The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP016341	Bordetella holmesii strain H903 chromosome, complete genome	3694378	1095298	1202087	3694378	protease,tRNA,transposase	Ralstonia_virus(16.67%)	96	NA	NA
WP_005011985.1|1095298_1096519_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_017685926.1|1096606_1097197_+	DMT family transporter	NA	NA	NA	NA	NA
WP_161635719.1|1097193_1097496_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005012606.1|1097547_1098537_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_005012607.1|1098657_1099539_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_005019028.1|1099712_1100567_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005012610.1|1100598_1101447_+	sulfurtransferase	NA	NA	NA	NA	NA
WP_005012613.1|1101574_1102795_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	1.1e-181
WP_005012619.1|1102813_1103380_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_005012620.1|1103577_1104729_-	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_005012623.1|1104867_1105872_-	acyltransferase family protein	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	25.9	3.9e-18
WP_005012624.1|1106028_1107000_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005012626.1|1107078_1107867_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012627.1|1107938_1108175_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_005012631.1|1108183_1109095_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_005012634.1|1109138_1111010_+	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_005012636.1|1111170_1111968_+	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_005012637.1|1112199_1112574_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_005012639.1|1112650_1112974_+	primosomal replication protein N	NA	NA	NA	NA	NA
WP_005012641.1|1113057_1113330_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_005012642.1|1113344_1113800_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_005012643.1|1113921_1114758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012644.1|1114754_1116128_+	replicative DNA helicase	NA	C7BGG1	Burkholderia_phage	57.7	1.1e-132
WP_005019033.1|1116204_1117161_-	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_005012655.1|1117248_1118226_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_005012656.1|1118350_1120006_-	PhoH family protein	NA	A0A1L2CUJ9	Pectobacterium_phage	33.7	1.2e-69
WP_005012657.1|1120054_1120519_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_005012658.1|1120515_1120977_-	Xcc1710-like domain-containing protein	NA	NA	NA	NA	NA
WP_005012659.1|1121202_1122390_+	alanine transaminase	NA	NA	NA	NA	NA
WP_005019036.1|1122386_1123691_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_005012661.1|1123687_1125097_+	threonine synthase	NA	NA	NA	NA	NA
WP_101557744.1|1125290_1126410_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	5.8e-55
WP_005012662.1|1126545_1127565_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	34.8	3.0e-50
WP_005012663.1|1127573_1130279_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	25.1	6.8e-17
WP_005012664.1|1130418_1131072_+	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_005019040.1|1131134_1131497_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_005012668.1|1132063_1133524_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_005012669.1|1133786_1134860_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	46.4	7.9e-78
WP_005011985.1|1134944_1136165_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_101557770.1|1137922_1139043_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005019053.1|1139016_1140516_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_005012673.1|1140529_1141633_+	glycolate oxidase subunit GlcE	NA	NA	NA	NA	NA
WP_005012675.1|1141637_1142888_+	glycolate oxidase subunit GlcF	NA	NA	NA	NA	NA
WP_005019055.1|1142884_1144330_-	NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta	NA	NA	NA	NA	NA
WP_005012678.1|1144326_1144641_-	NAD(P) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_005019066.1|1144642_1145761_-	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_005012682.1|1145943_1147164_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	5.5e-184
WP_005012685.1|1147263_1148130_-	N-formylglutamate amidohydrolase	NA	NA	NA	NA	NA
WP_005012688.1|1148190_1149171_-	tripartite tricarboxylate transporter substrate binding protein BugE	NA	NA	NA	NA	NA
WP_005012689.1|1149317_1150238_+	transcriptional regulator GcvA	NA	Q6JIH3	Burkholderia_virus	30.8	2.1e-26
WP_005012692.1|1150246_1151359_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_005012695.1|1151440_1152262_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005019071.1|1152337_1152946_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_005012700.1|1153083_1154460_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	46.1	7.2e-108
WP_005012704.1|1154521_1154965_+	cytochrome c	NA	NA	NA	NA	NA
WP_080688213.1|1155031_1155688_-	cytochrome B	NA	NA	NA	NA	NA
WP_101557770.1|1155730_1156850_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005012709.1|1157019_1157301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012711.1|1158011_1158800_+	DUF3053 family protein	NA	NA	NA	NA	NA
WP_005012713.1|1158796_1159903_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_005012715.1|1160577_1161936_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	38.3	2.1e-19
WP_005012717.1|1162050_1162248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|1162265_1163386_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_076879487.1|1163479_1164034_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	43.7	1.3e-31
WP_005012730.1|1164621_1165938_-	ergothioneine biosynthesis protein EgtB	NA	NA	NA	NA	NA
WP_005019086.1|1165950_1166964_-	L-histidine N(alpha)-methyltransferase	NA	NA	NA	NA	NA
WP_005012067.1|1167510_1168461_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012745.1|1168540_1168840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012747.1|1170200_1171859_-	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_005012749.1|1172007_1173228_-	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_005012751.1|1173345_1174629_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	68.4	4.6e-157
WP_005012753.1|1174632_1175574_-	AEC family transporter	NA	NA	NA	NA	NA
WP_005012755.1|1175683_1176142_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_026087875.1|1176522_1177143_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_005012761.1|1177550_1179971_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.1	3.9e-64
WP_005012762.1|1180078_1180816_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_005019089.1|1180862_1182107_+	cystathionine gamma-synthase family protein	NA	A0A0B5JD48	Pandoravirus	27.1	1.3e-10
WP_005012769.1|1182429_1182702_+	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	56.2	4.2e-20
WP_005012771.1|1183285_1184014_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_005012772.1|1184035_1184953_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_005012775.1|1184952_1185462_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_005012777.1|1185578_1186250_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005012779.1|1186359_1187427_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.7	2.8e-14
WP_005012781.1|1187446_1189291_+	potassium transporter Kup	NA	A7K9V6	Acanthocystis_turfacea_chlorella_virus	30.0	5.9e-65
WP_005012784.1|1189427_1190615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012786.1|1190915_1191701_+	acyltransferase	NA	NA	NA	NA	NA
WP_101557770.1|1191724_1192844_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005012789.1|1192948_1194286_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	83.3	4.3e-57
WP_005012790.1|1194395_1195337_-	ornithine carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	26.0	5.8e-16
WP_005012795.1|1195392_1196574_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	28.4	2.1e-23
WP_005012796.1|1196732_1197023_+	DUF3579 domain-containing protein	NA	NA	NA	NA	NA
WP_005012797.1|1197069_1197738_-	2-hydroxyacid dehydrogenase	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	26.8	8.9e-11
WP_005012798.1|1197734_1198022_-	D-isomer specific 2-hydroxyacid dehydrogenase	NA	NA	NA	NA	NA
WP_005019092.1|1198398_1199184_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_005012801.1|1199216_1199951_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005011985.1|1200866_1202087_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 2
NZ_CP016341	Bordetella holmesii strain H903 chromosome, complete genome	3694378	1206874	1263280	3694378	protease,tRNA,transposase	Ralstonia_virus(23.08%)	44	NA	NA
WP_005012808.1|1206874_1207825_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012810.1|1207906_1208386_-	sensor protein	NA	NA	NA	NA	NA
WP_005012811.1|1209597_1210797_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	1.2e-178
WP_005012812.1|1210942_1211320_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_068948307.1|1211343_1213125_-	GMC family oxidoreductase	NA	NA	NA	NA	NA
WP_005012814.1|1213133_1213871_-	gluconate 2-dehydrogenase subunit 3 family protein	NA	NA	NA	NA	NA
WP_005012815.1|1214155_1215715_-	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_005012817.1|1215774_1216533_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_005019095.1|1216629_1217286_-	adenylate kinase	NA	NA	NA	NA	NA
WP_005012820.1|1217439_1218204_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_005012822.1|1218218_1218398_-	Trm112 family protein	NA	NA	NA	NA	NA
WP_005012823.1|1218423_1219458_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_005012826.1|1219454_1219868_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_005012827.1|1219864_1220449_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_005012828.1|1220801_1222160_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	33.6	1.0e-29
WP_005012829.1|1222253_1222832_+	superoxide dismutase	NA	NA	NA	NA	NA
WP_101557770.1|1222956_1224077_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_080601032.1|1224149_1225406_+	chloride channel protein	NA	NA	NA	NA	NA
WP_005019101.1|1225509_1226715_+	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_005012833.1|1226778_1227228_-	DUF192 domain-containing protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	42.2	6.8e-15
WP_005012834.1|1227360_1227606_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	75.0	6.5e-20
WP_005012835.1|1227830_1228145_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	43.9	8.4e-12
WP_005012838.1|1233398_1235504_+	penicillin-binding protein 1C	NA	NA	NA	NA	NA
WP_005012839.1|1235557_1237867_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	9.1e-164
WP_005012840.1|1239220_1240888_+	MCE family protein	NA	NA	NA	NA	NA
WP_005012841.1|1240890_1241556_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_005012843.1|1241688_1245495_+	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_005012844.1|1245720_1246866_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005012847.1|1246984_1247914_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005012848.1|1247910_1248987_+	inner-membrane translocator	NA	NA	NA	NA	NA
WP_005012850.1|1248983_1249790_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.9	7.2e-15
WP_005012851.1|1249786_1250518_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.3	2.6e-16
WP_005012853.1|1250894_1252133_-	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	28.3	6.2e-26
WP_005012854.1|1252180_1252519_-	nitrogen regulatory protein P-II 1	NA	NA	NA	NA	NA
WP_005012067.1|1252766_1253717_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012855.1|1254035_1254218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005011985.1|1254283_1255504_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005012861.1|1255597_1256818_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	4.2e-184
WP_005012863.1|1256877_1257141_+	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_005012866.1|1257262_1258762_+	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_005012868.1|1259182_1259380_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_005012869.1|1259395_1259755_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_005012870.1|1259827_1260850_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	38.8	6.1e-27
WP_005012871.1|1260862_1263280_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP016341	Bordetella holmesii strain H903 chromosome, complete genome	3694378	1586817	1693072	3694378	integrase,tRNA,transposase	Leptospira_phage(14.29%)	100	1644092:1644108	1689758:1689774
WP_005011985.1|1586817_1588038_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013527.1|1588392_1588869_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_005013528.1|1589127_1589736_-	YhbY family RNA-binding protein	NA	NA	NA	NA	NA
WP_005013529.1|1589754_1590426_+	RlmE family RNA methyltransferase	NA	NA	NA	NA	NA
WP_005019299.1|1590599_1592486_+	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	E5ESM9	Bathycoccus_sp._RCC1105_virus	42.5	6.2e-110
WP_005013531.1|1592513_1593356_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	32.5	6.5e-27
WP_005013532.1|1593352_1594696_+	phosphoglucosamine mutase	NA	A0A1X9I671	Streptococcus_phage	27.1	2.7e-06
WP_005013533.1|1594880_1595696_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005013534.1|1595761_1597243_-	exopolyphosphatase	NA	NA	NA	NA	NA
WP_005013535.1|1597441_1599514_+	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_005013536.1|1599733_1600771_+	phosphate ABC transporter substrate-binding protein PstS	NA	E3SKK5	Synechococcus_phage	40.2	8.5e-53
WP_005013537.1|1601957_1602815_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_005013538.1|1602842_1603619_+	phosphate ABC transporter ATP-binding protein PstB	NA	G9BWD6	Planktothrix_phage	29.7	5.6e-17
WP_005013539.1|1604446_1604956_+	DUF1993 domain-containing protein	NA	NA	NA	NA	NA
WP_005013542.1|1606033_1606804_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_025341421.1|1606800_1607811_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_101557920.1|1607869_1608950_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.5	2.0e-44
WP_101557831.1|1609118_1610238_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.2e-55
WP_080601033.1|1610239_1610983_+	class A beta-lactamase	NA	A0A1B0VBP7	Salmonella_phage	47.2	8.0e-53
WP_005013549.1|1610987_1611359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013550.1|1611419_1611665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068948310.1|1611771_1613271_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_005013552.1|1613892_1614228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013553.1|1614486_1614618_+	entericidin A/B family lipoprotein	NA	NA	NA	NA	NA
WP_005013555.1|1614647_1615145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013556.1|1615154_1615529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013558.1|1615619_1616912_+	aspartate carbamoyltransferase	NA	Q84489	Paramecium_bursaria_Chlorella_virus	37.2	2.2e-42
WP_005013559.1|1617028_1617928_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	32.5	5.9e-42
WP_005013561.1|1618079_1618298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017685641.1|1618771_1620397_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_005013563.1|1620632_1622156_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.3	2.2e-20
WP_005013564.1|1622127_1622823_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005013565.1|1623163_1624225_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	64.0	5.7e-113
WP_005013566.1|1624270_1624822_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_005013567.1|1624828_1625749_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013568.1|1625888_1628186_+	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_005011985.1|1628241_1629462_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013569.1|1629720_1630326_+	DUF2889 domain-containing protein	NA	NA	NA	NA	NA
WP_005013570.1|1630336_1631497_+	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_005013571.1|1631518_1632400_+	succinate--CoA ligase subunit alpha	NA	A0A2K9L1S3	Tupanvirus	31.4	1.1e-19
WP_005013572.1|1632696_1633395_+	TerC family protein	NA	W8EBD0	Pseudomonas_phage	33.8	8.9e-22
WP_005013573.1|1633536_1634259_+	TerC family protein	NA	A0A2R2YAT9	Pseudomonas_phage	43.8	8.0e-42
WP_005019317.1|1634377_1635316_+	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_005013577.1|1635346_1636126_+	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_005013578.1|1636112_1637336_+	heme biosynthesis operon protein HemX	NA	NA	NA	NA	NA
WP_005013579.1|1637340_1638888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013580.1|1638923_1639457_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	55.5	1.8e-51
WP_005013581.1|1639700_1640396_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_005013582.1|1640410_1640542_+	entericidin A/B family lipoprotein	NA	NA	NA	NA	NA
WP_005013583.1|1640589_1641714_+	acyl-CoA/acyl-ACP dehydrogenase	NA	NA	NA	NA	NA
WP_005013584.1|1641719_1644059_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	40.3	6.9e-151
WP_005013585.1|1644055_1644463_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
1644092:1644108	attL	CAGGCAGCCATCGGCCA	NA	NA	NA	NA
WP_005013586.1|1644724_1644985_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|1645207_1646158_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012067.1|1646256_1647207_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013587.1|1647256_1648465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013588.1|1648686_1649226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013589.1|1649450_1649855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013590.1|1649919_1650675_+	Flp pilus assembly protein CpaB	NA	NA	NA	NA	NA
WP_005013591.1|1650674_1652036_+	pilus assembly protein	NA	NA	NA	NA	NA
WP_005013592.1|1652032_1652656_+	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_101557770.1|1652699_1653819_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005013595.1|1654471_1655227_+	pilus assembly protein	NA	NA	NA	NA	NA
WP_005013596.1|1655403_1656198_+	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_005013597.1|1656194_1656632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153566127.1|1656743_1656896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013598.1|1657316_1658285_-	homoserine kinase	NA	NA	NA	NA	NA
WP_025341429.1|1658441_1659449_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_017685693.1|1659506_1659965_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_005013601.1|1660038_1661385_-	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_005013602.1|1661402_1661774_+	DUF2069 domain-containing protein	NA	NA	NA	NA	NA
WP_005013604.1|1661773_1663243_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	36.1	5.8e-47
WP_005013607.1|1663398_1664124_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005019347.1|1664137_1666852_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_005013609.1|1667103_1668468_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_005013610.1|1668507_1669566_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	43.7	4.9e-80
WP_005013611.1|1669593_1670412_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_005013612.1|1670449_1670728_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005013614.1|1671991_1672291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013615.1|1672860_1674264_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_005013616.1|1674276_1674927_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_005011985.1|1675068_1676289_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013617.1|1676319_1677396_+	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_005013618.1|1677542_1678673_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_005019351.1|1678859_1680485_+	membrane protein	NA	NA	NA	NA	NA
WP_005019353.1|1680491_1681307_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_110097765.1|1681321_1682392_+	twin-arginine translocation signal domain-containing protein	NA	NA	NA	NA	NA
WP_005013621.1|1682443_1683103_+	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_101557807.1|1683742_1684905_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_157933264.1|1684946_1685261_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	S5WIU1	Leptospira_phage	50.5	1.5e-24
WP_080687433.1|1685244_1685631_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_101557809.1|1685669_1685936_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_005013625.1|1686328_1687018_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005013626.1|1687117_1687279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017685992.1|1687429_1687594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013627.1|1687720_1687957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013628.1|1688146_1688395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013629.1|1688508_1689879_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
1689758:1689774	attR	TGGCCGATGGCTGCCTG	NA	NA	NA	NA
WP_005013631.1|1689879_1690620_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005013632.1|1691119_1693072_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	35.9	7.1e-125
>prophage 4
NZ_CP016341	Bordetella holmesii strain H903 chromosome, complete genome	3694378	1711366	1755293	3694378	integrase,holin,tRNA,transposase	Leptospira_phage(33.33%)	37	1753861:1753875	1760337:1760351
WP_005019367.1|1711366_1714228_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	25.4	1.0e-71
WP_005013657.1|1714217_1715183_-	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_005019369.1|1715939_1717415_+	RsmB/NOP family class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_005013659.1|1717419_1717695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|1718031_1719151_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_161992024.1|1719025_1719274_+|transposase	transposase	transposase	A4PE56	Ralstonia_virus	94.1	1.9e-11
WP_005013660.1|1719452_1720661_+	stearoyl-CoA desaturase	NA	NA	NA	NA	NA
WP_005013661.1|1720657_1722940_+	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	36.2	2.5e-105
WP_005013662.1|1722950_1725332_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_005013663.1|1725595_1727503_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	31.9	4.3e-66
WP_005013664.1|1727517_1728408_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_005013665.1|1728414_1729548_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_005013666.1|1729547_1730369_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_005013667.1|1730393_1731584_-	succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_005013668.1|1731885_1732167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013669.1|1732332_1732653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101557814.1|1732692_1733779_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.5	2.0e-44
WP_005013671.1|1733975_1734236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013542.1|1734728_1735499_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_025341421.1|1735495_1736506_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_050597667.1|1736564_1737383_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	46.0	1.2e-54
WP_005013673.1|1737845_1738631_-	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_101557815.1|1739490_1740610_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	7.5e-55
WP_005012353.1|1741676_1742681_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005013675.1|1742756_1743569_+	type I phosphodiesterase/nucleotide pyrophosphatase 1	NA	NA	NA	NA	NA
WP_005013676.1|1743796_1745968_+|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
WP_005013677.1|1746021_1747341_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_005011985.1|1747429_1748650_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013678.1|1748868_1749729_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013679.1|1749725_1750949_-	MFS transporter	NA	NA	NA	NA	NA
WP_005013680.1|1751247_1751745_+	BON domain-containing protein	NA	NA	NA	NA	NA
WP_005013681.1|1751783_1752566_-	deaminated glutathione amidase	NA	NA	NA	NA	NA
WP_005013682.1|1752591_1752810_-	SlyX family protein	NA	NA	NA	NA	NA
WP_005019379.1|1752884_1753154_+	YunC family protein	NA	NA	NA	NA	NA
WP_005013684.1|1753373_1753838_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
1753861:1753875	attL	GCCGATGGCATCGGC	NA	NA	NA	NA
WP_005013685.1|1753911_1754193_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_005013686.1|1754309_1755293_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
1760337:1760351	attR	GCCGATGCCATCGGC	NA	NA	NA	NA
>prophage 5
NZ_CP016341	Bordetella holmesii strain H903 chromosome, complete genome	3694378	1780569	1821960	3694378	transposase	Ralstonia_virus(50.0%)	39	NA	NA
WP_005012067.1|1780569_1781520_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013708.1|1781516_1782032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013710.1|1782389_1783010_+	SCO family protein	NA	NA	NA	NA	NA
WP_005013711.1|1783109_1783361_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_005013712.1|1783448_1784927_-	AdeC/AdeK/OprM family multidrug efflux complex outer membrane factor	NA	NA	NA	NA	NA
WP_005013714.1|1784923_1788094_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_005013715.1|1788106_1789303_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005013717.1|1789491_1790424_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013718.1|1790492_1791224_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_005013719.1|1791289_1791925_+	chorismate lyase	NA	NA	NA	NA	NA
WP_005013720.1|1791910_1793089_-	MFS transporter	NA	NA	NA	NA	NA
WP_005013721.1|1793249_1793798_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_005013722.1|1793878_1794238_+	LysE family transporter	NA	NA	NA	NA	NA
WP_005011985.1|1794285_1795506_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013723.1|1795581_1796703_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005013724.1|1796740_1797454_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.1	1.7e-12
WP_005013725.1|1797464_1798685_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	4.6e-183
WP_005013726.1|1798767_1799322_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_005013727.1|1799467_1800418_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013729.1|1800377_1800539_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_005013730.1|1800579_1801506_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005013731.1|1801519_1802392_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005013732.1|1802554_1803502_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_026087954.1|1803840_1804422_+	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_005012808.1|1804999_1805950_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013735.1|1805929_1806682_-	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_005019399.1|1806694_1807426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013736.1|1807582_1809748_-	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_005013738.1|1809837_1810107_-	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_005019401.1|1810195_1810402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013740.1|1810400_1810919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003814004.1|1810937_1811717_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_005013742.1|1811884_1812901_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_005013744.1|1812973_1813465_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_003814007.1|1813475_1815191_-	acetolactate synthase 3 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	30.3	3.1e-60
WP_005012808.1|1816354_1817305_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814009.1|1818956_1820198_-	MFS transporter	NA	NA	NA	NA	NA
WP_003814010.1|1820209_1820983_-	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_005013747.1|1821009_1821960_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP016341	Bordetella holmesii strain H903 chromosome, complete genome	3694378	2146927	2207050	3694378	protease,tRNA,transposase	Ralstonia_virus(23.08%)	59	NA	NA
WP_005014173.1|2146927_2147416_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	39.1	1.3e-06
WP_005014175.1|2147408_2148257_-	haloacid dehalogenase-like hydrolase	NA	NA	NA	NA	NA
WP_005014177.1|2148348_2148846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014180.1|2148983_2149343_-	cation:proton antiporter	NA	NA	NA	NA	NA
WP_005014182.1|2149339_2149621_-	K+/H+ antiporter subunit F	NA	NA	NA	NA	NA
WP_005014183.1|2149620_2150103_-	Na+/H+ antiporter subunit E	NA	NA	NA	NA	NA
WP_005014185.1|2150104_2151733_-	monovalent cation/H+ antiporter subunit D	NA	NA	NA	NA	NA
WP_005014186.1|2151729_2152074_-	Na+/H+ antiporter subunit C	NA	NA	NA	NA	NA
WP_005019567.1|2152075_2155018_-	monovalent cation/H+ antiporter subunit A	NA	NA	NA	NA	NA
WP_005014197.1|2155463_2156435_+	tripartite tricarboxylate transporter substrate binding protein BugE	NA	NA	NA	NA	NA
WP_005014198.1|2156424_2157807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|2157949_2158900_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005014200.1|2158859_2160101_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_005014202.1|2160097_2161219_-	DNA repair exonuclease	NA	NA	NA	NA	NA
WP_005014203.1|2162710_2163178_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005014210.1|2163248_2163899_+	DUF502 domain-containing protein	NA	NA	NA	NA	NA
WP_005014211.1|2163985_2165125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012353.1|2165293_2166298_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014212.1|2166294_2167542_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_005014213.1|2167894_2168761_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.0	5.9e-23
WP_005014215.1|2168720_2170325_+	glycerol-3-phosphate dehydrogenase/oxidase	NA	NA	NA	NA	NA
WP_005014221.1|2170336_2171023_-	type 1 glutamine amidotransferase domain-containing protein	NA	NA	NA	NA	NA
WP_005014223.1|2171019_2172060_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005014226.1|2172175_2172847_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014227.1|2172843_2173836_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005014228.1|2173832_2174771_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.4	8.6e-20
WP_005014229.1|2174767_2175922_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_005014231.1|2175930_2177382_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_005014235.1|2177412_2177895_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_005014237.1|2177896_2178790_+	NRDE family protein	NA	Q9J5E1	Fowlpox_virus	34.8	6.5e-25
WP_005014239.1|2178786_2179230_+	carboxypeptidase regulatory-like domain-containing protein	NA	NA	NA	NA	NA
WP_005014241.1|2179242_2179617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014242.1|2179759_2180158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076879494.1|2180284_2180572_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_005014247.1|2180568_2180985_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_005014248.1|2181160_2181793_+	7-carboxy-7-deazaguanine synthase	NA	NA	NA	NA	NA
WP_005014250.1|2181821_2182268_+	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
WP_005014253.1|2182554_2183706_+	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_005012353.1|2183819_2184824_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014256.1|2185807_2186515_+	translesion DNA synthesis-associated protein ImuA	NA	NA	NA	NA	NA
WP_032954285.1|2186447_2187899_+	DNA polymerase Y family protein	NA	NA	NA	NA	NA
WP_005014260.1|2187904_2191063_+	error-prone DNA polymerase	NA	M9MUV5	Rhodococcus_phage	29.0	1.2e-52
WP_005014263.1|2191075_2191597_-	DNA-deoxyinosine glycosylase	NA	NA	NA	NA	NA
WP_005014265.1|2191586_2192411_-	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_005014267.1|2192407_2193007_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	30.9	7.0e-07
WP_005014269.1|2193115_2194972_-	phosphoenolpyruvate carboxykinase (GTP)	NA	NA	NA	NA	NA
WP_005012353.1|2195120_2196125_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014271.1|2196333_2197596_+	Zn-dependent hydrolase	NA	NA	NA	NA	NA
WP_005014274.1|2197600_2197936_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_005014275.1|2197932_2198862_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014277.1|2198866_2199580_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005014278.1|2199683_2201141_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.6	1.0e-11
WP_005014281.1|2201137_2201434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014283.1|2201558_2202917_+	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.5	1.4e-42
WP_068948312.1|2203017_2203818_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_005014286.1|2203997_2205116_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B6VT43	Edwardsiella_phage	46.5	3.4e-79
WP_005014289.1|2205188_2205560_+	lipoprotein	NA	NA	NA	NA	NA
WP_005014290.1|2205566_2206418_-	hypothetical protein	NA	A0A1B1INV8	uncultured_Mediterranean_phage	28.9	4.0e-16
WP_005014292.1|2206438_2207050_-|protease	ATP-dependent protease La (LON) domain-containing protein	protease	NA	NA	NA	NA
>prophage 7
NZ_CP016341	Bordetella holmesii strain H903 chromosome, complete genome	3694378	2302173	2423684	3694378	integrase,protease,tRNA,transposase	Leptospira_phage(15.15%)	107	2333703:2333762	2355010:2355284
WP_101557807.1|2302173_2303336_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_068948316.1|2303448_2304417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014478.1|2304413_2305334_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_025341469.1|2305430_2309909_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_005019672.1|2310287_2314622_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_005014481.1|2315260_2315824_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_005014483.1|2315835_2316081_-	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_005014492.1|2316236_2316746_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005014495.1|2316791_2317772_+	DUF4880 domain-containing protein	NA	NA	NA	NA	NA
WP_005014496.1|2317983_2320335_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_005014497.1|2320381_2321212_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_005019676.1|2321208_2321898_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.8	4.1e-35
WP_005014501.1|2321890_2323171_-	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_005014502.1|2323268_2324207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014504.1|2324188_2325895_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.1	2.2e-50
WP_100225795.1|2325972_2327076_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	38.7	1.3e-06
WP_005014509.1|2327128_2327878_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_005014511.1|2327884_2329399_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.9	8.8e-83
WP_005019680.1|2329411_2329699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014514.1|2329719_2330607_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_005014516.1|2330757_2331264_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005014518.1|2331260_2332217_+	FecR family protein	NA	NA	NA	NA	NA
WP_005019683.1|2332404_2333751_+	TonB-dependent receptor	NA	NA	NA	NA	NA
2333703:2333762	attL	TGACCTGCCCCCAGATTTAGTACGGCACCGACATAGAGCCCAGGGGTAAAAGACCTTCTT	NA	NA	NA	NA
WP_025341181.1|2333718_2333949_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	56.9	2.2e-14
WP_101558036.1|2333978_2334542_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_032968029.1|2334696_2335467_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	3.7e-77
WP_025341421.1|2335463_2336474_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_076879495.1|2336788_2337235_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_005014534.1|2337290_2337485_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_005014536.1|2337486_2337828_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_005014539.1|2337837_2339700_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	38.7	1.4e-98
WP_005014543.1|2339739_2340246_-	Fe-S protein assembly co-chaperone HscB	NA	NA	NA	NA	NA
WP_005014544.1|2340249_2340573_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	54.2	6.8e-25
WP_005014545.1|2340574_2340979_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	79.8	1.9e-53
WP_005014546.1|2341015_2342227_-	IscS subfamily cysteine desulfurase	NA	NA	NA	NA	NA
WP_005014547.1|2342248_2342797_-	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
WP_005014551.1|2343021_2343513_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_017685984.1|2343727_2345758_-	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_005014553.1|2345832_2347035_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_032826331.1|2347577_2348513_-	transcriptional regulator GcvA	NA	NA	NA	NA	NA
WP_005014556.1|2349546_2349828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014560.1|2349914_2350088_+	OsmC family protein	NA	NA	NA	NA	NA
WP_005014564.1|2350199_2350544_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_005014566.1|2350615_2351284_+	anti-ECF sigma factor ChrR	NA	NA	NA	NA	NA
WP_005014572.1|2352699_2353743_+	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A2K9L339	Tupanvirus	29.2	1.4e-31
WP_076879527.1|2353739_2353841_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_101557770.1|2353932_2355052_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005014574.1|2355302_2355956_+	transcriptional repressor LexA	NA	A0A2H4JG58	uncultured_Caudovirales_phage	50.7	1.9e-10
2355010:2355284	attR	AAGAAGGTCTTTTACCCCTGGGCTCTATGTCGGTGCCGTACTAAATCTGGGGGCAGGTCAACCACACCTTGGATGTGCCAATCCTGAGTATCTGACGATGGCTTTGCGCGAATCGACCGCAAACCAGGGGCCAGCCATGACCGCGTAGCGTCCCCTGCTTGCGGTAGTCGCTAGAAACGGGAGTATCGCCCTGGCATCGCTTGCATTTTTCAGCTGTGTCCCCCAGAATCACGCTGTATATACATACAGTCCGTGGTTCACACAAGCCCCGGGCC	NA	NA	NA	NA
WP_032974133.1|2356071_2357292_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	7.9e-183
WP_005014581.1|2357342_2359772_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	51.4	3.6e-219
WP_005014587.1|2359937_2361236_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	54.3	3.1e-129
WP_005014589.1|2361340_2361994_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.9	2.0e-55
WP_005014590.1|2361996_2363307_-	trigger factor	NA	NA	NA	NA	NA
WP_005014595.1|2363534_2364074_+	TIGR00645 family protein	NA	K4K6D8	Caulobacter_phage	35.8	4.3e-24
WP_101557809.1|2364552_2364819_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_135238891.1|2364857_2365223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025341473.1|2365104_2366115_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_005013542.1|2366111_2366882_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_050427733.1|2366967_2367627_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	46.5	6.2e-49
WP_005014598.1|2367594_2368086_-	DUF924 family protein	NA	NA	NA	NA	NA
WP_005014599.1|2368195_2368399_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	66.7	6.6e-18
WP_005014600.1|2368716_2369037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014605.1|2369020_2369356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014607.1|2369410_2369623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014610.1|2369698_2370037_+	IS66 family insertion sequence hypothetical protein	NA	A0A218MNG9	uncultured_virus	50.0	3.7e-05
WP_005014613.1|2370033_2370369_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_005014618.1|2370431_2372003_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	47.5	2.0e-125
WP_005014621.1|2372796_2373108_+	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_101557770.1|2373300_2374421_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005011899.1|2374548_2374743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557807.1|2380825_2381987_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_005019713.1|2382372_2383836_+	ribonuclease G	NA	NA	NA	NA	NA
WP_005014698.1|2383968_2385519_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.9	4.1e-19
WP_017685964.1|2385515_2385665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|2385830_2386951_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005014703.1|2388064_2388922_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014704.1|2388974_2389472_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014705.1|2389592_2391008_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_005014706.1|2391017_2392202_+	EmrA/EmrK family multidrug efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005014709.1|2392198_2393797_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_005014714.1|2394979_2395225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014716.1|2395635_2395821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014720.1|2395976_2396888_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014721.1|2397009_2397852_-	glyoxylate/hydroxypyruvate reductase A	NA	NA	NA	NA	NA
WP_005014723.1|2398054_2399428_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_153566136.1|2399418_2399574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014726.1|2399737_2401249_-	DUF853 family protein	NA	A0A248XCZ8	Klebsiella_phage	45.9	2.5e-77
WP_005014728.1|2401401_2402133_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_005014730.1|2402239_2403541_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_005014740.1|2403548_2404457_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_005014741.1|2404453_2405047_+	nicotinate (nicotinamide) nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_005014744.1|2405090_2405504_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_005014747.1|2405500_2405971_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_005014748.1|2405977_2406583_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_005014750.1|2408384_2410169_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_005014753.1|2410165_2411551_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014754.1|2411536_2412499_-	threo-3-hydroxy-L-aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_005014755.1|2412568_2413198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014759.1|2413235_2414444_-	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_005014760.1|2414565_2415135_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005014763.1|2415266_2416820_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_005011985.1|2417123_2418344_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005014765.1|2418751_2419654_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005014766.1|2419650_2420520_+	manganese/iron ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	1.5e-10
WP_005014767.1|2420516_2421368_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_005014769.1|2421364_2422189_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_005011985.1|2422463_2423684_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 8
NZ_CP016341	Bordetella holmesii strain H903 chromosome, complete genome	3694378	2933144	3010204	3694378	integrase,tRNA,transposase	Ralstonia_virus(21.43%)	56	2935999:2936058	2984586:2985156
WP_005019978.1|2933144_2933924_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_005015711.1|2933946_2934894_+	prolyl aminopeptidase	NA	NA	NA	NA	NA
WP_005015713.1|2934895_2935096_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_101557770.1|2935430_2936550_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
2935999:2936058	attL	GACCGAGCGCGTGGTTCGCCCAGCGGCAATCGCGCCGAATCAGAGTTGGTCAATGGACTT	NA	NA	NA	NA
WP_005015714.1|2936871_2937588_-	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_005015715.1|2937584_2938478_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005011985.1|2938641_2939862_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005015716.1|2940014_2941097_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.1	1.5e-31
WP_005015717.1|2942776_2943760_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_005015719.1|2943822_2945235_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_005015721.1|2945352_2946195_+	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_005015735.1|2946473_2947082_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	46.8	1.0e-05
WP_005015738.1|2947097_2947718_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_005015741.1|2947783_2948491_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.3	1.2e-13
WP_005015743.1|2948495_2949218_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.6	1.9e-11
WP_005015745.1|2949204_2949495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005020013.1|2949570_2950791_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	5.5e-184
WP_025341216.1|2951515_2952367_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005015753.1|2952418_2953672_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005015755.1|2953848_2954637_-	putative hydro-lyase	NA	NA	NA	NA	NA
WP_005015757.1|2954756_2955671_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015758.1|2955803_2957696_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	37.9	4.6e-121
WP_017685928.1|2957881_2959261_+	uracil-xanthine permease	NA	H9YQ34	environmental_Halophage	50.7	4.1e-26
WP_076879504.1|2959705_2960002_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_005015774.1|2963802_2964405_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_005015778.1|2964538_2964997_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_005015780.1|2964998_2965598_-	iron transport sensor protein	NA	NA	NA	NA	NA
WP_005015783.1|2965606_2966416_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005015786.1|2966450_2967305_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005015790.1|2967424_2968012_+	HutD family protein	NA	NA	NA	NA	NA
WP_005015791.1|2968008_2969388_+	formimidoylglutamate deiminase	NA	NA	NA	NA	NA
WP_153566140.1|2969892_2970039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015794.1|2977710_2979051_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	G9E4Q1	Emiliania_huxleyi_virus	32.3	2.9e-45
WP_005015796.1|2979064_2979916_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	40.4	4.4e-47
WP_005015799.1|2979927_2981193_-	capsular biosynthesis protein	NA	NA	NA	NA	NA
WP_005015801.1|2981254_2983159_-	capsular polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_005015804.1|2985134_2985989_-	hypothetical protein	NA	NA	NA	NA	NA
2984586:2985156	attR	GACCGAGCGCGTGGTTCGCCCAGCGGCAATCGCGCCGAATCAGAGTTGGTCAATGGACTTTGTGGCCGACGGCCTAGCCTATGGCCGCCGATTCCGCTGTTTGACTATCGTCGATGACTACACTCGCGAATGCCTGGCCATCGAGGTCGATACGTCGTTGCCGGGACTGCGTGTTGCCATGGTGCTGCAACGGCTGGCGGAGATGCGTGGCCTGCCGCGATCTATTACCGTGGACAACGGGCCAGAGTTCGCCGGAAGAGCCTTGGACGCCTGGGCCTACCAAGCAGGCGTAAAGCTGTCGTTTATTCGGCCGGGTAAGCCGGTGGAGAACGCTTATATCGAAAGTTTCAACGGCAAGTTCCGCGACGAATGCCTTAACGAGCACTGGTTCTTGTCCCTGCGACAGGCTAAAAGCTTGATCGAAAACTGGCGAGTCGAGTACAACACCGATCGGCCTCACAGCGCGCTCGGATATTTAACGCCGGCGCAATTCGTGCAGGCTCATCAGAAAGAAGGTCTTTTACCCCTGGGCTCTATGTCGGTGCCGTACTAAATCTGGGGGCAGGTCAGC	NA	NA	NA	NA
WP_005015806.1|2985981_2986776_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005015810.1|2986991_2987942_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005020039.1|2988544_2989342_-	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005015813.1|2989381_2990035_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_005015815.1|2990015_2991080_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	37.3	6.5e-32
WP_005015817.1|2991243_2993469_-	glycoside hydrolase family 31 protein	NA	NA	NA	NA	NA
WP_005015818.1|2993714_2995559_-|tRNA	tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD	tRNA	NA	NA	NA	NA
WP_005015820.1|2995675_2996548_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_005015825.1|2996594_2998295_-	long-chain-fatty-acid--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	27.5	1.0e-31
WP_005015826.1|2998357_2999557_+	amidohydrolase	NA	NA	NA	NA	NA
WP_005015829.1|2999567_3000446_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015832.1|3000552_3001590_+	YeiH family putative sulfate export transporter	NA	NA	NA	NA	NA
WP_025341225.1|3001670_3002075_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_005015836.1|3002086_3003544_+	magnesium transporter	NA	NA	NA	NA	NA
WP_005015841.1|3004186_3004783_-	cation transport-associated protein	NA	NA	NA	NA	NA
WP_005015844.1|3004943_3005402_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015847.1|3006179_3007151_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005015849.1|3007272_3007692_+	DUF1993 domain-containing protein	NA	NA	NA	NA	NA
WP_068948323.1|3008983_3010204_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	3.0e-182
