The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP016811	Klebsiella pneumoniae strain DHQP1002001 chromosome, complete genome	5184828	666886	729120	5184828	tRNA,transposase,tail	Bacillus_phage(21.05%)	46	NA	NA
WP_004175147.1|666886_667750_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
WP_068814719.1|667760_668534_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.2	3.0e-26
WP_004151134.1|668775_669672_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_068814721.1|669913_671275_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.5	3.9e-207
WP_004175198.1|671593_672316_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_068814723.1|672312_673791_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	1.4e-29
WP_004149057.1|673787_675203_-	MFS transporter	NA	NA	NA	NA	NA
WP_009485875.1|675204_678282_-	multidrug efflux RND transporter permease subunit MdtC	NA	NA	NA	NA	NA
WP_004149055.1|678282_681405_-	MdtB/MuxB family multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_068814724.1|681404_682643_-	MdtA/MuxA family multidrug efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_068814726.1|682943_684224_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_001101446.1|684255_685281_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_077269499.1|685599_686568_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_001101446.1|686862_687888_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_021440454.1|688305_688917_-	positive transcription regulator	NA	NA	NA	NA	NA
WP_032411492.1|689032_689173_-	small membrane protein	NA	NA	NA	NA	NA
WP_000019449.1|689356_690337_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	5.2e-185
WP_004899452.1|690609_691311_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_068814727.1|691325_693182_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_016531337.1|693470_694823_-	molecular chaperone	NA	NA	NA	NA	NA
WP_023282839.1|694960_695809_+	DNA-3-methyladenine glycosylase 2	NA	NA	NA	NA	NA
WP_002912442.1|695923_696565_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	39.3	2.0e-36
WP_004151145.1|696655_697237_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	41.6	5.1e-31
WP_031591026.1|697267_699115_+	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_068814730.1|699346_700930_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	43.5	5.0e-36
WP_086910769.1|701695_702586_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.6	3.3e-45
WP_031591033.1|702978_703608_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_068814731.1|704567_706007_+	capsule assembly Wzi family protein	NA	NA	NA	NA	NA
WP_031591037.1|706152_707286_+	polysaccharide export protein	NA	NA	NA	NA	NA
WP_024177910.1|707291_707726_+	protein-tyrosine-phosphatase	NA	NA	NA	NA	NA
WP_068814732.1|707742_709905_+	polysaccharide biosynthesis tyrosine autokinase	NA	NA	NA	NA	NA
WP_068814733.1|709977_711408_+	undecaprenyl-phosphate galactose phosphotransferase WbaP	NA	NA	NA	NA	NA
WP_068814736.1|711431_712895_+	lipopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_023322974.1|712887_714018_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_031591043.1|714026_715121_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_159080874.1|715665_716091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071549031.1|716333_717608_+|tail	phage tail protein	tail	A0A1J0MHZ5	Klebsiella_phage	46.5	1.4e-97
WP_158414492.1|717628_717790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023322969.1|718721_719873_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_004099053.1|720011_720980_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.8	5.1e-185
WP_031591050.1|721084_722491_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	3.6e-38
WP_162616940.1|722678_723647_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.1	9.7e-184
WP_004180506.1|723782_725198_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	31.0	1.4e-53
WP_004899416.1|725219_726590_+	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	25.9	1.1e-31
WP_031589093.1|726753_727920_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	9.1e-112
WP_031589100.1|728112_729120_+	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	28.0	4.4e-30
>prophage 2
NZ_CP016811	Klebsiella pneumoniae strain DHQP1002001 chromosome, complete genome	5184828	832495	842087	5184828	transposase	Burkholderia_phage(33.33%)	10	NA	NA
WP_004099053.1|832495_833464_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.8	5.1e-185
WP_002911596.1|833643_834789_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	58.7	1.1e-117
WP_004148893.1|835180_835447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151461.1|835327_835609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002911594.1|835651_836359_+	phosphohydrolase	NA	S4W232	Pandoravirus	27.7	2.8e-07
WP_014343261.1|836435_837836_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	53.0	3.9e-101
WP_004200342.1|837816_838311_+	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	50.7	5.7e-31
WP_004899215.1|838285_839197_-	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_002911591.1|839380_840292_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_040183072.1|840407_842087_+	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	41.1	6.9e-20
>prophage 3
NZ_CP016811	Klebsiella pneumoniae strain DHQP1002001 chromosome, complete genome	5184828	979430	1073367	5184828	tail,plate,capsid,integrase,head,terminase,transposase,protease,portal,holin	Vibrio_phage(29.11%)	116	989538:989555	1044570:1044587
WP_004175481.1|979430_980177_+|protease	proteasome-type protease	protease	NA	NA	NA	NA
WP_014343226.1|980656_981514_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_004200323.1|981669_982650_+	fatty acid desaturase	NA	NA	NA	NA	NA
WP_004189318.1|982642_983443_+	PhnD/SsuA/transferrin family substrate-binding protein	NA	NA	NA	NA	NA
WP_004145488.1|983480_983603_-	nitrilotriacetate monooxygenase	NA	NA	NA	NA	NA
WP_014343223.1|983900_984044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910764.1|984220_985162_+	transcriptional regulator TdcA	NA	NA	NA	NA	NA
WP_002910762.1|985255_986245_+	bifunctional threonine ammonia-lyase/L-serine ammonia-lyase TdcB	NA	NA	NA	NA	NA
WP_004200322.1|986270_987602_+	threonine/serine transporter TdcC	NA	NA	NA	NA	NA
WP_002910759.1|987629_988838_+	propionate kinase	NA	NA	NA	NA	NA
WP_068814843.1|988866_991161_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.7	1.5e-158
989538:989555	attL	GCGCGAGGAGCTGGCCGA	NA	NA	NA	NA
WP_004225356.1|991212_991359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162616953.1|991648_992707_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004175489.1|992816_993731_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_068814845.1|993740_995027_+	high-affinity branched-chain amino acid ABC transporter permease LivM	NA	NA	NA	NA	NA
WP_004148803.1|995023_995899_+	ATP-binding cassette domain-containing protein	NA	A0A285PWH2	Cedratvirus	25.5	1.5e-10
WP_068814850.1|995895_996615_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.0	1.5e-11
WP_002910720.1|996620_997514_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004180410.1|997797_999441_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	50.4	5.7e-136
WP_002910717.1|999490_999967_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002910715.1|1000065_1000992_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004175494.1|1001295_1002591_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	36.8	9.6e-62
WP_162616943.1|1002602_1003412_+	solute-binding protein	NA	NA	NA	NA	NA
WP_065803155.1|1003652_1004915_-|integrase	site-specific integrase	integrase	A0A286S1S8	Klebsiella_phage	94.8	1.5e-232
WP_016244760.1|1004957_1005203_-	excisionase family protein	NA	A0A286S2A4	Klebsiella_phage	93.4	3.8e-36
WP_029497927.1|1005420_1006170_-	hypothetical protein	NA	A0A077KCB2	Edwardsiella_phage	60.3	2.3e-84
WP_023312753.1|1006166_1006391_-	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	60.8	1.5e-18
WP_123640128.1|1006622_1006844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048265752.1|1006914_1007208_-	host cell division inhibitory peptide Kil	NA	NA	NA	NA	NA
WP_159080877.1|1007876_1008020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068814854.1|1008361_1008958_-	helix-turn-helix transcriptional regulator	NA	K7P850	Enterobacteria_phage	27.1	4.1e-07
WP_048289165.1|1009066_1009279_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_068814858.1|1009299_1009620_+	hypothetical protein	NA	A0A0M4RU01	Salmonella_phage	68.9	5.0e-36
WP_047666494.1|1009815_1010070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068814860.1|1010066_1011161_+	hypothetical protein	NA	K7PLZ7	Enterobacterial_phage	40.3	9.7e-31
WP_068814862.1|1011187_1011583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023158880.1|1011582_1011804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068814864.1|1011796_1012582_+	hypothetical protein	NA	C7BGF1	Burkholderia_phage	52.1	1.5e-62
WP_040209280.1|1013233_1013497_+	DUF4752 family protein	NA	T1S9K2	Salmonella_phage	75.6	2.2e-29
WP_068814868.1|1013938_1014214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064161787.1|1015078_1015813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065520066.1|1016844_1017438_+	hypothetical protein	NA	A0A0M4RU10	Salmonella_phage	63.2	1.2e-40
WP_068814873.1|1017434_1018205_+	dcm methylase	NA	D5LH17	Escherichia_phage	51.2	3.0e-63
WP_077269504.1|1018201_1018846_+	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	80.5	1.2e-102
WP_068814875.1|1018842_1019442_+	hypothetical protein	NA	H9C175	Pectobacterium_phage	58.9	1.1e-65
WP_068814876.1|1020079_1020349_+|holin	holin	holin	K7P6H9	Enterobacteria_phage	77.2	8.1e-32
WP_068815639.1|1020326_1020827_+	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	84.4	5.9e-76
WP_068814877.1|1020823_1021315_+	hypothetical protein	NA	Q2NPG0	Xanthomonas_virus	43.9	7.4e-31
WP_068814879.1|1021416_1021767_+	hypothetical protein	NA	H2EQH5	Salmonella_phage	39.7	5.5e-12
WP_162616932.1|1022078_1022450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071549025.1|1022398_1022749_+	HNH endonuclease	NA	K7PHK9	Enterobacteria_phage	78.4	4.6e-51
WP_004884285.1|1022878_1023373_+|terminase	phage terminase small subunit P27 family	terminase	Q8HAD7	Salmonella_phage	92.0	1.2e-81
WP_068814881.1|1023369_1025100_+|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	83.0	2.3e-300
WP_068814883.1|1025294_1026524_+|portal	phage portal protein	portal	U5P411	Shigella_phage	81.7	1.3e-201
WP_068814885.1|1026510_1027164_+|head,protease	HK97 family phage prohead protease	head,protease	Q8W628	Enterobacteria_phage	87.9	9.3e-106
WP_068814887.1|1027178_1028387_+|capsid	phage major capsid protein	capsid	A0A192Y5T6	Salmonella_phage	84.2	2.2e-193
WP_077269505.1|1028413_1028629_+	hypothetical protein	NA	M1FN89	Enterobacteria_phage	42.4	7.2e-07
WP_040186339.1|1028625_1028946_+|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	39.8	1.7e-15
WP_004899632.1|1029015_1029213_+	hypothetical protein	NA	A0A286S2A5	Klebsiella_phage	96.9	2.4e-25
WP_004899631.1|1029214_1029547_+|head	phage head closure protein	head	A0A286S2A2	Klebsiella_phage	98.2	2.9e-55
WP_032437723.1|1029539_1030079_+	HK97 gp10 family phage protein	NA	A0A286S249	Klebsiella_phage	95.5	3.7e-92
WP_068814891.1|1030075_1030441_+	DUF3168 domain-containing protein	NA	A0A286S1R1	Klebsiella_phage	95.0	5.4e-63
WP_000115125.1|1030497_1030989_+	hypothetical protein	NA	A0A286S1Q8	Klebsiella_phage	100.0	2.3e-88
WP_001177591.1|1031032_1031386_+|tail	phage tail assembly protein	tail	A0A286S1N4	Klebsiella_phage	99.1	4.9e-61
WP_031591515.1|1031418_1031682_+	hypothetical protein	NA	A0A286S1P2	Klebsiella_phage	96.6	1.0e-42
WP_068814894.1|1031746_1032214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068814896.1|1032258_1034703_+|tail	phage tail tape measure protein	tail	A0A286S1S3	Klebsiella_phage	61.3	1.1e-252
WP_004207036.1|1034702_1035173_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	67.7	8.3e-64
WP_068814899.1|1035169_1035652_+	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	90.6	2.1e-78
WP_064143746.1|1035662_1036043_+	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	94.4	6.9e-69
WP_159080878.1|1036039_1036180_+	hypothetical protein	NA	A0A286S259	Klebsiella_phage	93.3	1.8e-19
WP_048981108.1|1036406_1036970_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_049090873.1|1037151_1037376_+	transcriptional regulator	NA	M1PVU4	Vibrio_phage	57.1	1.5e-15
WP_004114537.1|1039508_1040456_+	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	79.4	2.9e-140
WP_004114539.1|1040460_1040700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004114541.1|1040702_1040990_+	HTH domain-containing protein	NA	C9DGL7	Escherichia_phage	48.3	3.5e-17
WP_064355300.1|1041005_1041623_+	DUF3164 family protein	NA	A0A2I7S9B0	Vibrio_phage	59.9	2.6e-65
WP_068814901.1|1041703_1042201_+	hypothetical protein	NA	A0A0A7RUP4	Clostridium_phage	36.0	1.9e-05
WP_068814903.1|1042160_1042637_+	hypothetical protein	NA	K7PHA5	Enterobacterial_phage	37.2	3.3e-12
WP_068814905.1|1042633_1043188_+	regulatory protein GemA	NA	A0A0C4UQU3	Shigella_phage	46.7	2.4e-38
WP_064176649.1|1043184_1043574_+	transcriptional regulator	NA	A0A0C4UR27	Shigella_phage	58.1	4.6e-36
WP_141769813.1|1043582_1043846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001310555.1|1043850_1044867_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
1044570:1044587	attR	GCGCGAGGAGCTGGCCGA	NA	NA	NA	NA
WP_068814908.1|1045362_1045941_+	N-acetylmuramidase	NA	A0A2I7S9B9	Vibrio_phage	46.0	5.1e-39
WP_019704473.1|1045943_1046162_+	hypothetical protein	NA	A0A0C4UQR6	Shigella_phage	70.8	1.7e-24
WP_068814910.1|1046154_1046562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068814912.1|1046549_1047155_+	hypothetical protein	NA	M4MB79	Vibrio_phage	39.8	1.2e-22
WP_068814914.1|1047151_1047382_+	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_004114566.1|1047362_1047665_+	DUF2730 domain-containing protein	NA	M1Q558	Vibrio_phage	42.6	4.3e-13
WP_004114568.1|1047674_1047962_+	hypothetical protein	NA	A0A2I7S9D8	Vibrio_phage	64.5	8.4e-27
WP_068814916.1|1047964_1048240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004114570.1|1048229_1048808_+	DUF3486 family protein	NA	M4MCR3	Vibrio_phage	59.2	1.8e-52
WP_068814917.1|1048804_1050394_+	hypothetical protein	NA	M4MHG0	Vibrio_phage	68.5	2.7e-199
WP_068814918.1|1050393_1051965_+	DUF935 domain-containing protein	NA	A0A2I7S9K0	Vibrio_phage	56.2	4.6e-159
WP_023301732.1|1051957_1052800_+	hypothetical protein	NA	M1PVV7	Vibrio_phage	56.9	1.7e-88
WP_108676103.1|1052988_1054005_+	peptidase	NA	M1Q578	Vibrio_phage	49.1	3.9e-74
WP_068814921.1|1054007_1054907_+|head	phage head protein	head	M4MB71	Vibrio_phage	59.4	1.5e-101
WP_068814923.1|1054983_1055490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004114585.1|1055489_1055930_+	DUF1320 domain-containing protein	NA	A0A2I7S9E9	Vibrio_phage	47.9	4.9e-34
WP_048981146.1|1055929_1056472_+	phage morphogeneis protein	NA	A0A2I7S9D7	Vibrio_phage	64.2	2.9e-60
WP_068814926.1|1056468_1057080_+	hypothetical protein	NA	M1PJ94	Vibrio_phage	40.8	1.4e-39
WP_049086219.1|1057082_1057292_+	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_068814930.1|1057293_1058775_+|tail	phage tail protein	tail	M1Q565	Vibrio_phage	60.2	9.6e-167
WP_068814932.1|1058784_1059138_+|tail	phage tail protein	tail	A0A2P1A4D6	Alteromonadaceae_phage	34.2	7.7e-14
WP_068814934.1|1059141_1059525_+	hypothetical protein	NA	A0A2P9JZJ9	Alteromonadaceae_phage	40.5	3.4e-15
WP_068814936.1|1059623_1061432_+|tail	phage tail protein	tail	M4MHE6	Vibrio_phage	31.4	3.8e-64
WP_068814938.1|1061431_1062688_+	multidrug DMT transporter	NA	M4M9N2	Vibrio_phage	42.0	2.2e-87
WP_068814940.1|1062680_1063772_+|tail	phage tail protein	tail	M4M9L5	Vibrio_phage	49.0	1.3e-91
WP_068814944.1|1063762_1064302_+|plate	phage baseplate assembly protein V	plate	A0A2I7S9F6	Vibrio_phage	44.4	1.1e-32
WP_068814946.1|1064298_1064751_+	hypothetical protein	NA	A0A2I7S9F0	Vibrio_phage	43.4	6.6e-26
WP_068814950.1|1064737_1065814_+|plate	baseplate J/gp47 family protein	plate	A0A2I7S9E5	Vibrio_phage	52.0	1.0e-101
WP_068814952.1|1065798_1066383_+	YmfQ family protein	NA	M4M9M8	Vibrio_phage	47.7	4.8e-45
WP_068814954.1|1066385_1067198_+|tail	tail fiber protein	tail	X2KTY7	Enterobacteria_phage	66.7	6.9e-26
WP_068814956.1|1067197_1068073_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	37.0	2.2e-25
WP_068814961.1|1068082_1070068_+	hypothetical protein	NA	A0A1J0MHZ5	Klebsiella_phage	45.2	1.7e-126
WP_068814965.1|1070433_1073367_+	kinase	NA	A0A286S259	Klebsiella_phage	90.9	0.0e+00
>prophage 4
NZ_CP016811	Klebsiella pneumoniae strain DHQP1002001 chromosome, complete genome	5184828	1623198	1632613	5184828		Escherichia_phage(87.5%)	9	NA	NA
WP_002210516.1|1623198_1623819_-	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
WP_004183946.1|1623811_1625077_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.3	6.6e-233
WP_002903955.1|1625088_1625991_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_002210513.1|1626252_1627014_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_023280043.1|1627034_1627895_-	inhibitor-resistant class A broad-spectrum beta-lactamase SHV-26	NA	A0A077SL40	Escherichia_phage	99.3	1.7e-155
WP_004176262.1|1628192_1628453_+	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
WP_001620097.1|1628539_1629628_+	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_004176258.1|1629658_1630924_-	MFS transporter	NA	NA	NA	NA	NA
WP_161283558.1|1630978_1632613_-	DUF4981 domain-containing protein	NA	L0N6M2	Herpes_simplex_virus	55.7	6.9e-182
>prophage 5
NZ_CP016811	Klebsiella pneumoniae strain DHQP1002001 chromosome, complete genome	5184828	2075563	2130980	5184828	tail,plate,capsid,integrase,head,terminase,transposase,portal,tRNA	Enterobacteria_phage(52.94%)	62	2080791:2080808	2117217:2117234
WP_002901088.1|2075563_2076064_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_002901080.1|2076180_2076627_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_004140469.1|2076610_2077405_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_162616948.1|2077512_2078688_+	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_004140471.1|2078719_2079412_-	CTP synthase	NA	NA	NA	NA	NA
WP_004176547.1|2079557_2080067_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_014343000.1|2080071_2080410_+	DUF488 family protein	NA	NA	NA	NA	NA
WP_004190888.1|2080399_2080639_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
2080791:2080808	attL	CCCGACGGGGCTTTTTTT	NA	NA	NA	NA
WP_004213128.1|2080903_2081155_-	ogr/Delta-like zinc finger family protein	NA	A0A2I8TV89	Erwinia_phage	49.2	3.4e-08
WP_068815128.1|2081198_2082338_-	phage late control D family protein	NA	B9A7A9	Serratia_phage	71.3	3.2e-146
WP_068815130.1|2082492_2083665_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	70.2	3.2e-157
WP_032414481.1|2083664_2084180_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	61.2	3.7e-57
WP_004131585.1|2084225_2084543_+	hypothetical protein	NA	B9A7B2	Serratia_phage	54.8	1.0e-17
WP_032440702.1|2084542_2084701_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	63.3	3.5e-11
WP_068815132.1|2084687_2087663_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	46.8	9.5e-222
WP_032457467.1|2087677_2088169_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	62.7	5.6e-55
WP_068815134.1|2088484_2089972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032457351.1|2090221_2091319_-|tail	tail fiber protein	tail	A0A0M3ULH6	Salmonella_phage	29.0	1.3e-11
WP_009486478.1|2091318_2091531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068815136.1|2091527_2094554_-|tail	phage tail protein I	tail	D5LGZ2	Escherichia_phage	40.0	1.9e-23
WP_068815138.1|2094543_2095467_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	43.2	2.2e-52
WP_004131573.1|2095468_2095819_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	59.3	6.2e-24
WP_068815140.1|2095815_2096403_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	60.0	5.9e-59
WP_068815142.1|2096399_2097035_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	51.4	2.3e-56
WP_068815144.1|2097031_2097499_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	58.8	2.7e-46
WP_159080880.1|2097499_2097835_-	peptidase	NA	B6SD31	Bacteriophage	33.3	1.2e-05
WP_023339943.1|2098021_2098567_-	lysozyme	NA	Q1I0Z1	Pasteurella_virus	43.0	6.3e-31
WP_004213110.1|2098563_2098848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004131559.1|2098838_2099039_-|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	63.1	1.6e-16
WP_023339940.1|2099038_2099554_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	49.4	4.1e-40
WP_068815146.1|2099666_2100524_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	58.6	9.8e-71
WP_004213107.1|2100573_2101608_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	50.0	6.2e-96
WP_068815147.1|2101617_2102457_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	66.7	2.5e-95
WP_068815148.1|2102613_2104341_+	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	68.6	1.5e-235
WP_050597847.1|2104334_2105396_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	67.8	4.5e-142
WP_068815150.1|2105995_2106820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068815152.1|2107189_2107549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071549017.1|2107798_2109538_-	RNA-directed DNA polymerase	NA	NA	NA	NA	NA
WP_068815154.1|2112237_2113254_-	phosphoadenosine phosphosulfate reductase family protein	NA	B7SYG0	Stenotrophomonas_phage	43.7	1.5e-65
WP_068815155.1|2113527_2114094_-	3'-5' exoribonuclease	NA	D4HTX2	Vibrio_phage	33.2	7.2e-14
WP_004213098.1|2114090_2114315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004213097.1|2114383_2114656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068815159.1|2114671_2115049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023328080.1|2115064_2115283_-	hypothetical protein	NA	A0A0M5M1I3	Salmonella_phage	49.1	3.6e-06
WP_020806130.1|2115303_2115582_-	regulatory protein Cox	NA	Q1JS60	Enterobacteria_phage	88.9	6.2e-43
WP_068815161.1|2115702_2116002_+	helix-turn-helix transcriptional regulator	NA	Q1JS61	Enterobacteria_phage	75.8	7.1e-37
WP_068815163.1|2116117_2117131_+|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	79.4	2.2e-154
WP_068815165.1|2117365_2118379_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	29.5	1.4e-12
2117217:2117234	attR	CCCGACGGGGCTTTTTTT	NA	NA	NA	NA
WP_004150782.1|2118436_2118538_+	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_004213093.1|2118537_2118612_+	protein YoaJ	NA	NA	NA	NA	NA
WP_004140488.1|2118729_2118855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004140489.1|2118914_2119178_-	DUF2534 family protein	NA	NA	NA	NA	NA
WP_004150783.1|2119308_2119947_-	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_004148038.1|2120036_2120951_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	50.4	1.1e-72
WP_004150784.1|2121611_2122655_-	type II asparaginase	NA	NA	NA	NA	NA
WP_004140494.1|2122956_2124165_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_023279889.1|2124238_2126023_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.1	5.8e-17
WP_068815169.1|2126029_2126920_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004140497.1|2127040_2128549_+	UbiD family decarboxylase	NA	NA	NA	NA	NA
WP_004140498.1|2128582_2128747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150790.1|2128859_2129546_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004099053.1|2130011_2130980_-|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.8	5.1e-185
>prophage 6
NZ_CP016811	Klebsiella pneumoniae strain DHQP1002001 chromosome, complete genome	5184828	2382135	2391598	5184828	protease,tRNA	Bacillus_phage(16.67%)	8	NA	NA
WP_023279659.1|2382135_2383857_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	22.6	1.2e-14
WP_004141853.1|2383883_2384603_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|2384956_2385175_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002896522.1|2385294_2387574_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_002896520.1|2387604_2387922_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|2388247_2388469_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_004150848.1|2388545_2390486_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896440.1|2390482_2391598_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
>prophage 7
NZ_CP016811	Klebsiella pneumoniae strain DHQP1002001 chromosome, complete genome	5184828	2841059	2915279	5184828	tail,plate,capsid,integrase,head,terminase,transposase,portal,tRNA,holin	Enterobacteria_phage(19.57%)	91	2862800:2862846	2907651:2907697
WP_002892491.1|2841059_2842577_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.3	9.5e-85
WP_004151795.1|2842908_2844384_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	29.0	6.9e-48
WP_002892486.1|2844443_2846591_-	lysine decarboxylase CadA	NA	NA	NA	NA	NA
WP_002892484.1|2846673_2848008_-	cadaverine/lysine antiporter	NA	NA	NA	NA	NA
WP_004147422.1|2848373_2849942_-	CadC family transcriptional regulator	NA	NA	NA	NA	NA
WP_002892402.1|2850234_2850507_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_002892400.1|2850607_2851528_-	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferasee	NA	A0A1W6JP29	Morganella_phage	40.1	5.4e-51
WP_004211259.1|2852038_2852905_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004147417.1|2852927_2853953_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_023279772.1|2853954_2856390_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_012068380.1|2856400_2857096_-	molecular chaperone	NA	NA	NA	NA	NA
WP_004151792.1|2857154_2857715_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_020804404.1|2858186_2858849_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002892375.1|2858826_2859132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004147414.1|2859184_2860489_-	citrate synthase	NA	NA	NA	NA	NA
WP_004142684.1|2860534_2860675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002892370.1|2860999_2861170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002892366.1|2861248_2861650_-	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_002892360.1|2862045_2862339_-	hypothetical protein	NA	NA	NA	NA	NA
2862800:2862846	attL	AATGGCACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
WP_074192281.1|2863001_2863208_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	47.7	1.6e-08
WP_071549009.1|2864550_2865396_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_068815281.1|2865397_2867341_+	glycosyl transferase	NA	NA	NA	NA	NA
WP_025713552.1|2867758_2868073_-|tail	tail fiber assembly protein	tail	A0A218M4J2	Erwinia_phage	48.4	4.4e-13
WP_141769812.1|2868230_2868776_-	hypothetical protein	NA	A0A291LCK3	Klebsiella_phage	38.1	6.3e-15
WP_004176137.1|2868756_2869788_-|transposase	IS630-like element ISEc33 family transposase	transposase	NA	NA	NA	NA
WP_068815285.1|2869871_2870051_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025713554.1|2870103_2870700_-	YmfQ family protein	NA	A0A2P9JZK7	Alteromonadaceae_phage	36.4	3.6e-32
WP_065954093.1|2870696_2871845_-|plate	baseplate J/gp47 family protein	plate	B6SBU6	Clostridium_virus	26.1	1.7e-09
WP_068815287.1|2871834_2872284_-	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	39.7	2.3e-15
WP_065954091.1|2872280_2872862_-|plate	phage baseplate assembly protein	plate	NA	NA	NA	NA
WP_049268057.1|2872858_2873944_-|tail	tail protein	tail	Q8SBG7	Shigella_phage	30.6	1.5e-39
WP_068815289.1|2873940_2875341_-	hypothetical protein	NA	A0A2P9JZK2	Alteromonadaceae_phage	39.1	4.0e-05
WP_068815295.1|2875387_2877241_-	hypothetical protein	NA	A0A172JGI1	Citrobacter_phage	45.3	1.8e-21
WP_047719073.1|2877382_2877661_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000896639.1|2877662_2878034_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_068815297.1|2878037_2879549_-|tail	phage tail protein	tail	B5TK67	Pseudomonas_phage	44.4	1.2e-103
WP_071549008.1|2879553_2879730_-	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_065954087.1|2879732_2880278_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_068815298.1|2880274_2880634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068815299.1|2880638_2881019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068815300.1|2881020_2882070_-|capsid	major capsid protein	capsid	V5Q8G6	Xylella_phage	33.7	8.1e-51
WP_068815301.1|2882168_2882576_-|head	head decoration protein	head	NA	NA	NA	NA
WP_068815304.1|2882575_2883166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040210580.1|2883167_2884034_-	S49 family peptidase	NA	A0A248XD65	Klebsiella_phage	48.1	1.1e-48
WP_068815306.1|2884030_2885665_-|portal	phage portal protein	portal	A0A291AUL8	Sinorhizobium_phage	35.5	1.4e-89
WP_000483310.1|2885664_2885928_-|head,tail	phage head-tail adapter protein	head,tail	NA	NA	NA	NA
WP_068815311.1|2885936_2888063_-|terminase	terminase	terminase	A0A0C5ABH4	Bacteriophage	34.5	6.1e-98
WP_068815313.1|2888004_2888586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065954080.1|2888847_2889486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065954079.1|2889581_2889788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068815315.1|2890021_2890411_-	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	50.0	1.1e-24
WP_064148680.1|2890407_2890905_-	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	84.2	2.5e-79
WP_064782731.1|2890882_2891152_-|holin	holin	holin	K7P6H9	Enterobacteria_phage	77.2	7.4e-33
WP_068815318.1|2891695_2892379_-	antiterminator	NA	I6PDF8	Cronobacter_phage	52.8	3.4e-58
WP_009308007.1|2892375_2892516_-	YlcG family protein	NA	NA	NA	NA	NA
WP_068815320.1|2892512_2893151_-	hypothetical protein	NA	H6WRY9	Salmonella_phage	68.4	9.2e-74
WP_068815322.1|2893143_2893812_-	serine/threonine protein phosphatase	NA	K7P6H8	Enterobacteria_phage	80.1	2.5e-106
WP_012542614.1|2893808_2893976_-	NinE family protein	NA	K7P7K0	Enterobacteria_phage	62.5	3.5e-09
WP_068815323.1|2893956_2894424_-	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	46.5	3.4e-33
WP_071549007.1|2894705_2894927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077269509.1|2895107_2895956_-	DUF551 domain-containing protein	NA	A0A248SKW5	Klebsiella_phage	93.4	2.7e-49
WP_068815324.1|2895952_2896333_-	HNH endonuclease	NA	K7P7B7	Enterobacteria_phage	94.2	1.6e-62
WP_077269510.1|2896332_2897166_-	ead/Ea22-like family protein	NA	A0A075B8K3	Enterobacteria_phage	43.9	1.1e-26
WP_046181580.1|2897162_2897369_-	hypothetical protein	NA	R9TRD3	Aeromonas_phage	97.1	1.1e-31
WP_068815326.1|2897365_2897767_-	hypothetical protein	NA	R9TME7	Aeromonas_phage	31.9	6.7e-06
WP_064146426.1|2897763_2898066_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_068815328.1|2898062_2898911_-	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	60.8	1.2e-89
WP_068815329.1|2900074_2900395_-	hypothetical protein	NA	A0A0M4RU01	Salmonella_phage	67.9	6.5e-36
WP_019704103.1|2900444_2900660_-	helix-turn-helix transcriptional regulator	NA	Q716D6	Shigella_phage	60.9	5.5e-15
WP_068815331.1|2900759_2901392_+	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	39.5	2.0e-33
WP_008807814.1|2901828_2902035_+	phage encoded cell division inhibitor protein	NA	A0A0M4S6W3	Salmonella_phage	94.1	1.4e-31
WP_068815333.1|2902116_2902401_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	78.7	9.5e-39
WP_068815335.1|2902417_2903164_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	67.2	7.0e-65
WP_068815338.1|2903160_2903784_+	exonuclease	NA	A0A0S2SY31	Pseudomonas_phage	60.2	3.1e-58
WP_032426563.1|2903812_2904340_+	phage N-6-adenine-methyltransferase	NA	Q9ZWX6	Enterobacteria_phage	61.6	1.1e-56
WP_068815340.1|2904553_2904898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068815341.1|2904890_2905568_+	morphogenetic protein	NA	H2BDG4	Pseudomonas_virus	47.4	1.7e-49
WP_040217354.1|2905564_2905792_+	hypothetical protein	NA	S4TRP7	Salmonella_phage	43.2	1.8e-08
WP_068815344.1|2905788_2906010_+	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	52.2	2.0e-12
WP_064344914.1|2906009_2906249_+	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	43.6	7.8e-10
WP_071549006.1|2906261_2906597_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_068815346.1|2906473_2907637_+|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	86.8	6.6e-203
WP_004143017.1|2908067_2908934_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
2907651:2907697	attR	AATGGCACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
WP_023279775.1|2908935_2909148_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_004143010.1|2909193_2910579_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
WP_004151319.1|2910754_2911249_+	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_004178782.1|2911252_2911975_+	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_004178781.1|2912082_2912421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004178780.1|2912517_2913027_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_004143002.1|2913023_2914091_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_068815347.1|2914202_2915279_+|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
>prophage 8
NZ_CP016811	Klebsiella pneumoniae strain DHQP1002001 chromosome, complete genome	5184828	2929327	2983946	5184828	tRNA,transposase	Salmonella_phage(27.27%)	52	NA	NA
WP_002892205.1|2929327_2929807_+|tRNA	Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase YbaK	tRNA	NA	NA	NA	NA
WP_002892203.1|2929912_2931565_-	bifunctional UDP-sugar hydrolase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_004147385.1|2931834_2933055_+	MFS transporter	NA	NA	NA	NA	NA
WP_002892197.1|2933055_2933169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004217162.1|2933189_2933312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002892195.1|2933280_2934957_+	Kef family K(+) transporter	NA	NA	NA	NA	NA
WP_002892192.1|2934992_2936297_-	inosine/guanosine kinase	NA	NA	NA	NA	NA
WP_002892189.1|2936360_2937323_-	ferrochelatase	NA	NA	NA	NA	NA
WP_002892184.1|2937451_2938096_-	adenylate kinase	NA	NA	NA	NA	NA
WP_004177228.1|2938318_2940193_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.8	4.9e-115
WP_002892177.1|2940304_2940910_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_002892173.1|2940909_2941242_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_004147381.1|2941299_2943207_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	38.2	3.0e-43
WP_004177230.1|2943299_2943851_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	44.5	3.9e-28
WP_002892144.1|2944001_2944379_-	DUF454 family protein	NA	NA	NA	NA	NA
WP_002892142.1|2944448_2944976_+	primosomal replication protein N''	NA	NA	NA	NA	NA
WP_002892136.1|2944988_2945162_+	pleiotropic regulatory protein RsmS	NA	NA	NA	NA	NA
WP_023279779.1|2945229_2946129_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.2	1.6e-63
WP_004177234.1|2946164_2949512_-	mechanosensitive channel MscK	NA	NA	NA	NA	NA
WP_002892080.1|2949641_2950292_-	multidrug efflux transporter transcriptional repressor AcrR	NA	NA	NA	NA	NA
WP_004177236.1|2950434_2951628_+	multidrug efflux RND transporter periplasmic adaptor subunit AcrA	NA	NA	NA	NA	NA
WP_002892069.1|2951650_2954797_+	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.7	1.1e-47
WP_002892066.1|2955282_2955657_+	Hha toxicity modulator TomB	NA	NA	NA	NA	NA
WP_002892050.1|2955683_2955902_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_002892030.1|2956060_2956627_+	maltose O-acetyltransferase	NA	NA	NA	NA	NA
WP_004147370.1|2956598_2956739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002892026.1|2956759_2957230_+	membrane protein	NA	NA	NA	NA	NA
WP_021313732.1|2957204_2958656_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	25.1	4.6e-12
WP_002892021.1|2958756_2959455_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002892018.1|2959451_2959592_-	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_002892011.1|2959591_2959855_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_002892007.1|2959970_2961041_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	42.8	6.1e-70
WP_004177240.1|2961311_2962583_+	maltoporin	NA	NA	NA	NA	NA
WP_002892003.1|2962719_2963034_-	PTS transporter subunit EIIB	NA	NA	NA	NA	NA
WP_023279781.1|2963098_2965156_-	beta-galactosidase	NA	NA	NA	NA	NA
WP_064174663.1|2965187_2966390_-	galactosidase	NA	NA	NA	NA	NA
WP_004204761.1|2966394_2967246_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_023279783.1|2967256_2968564_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_023279784.1|2968626_2969859_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_004147361.1|2969897_2970041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068815348.1|2970215_2971325_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	35.0	2.5e-26
WP_068815349.1|2971558_2973118_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_014342881.1|2973152_2973398_-	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_023279787.1|2973589_2974453_+	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_068815351.1|2974497_2975094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004099053.1|2975137_2976106_-|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.8	5.1e-185
WP_001101446.1|2976400_2977426_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_004142688.1|2979054_2979270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004147352.1|2979266_2979524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001101446.1|2980432_2981458_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_004099053.1|2981752_2982721_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.8	5.1e-185
WP_068815353.1|2982977_2983946_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.4	4.3e-184
>prophage 1
NZ_CP016810	Klebsiella pneumoniae strain DHQP1002001 plasmid p_IncFIB_DHQP1002001, complete sequence	307743	1633	67716	307743	integrase,transposase	uncultured_Caudovirales_phage(33.33%)	55	58723:58740	70671:70688
WP_077253535.1|1633_2980_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_004143398.1|3028_3424_+	helix-turn-helix domain containing protein	NA	NA	NA	NA	NA
WP_009653207.1|3612_5010_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_004197671.1|5249_5528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004197678.1|5862_6429_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004197675.1|6553_8197_-	alpha-D-glucose phosphate-specific phosphoglucomutase	NA	A0A1X9I671	Streptococcus_phage	25.0	1.5e-22
WP_023157975.1|8310_10758_-	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	69.2	6.1e-25
WP_009653212.1|10776_12210_-	glycogen synthase GlgA	NA	NA	NA	NA	NA
WP_004099051.1|12298_13582_-	glucose-1-phosphate adenylyltransferase	NA	NA	NA	NA	NA
WP_004099052.1|13711_15904_-	1,4-alpha-glucan branching enzyme	NA	NA	NA	NA	NA
WP_013815099.1|16276_17245_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.1	1.0e-185
WP_022631502.1|17545_17746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019706028.1|22003_22555_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	79.0	1.0e-73
WP_019706029.1|22570_24667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019706030.1|25058_26063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068814598.1|26273_29282_-|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	62.8	0.0e+00
WP_004118540.1|29442_30000_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	47.2	8.4e-39
WP_004118538.1|30131_30464_+	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_011977829.1|30817_31966_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	65.9	1.7e-123
WP_021740570.1|32090_35108_-|transposase	Tn3-like element IS3000 family transposase	transposase	A0A125RQ78	Bacillus_phage	24.7	7.2e-52
WP_004118534.1|35481_35856_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	56.0	4.5e-28
WP_001549953.1|36384_37581_+	MFS transporter	NA	NA	NA	NA	NA
WP_004118529.1|37652_38480_-	universal stress protein	NA	NA	NA	NA	NA
WP_001549885.1|38498_39977_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	74.0	1.6e-198
WP_001549886.1|40460_40814_+	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	57.1	5.9e-22
WP_001549887.1|40909_42193_+	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	74.6	2.9e-175
WP_001549888.1|42242_42671_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	2.3e-52
WP_000427614.1|43334_44339_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_003100847.1|44417_44975_-	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	63.2	3.3e-59
WP_003100853.1|44968_45340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003100856.1|45336_45837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003100858.1|45833_46160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003465043.1|46414_46771_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_001293886.1|46760_47162_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_001247892.1|47158_47449_-	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_000845048.1|47755_48769_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001206316.1|48914_49706_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000679427.1|49869_50217_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|50210_51050_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000427614.1|51754_52759_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_000429838.1|52858_53293_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001294667.1|53364_53715_+	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_068814600.1|53730_54006_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_000654684.1|54008_54254_+	mercury resistance system transport protein MerF	NA	NA	NA	NA	NA
WP_000136268.1|54250_55897_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.3	1.0e-39
WP_003465059.1|55913_56279_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_001087809.1|56275_56512_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_000904941.1|56564_57179_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	50.3	6.6e-37
WP_013213991.1|57310_57784_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_013213994.1|58719_59052_-	hypothetical protein	NA	NA	NA	NA	NA
58723:58740	attL	TATTTGCAACAGTGCCAG	NA	NA	NA	NA
WP_013213995.1|59437_60349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019706022.1|62346_63240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014343474.1|63247_64510_-	N-6 DNA methylase	NA	NA	NA	NA	NA
WP_068814602.1|64751_65573_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_015056398.1|65562_67716_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
70671:70688	attR	CTGGCACTGTTGCAAATA	NA	NA	NA	NA
>prophage 2
NZ_CP016810	Klebsiella pneumoniae strain DHQP1002001 plasmid p_IncFIB_DHQP1002001, complete sequence	307743	70735	116693	307743	integrase,transposase	Escherichia_phage(39.13%)	41	97287:97331	111489:111533
WP_001067855.1|70735_71440_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001044210.1|71445_71586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001446887.1|72071_72809_+	recombinase family protein	NA	NA	NA	NA	NA
WP_000743213.1|72805_73030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001120891.1|73240_73780_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000480972.1|73751_74588_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001082320.1|74587_75391_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_022631488.1|75451_76267_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.0	4.5e-09
WP_000954592.1|76596_76773_+	DUF4102 domain-containing protein	NA	T1S9J3	Salmonella_phage	68.6	1.0e-06
WP_000427619.1|76954_77959_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_001067855.1|80389_81094_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001067855.1|81334_82039_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_077625545.1|82015_82516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001550555.1|82610_82901_+	alcohol dehydrogenase catalytic domain-containing protein	NA	E3SJ82	Synechococcus_phage	40.6	4.8e-06
WP_001067855.1|83046_83751_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_063840321.1|83942_84497_-	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_020324562.1|84640_85345_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	9.9e-138
WP_000227969.1|86057_87134_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_001189111.1|87675_89184_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
WP_006788217.1|91046_91226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004098977.1|91345_91972_-	ParA family plasmid-partitioning AAA ATPase	NA	E5FFJ3	Burkholderia_phage	30.1	3.8e-16
WP_004098982.1|92596_93472_-	RepB family plasmid replication initiator protein	NA	Q71TL8	Escherichia_phage	56.4	5.6e-82
WP_022631495.1|93883_94522_-	DUF4113 domain-containing protein	NA	F1C5A5	Cronobacter_phage	65.5	8.3e-75
WP_087759376.1|94568_95689_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.2	6.0e-52
WP_001067855.1|95786_96491_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
97287:97331	attL	AAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCC	NA	NA	NA	NA
WP_071549088.1|97292_97805_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_001749967.1|97809_98016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001288432.1|98397_99831_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	7.0e-106
WP_004098817.1|99864_101079_-	type II site-specific deoxyribonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
WP_001389365.1|101339_102104_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001144737.1|102246_102513_-	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_004201280.1|102733_103207_-	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	8.4e-16
WP_000845048.1|103362_104376_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001749988.1|104768_105338_+	recombinase family protein	NA	E5FFF9	Burkholderia_phage	43.2	5.2e-36
WP_004201235.1|106094_107564_+	HNH endonuclease	NA	G0X580	Salmonella_phage	51.3	5.5e-21
WP_004201234.1|108083_108821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004201232.1|108958_109645_-	NYN domain-containing protein	NA	NA	NA	NA	NA
WP_020324562.1|111551_112256_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	9.9e-138
111489:111533	attR	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTT	NA	NA	NA	NA
WP_001039463.1|113007_113394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071549085.1|113402_113543_+	plasmid stabilization protein	NA	NA	NA	NA	NA
WP_004199413.1|113675_116693_+|transposase	Tn3-like element IS3000 family transposase	transposase	A0A125RQ78	Bacillus_phage	24.7	5.5e-52
>prophage 3
NZ_CP016810	Klebsiella pneumoniae strain DHQP1002001 plasmid p_IncFIB_DHQP1002001, complete sequence	307743	128884	140976	307743		Escherichia_phage(25.0%)	13	NA	NA
WP_004152355.1|128884_129586_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.7	7.1e-27
WP_014343518.1|129787_129904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001568040.1|130022_130253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152354.1|130313_130985_-	mediator of plasmid stability	NA	NA	NA	NA	NA
WP_004152353.1|130987_131959_-	mediator of plasmid stability	NA	A0A222YXF2	Escherichia_phage	46.8	1.1e-73
WP_004152352.1|132190_132622_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	52.5	1.0e-28
WP_004152351.1|132621_133893_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.7	3.6e-154
WP_004152350.1|134293_135190_+	RepB family plasmid replication initiator protein	NA	Q71TL8	Escherichia_phage	53.8	3.3e-69
WP_004152349.1|135511_136717_+	ParA family protein	NA	Q1MVJ3	Enterobacteria_phage	89.0	7.3e-205
WP_004152348.1|136713_137688_+	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	62.3	1.4e-105
WP_004152347.1|138064_138397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004227314.1|138621_138837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152345.1|138948_140976_+	SAM-dependent DNA methyltransferase	NA	A0A220A2U5	Liberibacter_phage	26.6	2.1e-26
>prophage 4
NZ_CP016810	Klebsiella pneumoniae strain DHQP1002001 plasmid p_IncFIB_DHQP1002001, complete sequence	307743	212798	226217	307743	transposase	uncultured_Mediterranean_phage(20.0%)	15	NA	NA
WP_015056403.1|212798_215438_-	hypothetical protein	NA	A0A1B1IUG5	uncultured_Mediterranean_phage	20.5	1.9e-19
WP_068814615.1|215437_218407_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	23.8	8.5e-21
WP_015058217.1|218474_218684_-	helix-turn-helix domain-containing protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	50.9	2.9e-13
WP_001000409.1|219442_220978_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	87.7	2.0e-260
WP_068814617.1|221027_221363_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	88.9	6.3e-50
WP_001067855.1|221368_222073_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_011977736.1|222253_222583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004182076.1|222615_223437_-	DUF945 domain-containing protein	NA	K4F5L3	Cronobacter_phage	40.1	1.2e-44
WP_032430701.1|223546_223888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004182074.1|224269_224683_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004152721.1|224683_224962_-	helix-turn-helix transcriptional regulator	NA	O64356	Escherichia_phage	39.4	2.5e-07
WP_004152720.1|224951_225272_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	39.5	6.8e-09
WP_020325128.1|225352_225577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004182070.1|225587_225800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152717.1|225860_226217_-	hypothetical protein	NA	A0A248SL90	Klebsiella_phage	58.1	2.6e-25
>prophage 1
NZ_CP016812	Klebsiella pneumoniae strain DHQP1002001 plasmid p_incR_DHQP1002001, complete sequence	65887	1587	54082	65887	integrase,transposase	Escherichia_phage(41.67%)	55	16279:16338	32587:33407
WP_001776119.1|1587_2115_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	39.5	5.7e-21
WP_001776120.1|2147_2579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001776122.1|3058_4024_-	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	42.7	1.6e-58
WP_004178082.1|4493_5981_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_000776034.1|6386_6818_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	1.6e-29
WP_004118291.1|6817_8089_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.3	4.9e-151
WP_000064120.1|8170_9145_-	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	54.4	2.6e-88
WP_000368714.1|9144_10350_-	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.6	2.4e-163
WP_000339857.1|10764_11034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004118283.1|11390_12257_-	replication initiation protein	NA	A0A222YYK1	Escherichia_phage	31.1	1.5e-23
WP_032409716.1|12791_12896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000764642.1|13024_13282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000015958.1|13339_14116_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.9	6.4e-53
WP_000129823.1|14112_14856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000493378.1|14906_15257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074193041.1|15400_15862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001261282.1|15818_16049_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
16279:16338	attL	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTG	NA	NA	NA	NA
WP_001067855.1|16341_17046_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001288432.1|17198_18632_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	7.0e-106
WP_004098817.1|18665_19880_-	type II site-specific deoxyribonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
WP_001389365.1|20140_20905_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_000427614.1|22276_23281_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_000656305.1|23591_23969_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_068815675.1|24169_24829_-	type A chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	99.5	7.1e-130
WP_004189163.1|25452_25893_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	60.3	2.6e-19
WP_004189161.1|25889_26240_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	63.8	5.2e-39
WP_004902302.1|26270_27863_+|transposase	IS66-like element ISKox1 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.8	3.2e-176
WP_015059985.1|28502_29759_-	EreA family erythromycin esterase	NA	NA	NA	NA	NA
WP_000237816.1|30004_30457_-	NAD(+)--rifampin ADP-ribosyltransferase Arr-2	NA	NA	NA	NA	NA
WP_000845048.1|30629_31643_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001067855.1|31878_32583_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001445937.1|32963_33920_+	hypothetical protein	NA	NA	NA	NA	NA
32587:33407	attR	CAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCCTCTATTGCGTGACGTAGATTCGTGACGTATAGTTACTGCAACTTATTTGTTTATAACTACCGTCAGGTACAAAATTATGTCTCCCGTACAAGCTAAACAAAAGCAGCATGAACGCTACGAAGCCGTAGCGGTGCAGGTTTTGCGTGGTCGTGCCGGTTACAAACCTGCCGTGAAAAGCCGCTTCAGTAAGTCAGCTAGTAGCAAATTCGCTCATACTATCGCTTTTGCCTGATCCTGAACTTTGAGGCACAATAAACCATCATTCGCTGATGGTTTTTTTATGCCTGTTCAAGACGTTATTCCCCCCTATGAGCAGATGTACCTGCTAAATCAGCAGCTGATCTGCAACGCTGATCAGTTCAAACATGCCGTTATCACAGTTGGCGGTCAGGCTGTGCAATACTGGATATCCTATTATCATGCACAATACGGCGACAGATTGCCTGATGAGCGCCTCACCACATCTGTTGACTGCGACTACAGCGCCCGGAAAGATGATATTGCGGCTATAGCAAAAACGCTCAACGTTAAGACGTGGGAGAACAAAGACGGTCAGCCCCCATCCCTTGCGCAGTTTATGCTTATCGATCAGGATACACACGATATCAAACGGGATGATGGACGCTTATTTGCCGTACCGGATGCGCCTGACGAGCCAAATGTGGTGGATATTATCGACCGCCCCGGAGGCTTTGACCGTTCTGATTTTCAGGGGAAAAAGCTTTACCTGTATACCGCCCCGTTTTATGTAGAAGCAACC	NA	NA	NA	NA
WP_011977825.1|33946_34108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000176305.1|34104_34716_-	DUF2913 family protein	NA	NA	NA	NA	NA
WP_001568067.1|34769_35051_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011977766.1|35223_35559_+	C2H2-type zinc finger protein	NA	NA	NA	NA	NA
WP_000019450.1|35787_36768_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	1.8e-185
WP_072093201.1|37370_37505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072093200.1|37589_37748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152386.1|37798_38656_-	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_004171450.1|38648_38726_-	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_013609506.1|38957_39227_-	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_108676127.1|39344_39707_-	endonuclease	NA	NA	NA	NA	NA
WP_001067855.1|39746_40451_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_032074402.1|40839_41184_+	MobC family plasmid mobilization relaxosome protein	NA	M1PXS8	Cellulophaga_phage	94.4	1.5e-51
WP_025367738.1|41861_42347_+	mobilization protein	NA	NA	NA	NA	NA
WP_024195375.1|42350_42566_+	MbeD family mobilization/exclusion protein	NA	NA	NA	NA	NA
WP_001099531.1|42733_43066_+	EmrE family multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_001067855.1|43797_44502_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_032140899.1|46123_46366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068815678.1|46397_47048_-	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_000804064.1|47153_48353_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_000058717.1|48384_49269_-	EamA family transporter	NA	NA	NA	NA	NA
WP_001351729.1|49406_49799_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_004199413.1|51064_54082_-|transposase	Tn3-like element IS3000 family transposase	transposase	A0A125RQ78	Bacillus_phage	24.7	5.5e-52
