail,transposase	Bacillus_phage(20.0%)	44	NA	NA
WP_067347698.1|3937641_3939489_+|tail	phage tail sheath family protein	tail	J9PVC2	Bacillus_phage	35.4	8.9e-45
WP_067347700.1|3939576_3940101_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_067347703.1|3940122_3940881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159425867.1|3940873_3941704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079142707.1|3941700_3942741_+	DUF4255 domain-containing protein	NA	NA	NA	NA	NA
WP_067347708.1|3942774_3944823_+	AAA family ATPase	NA	A0A109WUE1	Acidianus_tailed_spindle_virus	34.8	4.3e-08
WP_067358384.1|3944915_3945182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_067347711.1|3952059_3952590_+	SUKH-4 family immunity protein	NA	NA	NA	NA	NA
WP_067347712.1|3952605_3953280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079142709.1|3953283_3953673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_067358385.1|3953665_3954811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_067347715.1|3954869_3955394_+|plate	baseplate assembly protein	plate	NA	NA	NA	NA
WP_174717876.1|3955447_3955780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_067347719.1|3955776_3956169_+	GPW/gp25 family protein	NA	NA	NA	NA	NA
WP_067347722.1|3956165_3959447_+|plate	putative baseplate assembly protein	plate	NA	NA	NA	NA
WP_067347725.1|3959443_3963367_+|plate	putative baseplate assembly protein	plate	NA	NA	NA	NA
WP_067347728.1|3963363_3965586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_067347731.1|3965685_3967299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079142713.1|3968553_3969660_+	serine hydrolase	NA	A0A1D8EXR7	Mycobacterium_phage	33.0	1.4e-24
WP_067347736.1|3969853_3970984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159425868.1|3971075_3971963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_067347741.1|3972097_3973288_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	36.4	5.9e-42
WP_067347744.1|3975977_3977105_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_067347746.1|3977333_3978806_+	SWIM zinc finger family protein	NA	NA	NA	NA	NA
WP_099055827.1|3978955_3980548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052286768.1|3980661_3981120_-	cobalamin B12-binding domain-containing protein	NA	NA	NA	NA	NA
WP_067347749.1|3981480_3982287_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_067347752.1|3982530_3984234_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A1B0XUH3	Freshwater_phage	35.6	9.8e-14
WP_067347755.1|3984307_3986812_-	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	39.2	4.8e-126
WP_067347757.1|3987243_3988374_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	52.0	4.5e-23
WP_067347760.1|3988520_3988874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099055698.1|3989018_3989819_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	48.5	1.6e-19
WP_067347762.1|3989939_3991064_-	esterase	NA	NA	NA	NA	NA
WP_067347765.1|3991281_3991992_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_067347767.1|3992111_3993446_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_067347770.1|3993537_3995337_-	serine/threonine protein kinase	NA	A0A2I2L395	Orpheovirus	30.0	3.9e-13
WP_067347772.1|3995654_3997127_+	PspC domain-containing protein	NA	NA	NA	NA	NA
WP_067347775.1|3997123_3997348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079142720.1|3997397_3997931_-	DoxX family protein	NA	NA	NA	NA	NA
WP_067347777.1|3998127_3999405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159425869.1|3999684_4000365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_067347782.1|4000374_4001133_+	DUF4239 domain-containing protein	NA	NA	NA	NA	NA
WP_159425870.1|4001662_4001830_+	hypothetical protein	NA	A0A2H5BLJ2	Streptomyces_phage	60.0	2.3e-05
WP_174717838.1|4001817_4003011_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP011533	Streptomyces noursei ATCC 11455 chromosome, complete genome	9815884	4205347	4213951	9815884		Bacillus_phage(66.67%)	6	NA	NA
WP_067348139.1|4205347_4206088_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.0	2.7e-37
WP_067348142.1|4206239_4207358_-	trypsin-like peptidase domain-containing protein	NA	W5SAB9	Pithovirus	28.4	1.4e-05
WP_067348143.1|4207475_4208501_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	29.0	6.3e-24
WP_067348145.1|4208525_4209368_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.1	2.1e-17
WP_167739099.1|4210187_4212089_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	30.8	4.5e-52
WP_067348149.1|4212217_4213951_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.2	1.5e-41
>prophage 7
NZ_CP011533	Streptomyces noursei ATCC 11455 chromosome, complete genome	9815884	4730231	4739162	9815884	tail	Streptomyces_phage(83.33%)	7	NA	NA
WP_067349035.1|4730231_4730468_-	hypothetical protein	NA	A0A2H5BLH6	Streptomyces_phage	67.5	4.1e-19
WP_067349038.1|4730464_4731784_-	peptidoglycan-binding protein	NA	A0A2H5BLG5	Streptomyces_phage	61.8	5.3e-108
WP_067349040.1|4731900_4732101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079142788.1|4732117_4733224_-	hypothetical protein	NA	A0A1J0MBV9	Streptomyces_phage	55.2	6.4e-107
WP_067349046.1|4733257_4734286_-	hypothetical protein	NA	A0A1J0MC86	Streptomyces_phage	55.7	6.0e-59
WP_067349048.1|4734311_4735214_-|tail	phage tail family protein	tail	A0A1J0MBX9	Streptomyces_phage	50.2	5.5e-64
WP_067349051.1|4735223_4739162_-|tail	phage tail tape measure protein	tail	A0A166XZ24	Gordonia_phage	29.1	1.0e-42
>prophage 8
NZ_CP011533	Streptomyces noursei ATCC 11455 chromosome, complete genome	9815884	4743083	4758458	9815884	portal	Streptomyces_phage(41.67%)	17	NA	NA
WP_067349072.1|4743083_4743965_-	hypothetical protein	NA	A0A1L2JY55	Aeribacillus_phage	43.6	7.7e-55
WP_067349074.1|4744003_4744636_-	hypothetical protein	NA	D7NW52	Streptomyces_phage	49.7	4.4e-28
WP_099055711.1|4744697_4745747_-	hypothetical protein	NA	A0A1C9EHV4	Gordonia_phage	36.4	5.6e-36
WP_067349077.1|4745743_4747192_-|portal	phage portal protein	portal	D7NW49	Streptomyces_phage	62.7	2.6e-172
WP_067349080.1|4747208_4748822_-	hypothetical protein	NA	D7NW48	Streptomyces_phage	59.6	7.7e-186
WP_099055839.1|4748805_4749177_-	hypothetical protein	NA	D7NW47	Streptomyces_phage	45.5	1.5e-20
WP_067349085.1|4751205_4751754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_067349087.1|4751848_4752574_-	site-specific DNA-methyltransferase	NA	A0A097EWK8	Mycobacterium_phage	54.7	9.8e-64
WP_067349090.1|4752930_4753548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159425883.1|4753584_4754007_-	WhiB family transcriptional regulator	NA	NA	NA	NA	NA
WP_067349096.1|4754041_4754473_-	single-stranded DNA-binding protein	NA	G8IEB1	Mycobacterium_phage	50.5	9.4e-22
WP_067349098.1|4754472_4755018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_067349101.1|4755014_4755971_-	hypothetical protein	NA	A0A1J0MCR8	Streptomyces_phage	40.4	2.2e-39
WP_067349103.1|4756022_4756403_-	hypothetical protein	NA	Q854T6	Mycobacterium_virus	39.7	7.0e-13
WP_067349106.1|4756402_4756744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_067349107.1|4756740_4757544_-	recombinase RecT	NA	A0A173G9I3	Propionibacterium_phage	49.8	5.8e-57
WP_067349110.1|4757540_4758458_-	YqaJ viral recombinase family protein	NA	A0A173G9J1	Propionibacterium_phage	38.3	1.2e-42
>prophage 9
NZ_CP011533	Streptomyces noursei ATCC 11455 chromosome, complete genome	9815884	7579768	7612812	9815884	portal,terminase,tail,transposase	Streptomyces_phage(100.0%)	39	NA	NA
WP_079143597.1|7579768_7581118_+|terminase	terminase	terminase	A0A2H5BLJ5	Streptomyces_phage	86.0	5.4e-233
WP_159425944.1|7581114_7581456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_067354067.1|7581671_7582142_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_174717921.1|7582145_7583306_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_067358967.1|7583388_7584813_+|portal	phage portal protein	portal	A0A2H5BLC8	Streptomyces_phage	77.9	2.0e-209
WP_067354071.1|7584805_7585798_+	hypothetical protein	NA	A0A2H5BLE7	Streptomyces_phage	73.4	1.6e-133
WP_067354074.1|7585811_7586321_+	hypothetical protein	NA	A0A2H5BLC4	Streptomyces_phage	75.7	4.6e-36
WP_067354076.1|7586412_7587351_+	hypothetical protein	NA	A0A2H5BLD0	Streptomyces_phage	78.2	3.5e-130
WP_067354079.1|7587358_7587730_+	hypothetical protein	NA	A0A2H5BLD2	Streptomyces_phage	57.7	1.5e-28
WP_067354081.1|7587726_7588050_+	hypothetical protein	NA	A0A2H5BLI1	Streptomyces_phage	82.1	2.6e-45
WP_067354084.1|7588054_7588336_+	DUF5403 family protein	NA	A0A2H5BLF7	Streptomyces_phage	56.4	1.7e-19
WP_067354086.1|7588332_7588740_+	hypothetical protein	NA	A0A2H5BLG7	Streptomyces_phage	80.7	6.1e-55
WP_067354089.1|7588759_7589347_+	hypothetical protein	NA	A0A2H5BLI6	Streptomyces_phage	80.0	3.7e-85
WP_067354091.1|7589470_7589794_+|tail	phage tail assembly protein	tail	A0A2H5BLK7	Streptomyces_phage	63.6	1.7e-31
WP_159425945.1|7589853_7590204_+	hypothetical protein	NA	A0A2H5BLD8	Streptomyces_phage	67.2	4.9e-37
WP_067354097.1|7590176_7592864_+	hypothetical protein	NA	A0A2H5BLG0	Streptomyces_phage	67.5	8.1e-71
WP_067354100.1|7592865_7593765_+|tail	phage tail protein	tail	A0A2H5BLD4	Streptomyces_phage	45.7	2.1e-95
WP_067354102.1|7593774_7594836_+	hypothetical protein	NA	A0A1J0MCJ7	Streptomyces_phage	48.1	3.6e-91
WP_159425946.1|7594832_7596629_+	poly-gamma-glutamate hydrolase family protein	NA	A0A2H5BLE2	Streptomyces_phage	65.7	3.2e-132
WP_067354105.1|7596628_7597327_+	hypothetical protein	NA	A0A1J0MC85	Streptomyces_phage	42.9	1.7e-41
WP_067354108.1|7597400_7598432_+	CHAP domain-containing protein	NA	A0A291LH93	Streptomyces_phage	44.4	5.3e-71
WP_067354110.1|7598435_7598678_+	hypothetical protein	NA	A0A2H5BLH6	Streptomyces_phage	70.9	1.5e-24
WP_067354113.1|7598728_7599313_+	hypothetical protein	NA	A0A2H5BLJ7	Streptomyces_phage	61.5	1.4e-60
WP_067354116.1|7599300_7599552_+	hypothetical protein	NA	A0A2H5BLL6	Streptomyces_phage	55.7	1.7e-15
WP_067354118.1|7599680_7600478_+	hypothetical protein	NA	A0A2H5BLE4	Streptomyces_phage	82.2	1.0e-122
WP_067354121.1|7600590_7601331_+	hypothetical protein	NA	A0A2H5BLF0	Streptomyces_phage	78.0	1.7e-111
WP_067354122.1|7601422_7601704_+	hypothetical protein	NA	A0A2H5BLF1	Streptomyces_phage	76.3	4.1e-34
WP_067354129.1|7601815_7602211_+	hypothetical protein	NA	A0A2H5BLK6	Streptomyces_phage	72.1	1.2e-50
WP_067354131.1|7602286_7604719_+	toprim domain-containing protein	NA	A0A2H5BLM3	Streptomyces_phage	76.7	0.0e+00
WP_067354134.1|7604814_7606680_+	DNA polymerase I	NA	A0A2H5BLF8	Streptomyces_phage	84.9	1.9e-308
WP_067354136.1|7607024_7607693_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_067354139.1|7607975_7608203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_067354142.1|7608522_7609371_+	sigma-70 family RNA polymerase sigma factor	NA	A0A2H5BLH5	Streptomyces_phage	68.0	1.2e-97
WP_159425947.1|7609367_7609655_+	HNH endonuclease	NA	A0A2H5BLF5	Streptomyces_phage	67.0	2.4e-26
WP_159425948.1|7609636_7609786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_067354145.1|7609813_7610287_+	hypothetical protein	NA	A0A2H5BLJ2	Streptomyces_phage	42.0	4.6e-22
WP_174717838.1|7610274_7611468_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_067354146.1|7611769_7611979_-	DUF397 domain-containing protein	NA	A0A1J0MC88	Streptomyces_phage	50.8	1.8e-07
WP_079142996.1|7611975_7612812_-	helix-turn-helix transcriptional regulator	NA	A0A1J0MBX1	Streptomyces_phage	31.9	2.5e-18
>prophage 10
NZ_CP011533	Streptomyces noursei ATCC 11455 chromosome, complete genome	9815884	9352022	9467571	9815884	integrase,bacteriocin,protease,transposase	Planktothrix_phage(16.67%)	99	9409699:9409758	9466929:9467827
WP_067357105.1|9352022_9353042_+|bacteriocin	bacteriocin fulvocin C-related protein	bacteriocin	NA	NA	NA	NA
WP_079143206.1|9353334_9353910_+	DinB family protein	NA	NA	NA	NA	NA
WP_067357108.1|9354082_9354988_+	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_067357111.1|9355093_9355567_-	aminoglycoside 6'-N-acetyltransferase	NA	NA	NA	NA	NA
WP_159426029.1|9355746_9356007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_067357116.1|9356693_9357314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_067357125.1|9358318_9359200_+	trypsin-like peptidase domain-containing protein	NA	NA	NA	NA	NA
WP_067357128.1|9360130_9360712_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_067357130.1|9360797_9361556_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_067357133.1|9361682_9362354_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_067357135.1|9362350_9363091_+	SRPBCC domain-containing protein	NA	NA	NA	NA	NA
WP_067357137.1|9363274_9363847_+	dihydrofolate reductase family protein	NA	NA	NA	NA	NA
WP_067357140.1|9363906_9364866_-	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_159426030.1|9364987_9365605_-	META domain-containing protein	NA	NA	NA	NA	NA
WP_067357145.1|9366110_9366974_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_067357148.1|9367032_9367797_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_067357150.1|9368055_9369459_-	carboxypeptidase	NA	NA	NA	NA	NA
WP_067357152.1|9369919_9370681_-	pirin family protein	NA	NA	NA	NA	NA
WP_067357154.1|9371671_9372868_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_067357156.1|9372897_9373563_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_159426031.1|9373688_9374177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079143211.1|9374202_9375264_+	peptidoglycan-binding protein	NA	NA	NA	NA	NA
WP_067357161.1|9375260_9375983_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.7	2.1e-34
WP_067357165.1|9375964_9377164_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_067357168.1|9377339_9377918_+	flavoprotein	NA	NA	NA	NA	NA
WP_167739082.1|9378010_9378961_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_079143214.1|9379589_9380135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079143215.1|9380108_9380783_-	MFS transporter	NA	NA	NA	NA	NA
WP_067357173.1|9381449_9382109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_067357176.1|9382170_9382746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_067357178.1|9382905_9383202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159426034.1|9383718_9384789_+	hydroxymethylglutaryl-CoA reductase	NA	NA	NA	NA	NA
WP_067357180.1|9385141_9385711_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_067357183.1|9385697_9386519_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_067357185.1|9386715_9387810_-	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_067357188.1|9388939_9389758_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_067342866.1|9390297_9391986_-|transposase	ISAzo13 family transposase	transposase	NA	NA	NA	NA
WP_067359176.1|9392445_9393168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_067357191.1|9393632_9394532_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	35.1	5.5e-32
WP_167739122.1|9394630_9395974_-	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_067357196.1|9396449_9397706_-	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_067357198.1|9398376_9398703_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_079143221.1|9398995_9400216_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_079143222.1|9401306_9401510_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_067343027.1|9404582_9405329_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_159426035.1|9406885_9409021_-|transposase	ISAzo13 family transposase	transposase	NA	NA	NA	NA
WP_067357209.1|9409019_9409199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159426036.1|9409323_9409701_+	hypothetical protein	NA	NA	NA	NA	NA
9409699:9409758	attL	TGAACCTCTTTCATCCTGAGTAGTCGCAGGTCAGGAGCGTGTGAACGGCCTGGACGATGC	NA	NA	NA	NA
WP_067342997.1|9409708_9410455_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_067357212.1|9411096_9411984_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_067357215.1|9411997_9412744_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_079143225.1|9413107_9413857_+	DUF4239 domain-containing protein	NA	NA	NA	NA	NA
WP_067357219.1|9414545_9415811_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_159426037.1|9415848_9416148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159426038.1|9416144_9416603_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_067359177.1|9416881_9418042_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_067357222.1|9418274_9418577_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_159426039.1|9418708_9419050_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_067357226.1|9419046_9419271_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_079143684.1|9419320_9420355_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	29.4	2.7e-35
WP_079143686.1|9420406_9420604_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_159426041.1|9421673_9423482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_067357230.1|9425051_9425342_+|transposase	transposase	transposase	Q9ETV7	Enterobacteria_phage	38.1	2.3e-08
WP_159426042.1|9425981_9426419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_067343027.1|9427143_9427890_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_067357233.1|9428045_9428372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159426043.1|9428456_9429725_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_159426044.1|9429624_9430308_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_067357235.1|9430297_9430777_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_159426045.1|9431134_9432214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079143230.1|9432893_9433373_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_067357242.1|9434264_9434501_-	hypothetical protein	NA	NA	NA	NA	NA
WP_067357244.1|9434497_9435850_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_067357247.1|9435943_9436540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159426046.1|9436690_9437419_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_067357251.1|9437464_9438229_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_067357254.1|9438254_9438503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159426047.1|9439476_9439698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_067343085.1|9439743_9440508_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_067357259.1|9440646_9441084_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079143233.1|9441296_9441539_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_159426048.1|9441755_9443279_+	thiol-activated cytolysin family protein	NA	NA	NA	NA	NA
WP_099055765.1|9443342_9444092_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_107407346.1|9446666_9447728_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_079142319.1|9448102_9449698_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_159425740.1|9449902_9451402_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_067357272.1|9451451_9451952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079143237.1|9452386_9453673_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_067343085.1|9454802_9455567_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_067357251.1|9456815_9457580_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_079143239.1|9457885_9458938_+	M12 family metallopeptidase	NA	A0A0H4M9A8	Lutzomyia_reovirus	34.2	3.0e-21
WP_099055767.1|9461491_9462660_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	37.0	4.8e-44
WP_159426050.1|9462804_9463119_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_067357285.1|9463136_9463454_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_099055768.1|9463481_9464213_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_079143240.1|9464224_9464536_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_159426051.1|9464768_9465680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_067342997.1|9466231_9466978_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_159425749.1|9466998_9467571_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
9466929:9467827	attR	GCATCGTCCAGGCCGTTCACACGCTCCTGACCTGCGACTACTCAGGATGAAAGAGGTTCAGTTAACCACCGTGGCAGGGCCGTTGAGCTGGAACATTACGACAGGACTGGACACCGAGCAACTTGACGGGCTGGTCGCACGAGTTCACCAAGAGCTCGTGCAGGATCCGGACCCACCGGTGATGCCGGGGCGGATGTGGGCGCTGGGCCTGTACAAGTCGGTGGTGTTGGTGCTGTTCCTGCTGCGGCAGAACCCAGTCCAGGAGGTGGCCGCCGAGTTGTTCGGGATCTCCCAGGCCACCGTCTCCAGGAGGTGGACGGCCCTGCTGCCGATGGTGGAGAAGGTCCTGGCCACGCACGTTCCCGATCCCACCGAGGCCTCTGCCGGCCGGATCGTACTCGTGGATGGCACCTTGGTCACGACGTGGGACTGGTCCAGCGAGGGCACCACGATGTTCTCCGGCAAGCACCGCGACACCGGCTTCAACCTGCAGACCGCCGCCACTCTCGCCGGCGACCTGCTCGCGGTCTCCGCGCCGGTGCCCGGCAGCCGGCACGACATGCACGCCTGGCGCCAGTCCCACTTCCCCGAGGCATTCACCGAACGCGAGGGCATAGGCGACCTGGGCTACGCCGGCTCCTGACTGTTCACCCCCAGGCGCAAGCCGCCCGGCCAGGAACGATCCGCCGGAGACAAGAGAGCCAACCGCTCCGTCAACACGCTCCGAGCCGCAGTCGAACGGGCCATCGCGCACCTGAAGAACTGGAAGATTCTCGCCACCCGCTACCGCGGCCCCCTCACCCGCTTCCCCGACATCGTCAAGACCGTCACCGCCCTCACCTTCTACACAAGAGGCTGGTGAGGCCTACGTGAATAACCCTCCGGGTTCCACGATCTCC	NA	NA	NA	NA
>prophage 11
NZ_CP011533	Streptomyces noursei ATCC 11455 chromosome, complete genome	9815884	9478660	9698013	9815884	protease,transposase	Enterobacteria_phage(18.52%)	163	NA	NA
WP_067357314.1|9478660_9479395_-|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_067357316.1|9479904_9481074_-	methyltransferase domain-containing protein	NA	A0A1J0MC50	Streptomyces_phage	41.1	1.7e-73
WP_067357219.1|9482822_9484088_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_067357320.1|9484877_9485879_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_168409272.1|9488084_9488489_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_067357251.1|9488491_9489256_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_168409273.1|9489375_9489798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079143245.1|9490172_9490937_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_067342997.1|9491204_9491951_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_159426052.1|9492015_9492903_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_159426053.1|9492947_9493679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159426054.1|9494618_9495467_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	54.4	1.2e-68
WP_067359184.1|9495725_9496550_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_079143292.1|9496867_9498436_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_174717939.1|9498915_9500154_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	37.1	1.1e-30
WP_067342984.1|9500153_9500981_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	43.0	2.6e-52
WP_067342987.1|9502391_9503183_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.8	2.6e-25
WP_107407348.1|9503340_9503490_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_159426055.1|9504184_9504619_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_159426056.1|9504764_9505343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079143249.1|9507521_9508172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079143250.1|9510937_9511333_+	WhiB family transcriptional regulator	NA	NA	NA	NA	NA
WP_159426057.1|9512063_9512855_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_159426058.1|9513043_9513865_+|protease	trypsin-like serine protease	protease	Q6JKF3	Neodiprion_sertifer_nucleopolyhedrovirus	31.6	4.9e-19
WP_079143253.1|9514339_9515647_+	LCP family protein	NA	NA	NA	NA	NA
WP_159426059.1|9516036_9517029_+	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_067359039.1|9518016_9518970_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_079143256.1|9520076_9520868_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_079143257.1|9523090_9523408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159426060.1|9523480_9524008_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_079143259.1|9524064_9524811_-	DUF4239 domain-containing protein	NA	NA	NA	NA	NA
WP_079143260.1|9527248_9527890_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	33.5	1.4e-24
WP_067357349.1|9527984_9529694_-|transposase	ISAzo13 family transposase	transposase	NA	NA	NA	NA
WP_099055769.1|9529881_9531118_+|transposase	IS3 family transposase	transposase	A0A160DCU2	Gordonia_phage	59.9	2.0e-101
WP_159426061.1|9531128_9532220_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_079143245.1|9532430_9533195_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_067342997.1|9533462_9534209_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_067357356.1|9534653_9535172_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_079143263.1|9535168_9536425_-|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	70.8	4.6e-170
WP_159426062.1|9536543_9537272_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_159426063.1|9537963_9538239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_067357363.1|9538260_9539007_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_079143263.1|9539484_9540741_+|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	70.8	4.6e-170
WP_067357356.1|9540737_9541256_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_079143265.1|9543395_9543878_+	DoxX family protein	NA	NA	NA	NA	NA
WP_067342856.1|9544029_9545238_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_159426064.1|9545524_9545770_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_099055770.1|9545781_9546513_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_067343027.1|9546819_9547566_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_174717938.1|9548643_9550188_-|transposase	ISL3 family transposase	transposase	A9YX10	Burkholderia_phage	29.4	2.0e-05
WP_067357371.1|9550680_9550974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_067343085.1|9551099_9551864_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_159426065.1|9552026_9552461_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_067342830.1|9552595_9553342_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_159426066.1|9553507_9554086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079143267.1|9556604_9557048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079143250.1|9559691_9560087_+	WhiB family transcriptional regulator	NA	NA	NA	NA	NA
WP_159426057.1|9560817_9561609_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_159426058.1|9561797_9562619_+|protease	trypsin-like serine protease	protease	Q6JKF3	Neodiprion_sertifer_nucleopolyhedrovirus	31.6	4.9e-19
WP_159426067.1|9562832_9563612_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_079143269.1|9563920_9565285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_067357381.1|9565499_9566246_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_107407346.1|9566337_9567399_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_067357382.1|9571499_9571739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_067357384.1|9573082_9573733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159426068.1|9574245_9574896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_067357392.1|9574892_9575366_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_159425740.1|9575668_9577168_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_159426069.1|9577154_9577304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_067357395.1|9578295_9579189_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_079141959.1|9579397_9579928_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_079143271.1|9580581_9581034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099055771.1|9581614_9582783_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	37.1	2.5e-45
WP_067342866.1|9582994_9584683_-|transposase	ISAzo13 family transposase	transposase	NA	NA	NA	NA
WP_067357397.1|9585428_9585713_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_067357399.1|9586765_9587311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079143272.1|9587325_9587637_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_159426070.1|9588975_9589287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099055771.1|9589374_9590542_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	37.1	2.5e-45
WP_067343085.1|9591447_9592212_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_079143273.1|9592333_9593023_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_067343085.1|9593036_9593801_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_159426071.1|9596741_9597440_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_067357405.1|9598567_9599647_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_159426072.1|9602024_9602720_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_079143275.1|9602972_9603515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159426073.1|9605366_9606461_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_159426074.1|9606360_9607044_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_159426075.1|9607239_9607494_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_067342866.1|9607505_9609194_-|transposase	ISAzo13 family transposase	transposase	NA	NA	NA	NA
WP_067357410.1|9609354_9610731_-	S53 family peptidase	NA	NA	NA	NA	NA
WP_079143245.1|9610755_9611520_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_067342997.1|9611787_9612534_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_067343875.1|9613804_9614662_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_067343877.1|9614658_9615630_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_067343879.1|9615635_9616931_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_079143277.1|9617688_9618144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079143278.1|9618863_9619592_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_099055772.1|9620102_9621271_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	37.1	7.4e-45
WP_067343085.1|9621663_9622428_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_079143279.1|9622531_9623176_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_174717838.1|9624890_9626084_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_079143280.1|9627869_9628334_-	DoxX family protein	NA	NA	NA	NA	NA
WP_067343054.1|9630040_9631276_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_159426079.1|9631451_9632024_+	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_079143289.1|9631939_9632506_+|transposase	transposase	transposase	S5VXX4	Leptospira_phage	31.9	2.5e-06
WP_067359192.1|9632598_9633069_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_159426076.1|9633119_9633323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159426077.1|9633329_9633749_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_159425737.1|9634899_9636072_-	family 2 glycosyl transferase	NA	NA	NA	NA	NA
WP_079141951.1|9637385_9637766_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_067357427.1|9637824_9638187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167739031.1|9638200_9638410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079143281.1|9638546_9638858_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_067343012.1|9639282_9639822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079141947.1|9640029_9640359_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_067343008.1|9643304_9644114_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_067343027.1|9644920_9645667_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_099055777.1|9645942_9646287_+	transglycosylase family protein	NA	A0A1J0GVU2	Streptomyces_phage	61.4	2.8e-21
WP_067343006.1|9646430_9646766_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_067343004.1|9646964_9647930_+	isopenicillin N synthase family oxygenase	NA	NA	NA	NA	NA
WP_067343002.1|9648019_9648346_+|transposase	transposase	transposase	A0A2P1JR43	Mycobacterium_phage	44.0	2.8e-10
WP_079141943.1|9648483_9648816_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	53.5	1.2e-21
WP_159425735.1|9648885_9649665_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_067342999.1|9649928_9651281_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.5	3.6e-27
WP_067342997.1|9651369_9652116_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_079141939.1|9652282_9652495_+|transposase	transposase	transposase	A0A160DCU2	Gordonia_phage	50.0	1.3e-11
WP_159425733.1|9654182_9654746_+	DUF4142 domain-containing protein	NA	NA	NA	NA	NA
WP_067342866.1|9655003_9656692_+|transposase	ISAzo13 family transposase	transposase	NA	NA	NA	NA
WP_067342992.1|9656745_9657993_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_067342990.1|9658254_9659271_+	DNA-directed RNA polymerase subunit alpha	NA	NA	NA	NA	NA
WP_067357475.1|9659673_9659877_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_079141933.1|9661587_9662064_-	helix-turn-helix domain containing protein	NA	NA	NA	NA	NA
WP_079143292.1|9662963_9664532_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_067342988.1|9664729_9666268_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_067342987.1|9666267_9667059_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.8	2.6e-25
WP_159425732.1|9667173_9667584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174717939.1|9668024_9669263_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	37.1	1.1e-30
WP_067342984.1|9669262_9670090_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	43.0	2.6e-52
WP_159425731.1|9670545_9671730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_067342910.1|9672071_9672956_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_159425730.1|9674023_9675454_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079141931.1|9675642_9675852_-	DUF397 domain-containing protein	NA	NA	NA	NA	NA
WP_079141929.1|9675848_9676694_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_159425729.1|9676817_9677294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_067342974.1|9678229_9678757_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_067357464.1|9679275_9679464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_067342972.1|9679445_9680300_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_067342970.1|9680525_9681449_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_067342968.1|9681593_9681839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079141925.1|9682737_9683328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099055773.1|9683414_9684038_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	46.2	7.7e-09
WP_079141921.1|9684925_9686440_-	ABC transporter ATP-binding protein/permease	NA	NA	NA	NA	NA
WP_079143291.1|9686600_9687020_-	lasso peptide biosynthesis B2 protein	NA	NA	NA	NA	NA
WP_159425728.1|9687025_9687322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099055776.1|9687315_9689067_-	asparagine synthase	NA	NA	NA	NA	NA
WP_159425727.1|9689163_9689319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_067342956.1|9689557_9691009_+	transcriptional regulator	NA	K4IBI5	Streptomyces_phage	30.5	2.6e-39
WP_079143290.1|9691730_9692027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_067357458.1|9692032_9694261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_067342952.1|9694257_9694947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_067342950.1|9695118_9697239_+	Helicase associated domain protein	NA	NA	NA	NA	NA
WP_079143289.1|9697446_9698013_-|transposase	transposase	transposase	S5VXX4	Leptospira_phage	31.9	2.5e-06
>prophage 12
NZ_CP011533	Streptomyces noursei ATCC 11455 chromosome, complete genome	9815884	9725271	9798552	9815884	transposase	Planktothrix_phage(33.33%)	55	NA	NA
WP_067342910.1|9725271_9726156_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_159425716.1|9726145_9726301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_067342908.1|9727574_9727889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159425715.1|9728478_9728862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159425714.1|9729338_9729743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_067342905.1|9729817_9733099_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_067342903.1|9733098_9733527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_067342901.1|9733523_9733967_-	pilus assembly protein	NA	NA	NA	NA	NA
WP_079141906.1|9733968_9734391_-	pilus assembly protein	NA	NA	NA	NA	NA
WP_067342900.1|9734394_9734601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_067342898.1|9734621_9735500_-	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_067342896.1|9735496_9736462_-	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_067342895.1|9736422_9737823_-	CpaF family protein	NA	NA	NA	NA	NA
WP_067342893.1|9737956_9738757_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099055775.1|9738759_9739389_-	flagellar biosynthesis protein FlgA	NA	NA	NA	NA	NA
WP_159425713.1|9740350_9740884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_067342888.1|9741467_9744113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079143285.1|9744951_9745956_-	bifunctional lytic transglycosylase/C40 family peptidase	NA	NA	NA	NA	NA
WP_159425712.1|9746057_9748334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079143284.1|9749772_9751476_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	28.2	8.6e-10
WP_067342881.1|9751834_9752227_-	lasso peptide biosynthesis B2 protein	NA	NA	NA	NA	NA
WP_159425711.1|9752357_9753194_-	hypothetical protein	NA	A0A0F7L8X8	uncultured_marine_virus	29.4	3.0e-08
WP_067342879.1|9753280_9755863_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_079143283.1|9755859_9756435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_067342876.1|9756452_9756806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079141902.1|9756805_9757582_-	conjugal transfer protein	NA	NA	NA	NA	NA
WP_159425710.1|9757986_9758988_+	hypothetical protein	NA	NA	NA	NA	NA
WP_067342872.1|9759064_9759610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079141900.1|9760175_9761519_-	cytochrome P450	NA	NA	NA	NA	NA
WP_067342868.1|9762221_9763907_-|transposase	ISAzo13 family transposase	transposase	NA	NA	NA	NA
WP_067342866.1|9763977_9765666_-|transposase	ISAzo13 family transposase	transposase	NA	NA	NA	NA
WP_107407272.1|9765738_9766386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_067342863.1|9767371_9767839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_067342861.1|9768259_9769159_-	replication-relaxation family protein	NA	NA	NA	NA	NA
WP_159425709.1|9769354_9770194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159425708.1|9770714_9770873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159425707.1|9771158_9771719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159425706.1|9771979_9772564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_067342856.1|9773681_9774890_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_067342854.1|9776000_9776729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_067342852.1|9777366_9780969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174717825.1|9781871_9783659_+	maturase	NA	A0A0U4J920	Pseudomonas_phage	28.3	2.7e-22
WP_167739084.1|9784411_9786034_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_067342849.1|9786173_9790631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_067342847.1|9790737_9790956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_067342845.1|9790958_9791240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_067342844.1|9791332_9791635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_067342842.1|9791713_9792298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_067342840.1|9792618_9793212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_067342839.1|9793407_9795138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_067342837.1|9795137_9795593_-	hypothetical protein	NA	NA	NA	NA	NA
WP_067342835.1|9795705_9796323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_067342833.1|9796322_9796583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_067342831.1|9796617_9797487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_067342830.1|9797805_9798552_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
