The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP016894	Bacillus subtilis strain HJ0-6, complete genome	4235115	662869	671235	4235115		Synechococcus_phage(50.0%)	8	NA	NA
WP_015715438.1|662869_664165_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	25.7	4.5e-19
WP_029726599.1|664238_664964_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3G7P8	Synechococcus_phage	44.1	1.2e-45
WP_003219409.1|664956_665211_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_029726600.1|665207_665891_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_029726601.1|665874_668103_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.0	7.2e-158
WP_003233947.1|668078_669509_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.5	1.2e-52
WP_003233945.1|669610_670651_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	42.0	2.8e-64
WP_015252651.1|670647_671235_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	41.0	2.4e-28
>prophage 2
NZ_CP016894	Bacillus subtilis strain HJ0-6, complete genome	4235115	1160638	1204836	4235115	tRNA,coat	Planktothrix_phage(25.0%)	49	NA	NA
WP_003232972.1|1160638_1160878_-|coat	spore coat protein YjzB	coat	NA	NA	NA	NA
WP_003232971.1|1161042_1161981_+	beta-ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_003244890.1|1162003_1163245_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_003232967.1|1163320_1164106_+	DUF2268 domain-containing protein	NA	NA	NA	NA	NA
WP_003232965.1|1164297_1165284_+	oligopeptide ABC transporter ATP-binding protein AppD	NA	G9BWD6	Planktothrix_phage	32.9	5.7e-22
WP_003232964.1|1165280_1166270_+	oligopeptide ABC transporter ATP-binding protein AppF	NA	F2Y302	Organic_Lake_phycodnavirus	26.1	6.7e-07
WP_003245082.1|1166357_1167989_+	oligopeptide-binding protein AppA	NA	NA	NA	NA	NA
WP_003245828.1|1168064_1169015_+	oligopeptide ABC transporter permease AppB	NA	NA	NA	NA	NA
WP_003232961.1|1169031_1169943_+	oligopeptide ABC transporter permease AppC	NA	NA	NA	NA	NA
WP_003239298.1|1170147_1170900_+	DUF3603 family protein	NA	A0A0A0RP53	Bacillus_phage	43.9	5.4e-49
WP_003245134.1|1170934_1171927_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003232957.1|1172670_1174308_+	oligopeptide ABC transporter substrate-binding protein OppA	NA	NA	NA	NA	NA
WP_003245554.1|1174415_1175351_+	oligopeptide ABC transporter permease OppB	NA	NA	NA	NA	NA
WP_003232954.1|1175354_1176272_+	oligopeptide ABC transporter permease OppC	NA	NA	NA	NA	NA
WP_014906294.1|1176276_1177353_+	oligopeptide ABC transporter ATP-binding protein OppD	NA	G9BWD6	Planktothrix_phage	30.8	2.1e-17
WP_003245567.1|1177354_1178272_+	oligopeptide ABC transporter ATP-binding protein OppF	NA	M1HP82	Acanthocystis_turfacea_Chlorella_virus	24.6	1.2e-05
WP_010886478.1|1178378_1179596_+	MFS transporter	NA	NA	NA	NA	NA
WP_003244921.1|1179759_1180338_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003245483.1|1180518_1180914_+	transcriptional regulator Spx	NA	NA	NA	NA	NA
WP_003232944.1|1180956_1181613_-	TerC family protein	NA	A0A2R2YAT9	Pseudomonas_phage	38.0	1.1e-29
WP_121572562.1|1181782_1181923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015383354.1|1181889_1182546_+	adaptor protein MecA	NA	NA	NA	NA	NA
WP_029726275.1|1182705_1183857_+	competence protein CoiA	NA	NA	NA	NA	NA
WP_009967010.1|1183903_1185916_+	oligoendopeptidase F	NA	NA	NA	NA	NA
WP_003244944.1|1185953_1186121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003245184.1|1186435_1187335_-	adaptor protein SpxH	NA	NA	NA	NA	NA
WP_003232928.1|1187331_1187730_-	group 2 truncated hemoglobin YjbI	NA	NA	NA	NA	NA
WP_072692654.1|1187984_1188530_-	bifunctional muramidase/murein lytic transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	60.4	3.7e-39
WP_014479452.1|1188733_1189306_-	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_038427600.1|1189430_1189799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003245294.1|1189827_1190463_+	GTP diphosphokinase	NA	NA	NA	NA	NA
WP_003232918.1|1190481_1191282_+	NAD kinase	NA	NA	NA	NA	NA
WP_010886481.1|1191344_1192196_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_003244765.1|1192208_1192943_-	bis(5'-nucleosyl)-tetraphosphatase PrpE	NA	M4Q4T6	Vibrio_phage	25.0	3.2e-06
WP_003232910.1|1193177_1195022_+	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_003232909.1|1195270_1195981_+	thiaminase II	NA	NA	NA	NA	NA
WP_003232908.1|1195955_1196573_+	thiazole tautomerase TenI	NA	NA	NA	NA	NA
WP_029726273.1|1196556_1197666_+	glycine oxidase ThiO	NA	NA	NA	NA	NA
WP_072173897.1|1197665_1197866_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_003232902.1|1197862_1198633_+	thiazole synthase	NA	NA	NA	NA	NA
WP_003232900.1|1198629_1199640_+	thiazole biosynthesis adenylyltransferase ThiF	NA	NA	NA	NA	NA
WP_014479462.1|1199658_1200474_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_003232896.1|1200609_1201386_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_072692635.1|1201486_1202170_+|coat	spore coat protein CotO	coat	NA	NA	NA	NA
WP_014479464.1|1202262_1202712_-|coat	spore coat protein CotZ	coat	NA	NA	NA	NA
WP_014479465.1|1202839_1203328_-|coat	spore coat protein CotY	coat	NA	NA	NA	NA
WP_015252341.1|1203479_1203992_-|coat	Spore coat protein X	coat	NA	NA	NA	NA
WP_015252340.1|1204086_1204410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029726269.1|1204449_1204836_-|coat	spore coat protein	coat	NA	NA	NA	NA
>prophage 3
NZ_CP016894	Bacillus subtilis strain HJ0-6, complete genome	4235115	1269229	1304428	4235115	plate,portal,holin,terminase	Bacillus_phage(28.12%)	46	NA	NA
WP_003245490.1|1269229_1270501_+	ATPase YjoB	NA	A0A1V0SEI6	Indivirus	37.1	8.6e-15
WP_010886491.1|1270645_1271782_+	response regulator aspartate phosphatase RapA	NA	A0A1P8CWN8	Bacillus_phage	47.4	8.3e-94
WP_003245487.1|1271771_1271906_+	phosphatase RapA inhibitor PhrA	NA	NA	NA	NA	NA
WP_003232731.1|1271936_1272194_-	YciI family protein	NA	NA	NA	NA	NA
WP_068947486.1|1272314_1273268_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A218KC88	Bacillus_phage	73.5	2.8e-66
WP_003245254.1|1273307_1273685_-	PH domain-containing protein	NA	A5GYQ0	Lactococcus_phage	42.3	6.1e-17
WP_003244789.1|1273790_1274393_+	poly-gamma-glutamate hydrolase family protein	NA	F8WQ53	Bacillus_phage	49.2	3.8e-45
WP_003245071.1|1274469_1275306_+	manganese catalase	NA	NA	NA	NA	NA
WP_003232721.1|1275349_1275946_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	51.7	8.1e-40
WP_003232719.1|1276108_1276450_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	45.8	1.3e-18
WP_003232712.1|1276627_1276807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003245799.1|1276793_1277630_+	phage-like element PBSX protein XkdB	NA	S6BFM4	Thermus_phage	28.2	1.8e-24
WP_010886492.1|1277529_1278330_+	ATP-binding protein	NA	A6XMI1	Bacillus_virus	51.7	5.0e-61
WP_003245588.1|1278329_1278497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003245290.1|1278581_1278932_+	phage-like element PBSX protein XkdD	NA	NA	NA	NA	NA
WP_109789043.1|1278935_1279130_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_003245797.1|1279250_1279760_+	sigma-70 family RNA polymerase sigma factor	NA	A0A1L2JY33	Aeribacillus_phage	38.6	1.9e-21
WP_003244697.1|1279875_1280673_+|terminase	PBSX phage terminase small subunit	terminase	A0A0S2MVB6	Bacillus_phage	50.2	8.0e-59
WP_003245584.1|1280669_1281971_+|terminase	PBSX family phage terminase large subunit	terminase	A0A2P1JTW5	Anoxybacillus_phage	60.2	2.4e-153
WP_003245427.1|1281974_1283462_+|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	55.7	1.7e-139
WP_003245836.1|1283481_1284309_+	phage-like element PBSX protein XkdF	NA	A0A1B1P7E4	Bacillus_phage	58.7	2.1e-54
WP_003232690.1|1284334_1285270_+	phage-like element PBSX protein XkdG	NA	A0A1B1P7E3	Bacillus_phage	63.8	1.1e-104
WP_014479552.1|1285291_1285675_+	DUF3199 family protein	NA	A0A1B1P7D6	Bacillus_phage	40.5	1.4e-13
WP_009967053.1|1285671_1286028_+	DUF3599 family protein	NA	NA	NA	NA	NA
WP_003245226.1|1286024_1286510_+	HK97 gp10 family phage protein	NA	A0A249XXA4	Clostridium_phage	47.0	2.1e-38
WP_029726235.1|1286522_1286963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003232679.1|1286966_1287185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003245369.1|1287181_1288582_+	phage-like element PBSX protein XkdK	NA	A0A0A7S087	Clostridium_phage	39.3	2.3e-77
WP_003232677.1|1288583_1289027_+	phage-like element PBSX protein XkdM	NA	A0A0K2CNG3	Brevibacillus_phage	45.2	8.4e-26
WP_015715734.1|1289117_1289564_+|portal	phage portal protein	portal	A0A0A7RTY8	Clostridium_phage	37.7	5.9e-11
WP_072692631.1|1289605_1289746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046664098.1|1289746_1294828_+	transglycosylase SLT domain-containing protein	NA	A0A1L2JY60	Aeribacillus_phage	43.8	1.1e-41
WP_029727048.1|1294820_1295480_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A0A8WJR4	Clostridium_phage	33.2	1.1e-24
WP_003245730.1|1295495_1296473_+	phage-like element PBSX protein XkdQ	NA	H7BV96	unidentified_phage	32.6	1.0e-39
WP_015715735.1|1296472_1296739_+	DUF2577 domain-containing protein	NA	S6C459	Thermus_phage	36.4	1.7e-05
WP_015715736.1|1296796_1297222_+	DUF2634 domain-containing protein	NA	A0A2H4J6K5	uncultured_Caudovirales_phage	38.0	6.6e-12
WP_015715737.1|1297214_1298261_+|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	44.0	2.4e-71
WP_015483131.1|1298244_1298823_+	YmfQ family protein	NA	A0A2H4J717	uncultured_Caudovirales_phage	33.1	5.1e-15
WP_015715738.1|1298819_1299092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029727047.1|1299094_1301536_+	hypothetical protein	NA	A0A2H4J4R1	uncultured_Caudovirales_phage	35.2	1.1e-21
WP_029727046.1|1301553_1301880_+|portal	phage portal protein	portal	NA	NA	NA	NA
WP_014479563.1|1301876_1302041_+	XkdX family protein	NA	A0A2H4JAA1	uncultured_Caudovirales_phage	67.9	1.9e-15
WP_029727045.1|1302084_1302924_+	phage-like element PBSX protein XepA	NA	NA	NA	NA	NA
WP_015252265.1|1302976_1303246_+	hypothetical protein	NA	A0A2H4JD40	uncultured_Caudovirales_phage	64.8	4.8e-24
WP_014479566.1|1303258_1303522_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	64.4	6.1e-24
WP_029727044.1|1303534_1304428_+	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXD7	Bacillus_phage	68.8	2.0e-82
>prophage 4
NZ_CP016894	Bacillus subtilis strain HJ0-6, complete genome	4235115	1814511	1892343	4235115	holin,protease,tail,tRNA,integrase	Bacillus_phage(90.0%)	87	1833053:1833070	1893681:1893698
WP_029726462.1|1814511_1815840_-|protease	serine protease AprX	protease	A0A1B0T6A2	Bacillus_phage	33.2	1.6e-27
WP_014476869.1|1816064_1816298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003245758.1|1816577_1817285_+	poly-gamma-glutamate hydrolase family protein	NA	F8WQ53	Bacillus_phage	56.9	3.2e-51
WP_003245175.1|1817354_1817807_+	OsmC family protein	NA	NA	NA	NA	NA
WP_003245163.1|1817820_1818174_-	multidrug efflux SMR transporter subunit EbrB	NA	NA	NA	NA	NA
WP_009967307.1|1818187_1818505_-	multidrug efflux SMR transporter subunit EbrA	NA	NA	NA	NA	NA
WP_029317825.1|1818640_1818916_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003231769.1|1819004_1819418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029726461.1|1819517_1820462_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_003221097.1|1820501_1820723_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_014479841.1|1820918_1821191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003245262.1|1821272_1821503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003231758.1|1821745_1822138_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	G3MBF1	Bacillus_virus	58.3	2.5e-29
WP_014479842.1|1822097_1824200_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	U5PY35	Bacillus_phage	86.8	0.0e+00
WP_003231754.1|1824217_1825207_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	F8WQ21	Bacillus_phage	83.5	1.9e-155
WP_003245105.1|1825256_1825877_+	hypothetical protein	NA	A0A127AYS1	Bacillus_phage	48.4	1.6e-46
WP_014476879.1|1825940_1826708_-	sporulation-specific N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	50.0	5.3e-52
WP_080481951.1|1827340_1827982_+	AAA family ATPase	NA	G3MAX6	Bacillus_virus	42.5	8.5e-27
WP_032721590.1|1828005_1828299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068947490.1|1828754_1829288_+	N-acetyltransferase	NA	A0A1P8CWJ6	Bacillus_phage	98.9	5.6e-93
WP_032721592.1|1829412_1830297_-	endonuclease YokF	NA	A0A1P8CWK6	Bacillus_phage	94.9	1.4e-112
WP_032721594.1|1830810_1831344_+	SMI1/KNR4 family protein	NA	A0A1P8CWM2	Bacillus_phage	96.3	2.8e-07
WP_032721595.1|1831481_1833368_+	SPBc2 prophage-derived	NA	A0A1P8CWI7	Bacillus_phage	81.4	2.9e-160
1833053:1833070	attL	AAAAAAACAATTCTTAAA	NA	NA	NA	NA
WP_032721596.1|1833380_1833839_+	SMI1 / KNR4 family protein	NA	A0A1P8CWJ1	Bacillus_phage	84.9	1.2e-70
WP_032721598.1|1833894_1834476_+	SMI1/KNR4 family protein	NA	O64025	Bacillus_phage	86.5	4.0e-92
WP_072692678.1|1834780_1834870_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_068947491.1|1835025_1836024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041336419.1|1836191_1836524_+	YolD-like family protein	NA	A0A1P8CWP2	Bacillus_phage	98.2	8.4e-55
WP_068947492.1|1836516_1837767_+	UV damage repair protein UvrX	NA	O64031	Bacillus_phage	96.9	5.0e-233
WP_068947493.1|1837807_1837984_-	aspartate phosphatase	NA	A0A1P8CWP3	Bacillus_phage	96.6	9.1e-24
WP_068947494.1|1837973_1839110_-	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	99.2	8.1e-214
WP_017696899.1|1839237_1839489_-|holin	phage holin	holin	A0A1P8CWN5	Bacillus_phage	97.6	2.1e-37
WP_017696898.1|1839509_1839902_-	hypothetical protein	NA	A0A1P8CWP1	Bacillus_phage	100.0	2.2e-62
WP_068947495.1|1840018_1841122_-	N-acetylmuramoyl-L-alanine amidase BlyA	NA	A0A1P8CWN6	Bacillus_phage	97.0	8.7e-181
WP_068947496.1|1841299_1843534_-	hypothetical protein	NA	A0A0A0RUQ7	Bacillus_phage	38.6	1.9e-65
WP_068947646.1|1843546_1844365_-	hypothetical protein	NA	O64043	Bacillus_phage	66.1	7.3e-100
WP_068947497.1|1844379_1847022_-	hypothetical protein	NA	A0A1P8CWQ0	Bacillus_phage	93.4	0.0e+00
WP_068947498.1|1847034_1847796_-|tail	phage tail protein	tail	A0A1P8CWP8	Bacillus_phage	97.0	1.1e-129
WP_068947499.1|1847836_1854730_-|tail	phage tail tape measure protein	tail	A0A1P8CWQ1	Bacillus_phage	80.9	0.0e+00
WP_068947500.1|1854783_1855410_-	hypothetical protein	NA	A0A0H3UZD5	Geobacillus_virus	35.6	1.5e-28
WP_068947501.1|1855486_1855822_-	helix-turn-helix transcriptional regulator	NA	A0A0P0IZG9	Lactobacillus_phage	33.7	1.7e-10
WP_068947502.1|1856022_1857024_-|integrase	site-specific integrase	integrase	A0A1P8CWP6	Bacillus_phage	98.2	5.0e-191
WP_068947503.1|1857037_1857457_-	hypothetical protein	NA	A0A1P8CWQ4	Bacillus_phage	87.7	1.2e-61
WP_068947504.1|1857456_1857945_-	hypothetical protein	NA	A0A1P8CWQ6	Bacillus_phage	73.0	1.2e-57
WP_080332259.1|1857982_1858123_-	XkdX family protein	NA	NA	NA	NA	NA
WP_068947505.1|1858124_1858544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068947506.1|1858540_1859485_-	hypothetical protein	NA	A0A1P8CWR7	Bacillus_phage	35.9	1.0e-20
WP_068947507.1|1859484_1859841_-	hypothetical protein	NA	O64055	Bacillus_phage	89.0	2.5e-52
WP_009967521.1|1859904_1860132_-	hypothetical protein	NA	A0A1P8CWR2	Bacillus_phage	100.0	6.4e-38
WP_072692668.1|1860131_1860743_-	hypothetical protein	NA	A0A1P8CWQ5	Bacillus_phage	95.1	1.4e-63
WP_068947508.1|1860760_1861558_-	hypothetical protein	NA	A0A1P8CWR0	Bacillus_phage	99.6	1.3e-90
WP_068947509.1|1861600_1862311_-	hypothetical protein	NA	A0A1P8CWQ7	Bacillus_phage	99.6	9.1e-131
WP_068947510.1|1862307_1862814_-	hypothetical protein	NA	O64060	Bacillus_phage	98.8	1.7e-91
WP_068947511.1|1862810_1863461_-	hypothetical protein	NA	A0A1P8CWR8	Bacillus_phage	99.1	1.0e-120
WP_068947512.1|1863444_1863699_-	hypothetical protein	NA	A0A1P8CWS7	Bacillus_phage	92.9	1.1e-35
WP_068947513.1|1863695_1864091_-	hypothetical protein	NA	A0A1P8CWR5	Bacillus_phage	95.4	1.1e-66
WP_041352941.1|1864105_1864576_-	hypothetical protein	NA	A0A1P8CWS5	Bacillus_phage	98.7	2.0e-81
WP_041337005.1|1864611_1865628_-	hypothetical protein	NA	A0A1P8CWR9	Bacillus_phage	99.7	2.9e-186
WP_068947514.1|1865666_1866203_-	hypothetical protein	NA	A0A1P8CWS2	Bacillus_phage	98.9	3.0e-94
WP_068947515.1|1866227_1867664_-	hypothetical protein	NA	A0A1P8CWR1	Bacillus_phage	96.0	5.2e-258
WP_068947516.1|1867694_1869215_-	hypothetical protein	NA	O64068	Bacillus_phage	98.6	4.3e-279
WP_003230970.1|1869232_1871002_-	hypothetical protein	NA	O64069	Bacillus_phage	99.8	0.0e+00
WP_004399257.1|1870988_1871909_-	hypothetical protein	NA	A0A1P8CWS6	Bacillus_phage	100.0	5.4e-176
WP_068947517.1|1872009_1872534_-	hypothetical protein	NA	U5J9P3	Bacillus_phage	37.3	1.4e-19
WP_068947518.1|1872746_1873946_-	metallophosphoesterase	NA	W5RV85	Staphylococcus_phage	41.6	5.2e-70
WP_068947519.1|1873957_1874167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068947520.1|1874927_1875443_-	hypothetical protein	NA	A0A0A0PL66	Bacillus_phage	49.7	1.6e-36
WP_068947521.1|1876579_1876855_-	HU family DNA-binding protein	NA	A0A1P8CWT5	Bacillus_phage	94.5	9.2e-39
WP_068947647.1|1877107_1877740_-	hypothetical protein	NA	O64076	Bacillus_phage	78.2	8.2e-91
WP_061891092.1|1877960_1878863_-	hypothetical protein	NA	G3MAX5	Bacillus_virus	35.5	1.8e-06
WP_068947522.1|1879044_1880922_-	hypothetical protein	NA	A0A1P8CWS8	Bacillus_phage	98.1	0.0e+00
WP_068947523.1|1880961_1881156_-	hypothetical protein	NA	O64077	Bacillus_phage	96.9	3.0e-28
WP_017696861.1|1882182_1882359_+	hypothetical protein	NA	O64080	Bacillus_phage	92.3	4.4e-10
WP_072557198.1|1882412_1882628_+	hypothetical protein	NA	A0A1P8CWU4	Bacillus_phage	94.4	2.0e-28
WP_003230987.1|1882672_1882861_+	hypothetical protein	NA	O64081	Bacillus_phage	96.8	9.7e-24
WP_068947524.1|1882942_1884160_+	hypothetical protein	NA	A0A1P8CWT6	Bacillus_phage	83.4	2.9e-201
WP_068947525.1|1884475_1885330_+	hypothetical protein	NA	A0A1P8CWT8	Bacillus_phage	72.9	4.1e-101
WP_068947526.1|1885335_1886262_+	hypothetical protein	NA	A0A1P8CWU6	Bacillus_phage	89.9	5.0e-145
WP_021493585.1|1886263_1886866_+	hypothetical protein	NA	A0A1P8CWV1	Bacillus_phage	98.5	9.5e-105
WP_068947527.1|1886867_1888664_+	ATP-dependent helicase	NA	A0A1P8CWU5	Bacillus_phage	99.2	0.0e+00
WP_068947528.1|1889161_1890067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068947648.1|1890208_1890430_+	helix-turn-helix transcriptional regulator	NA	A0A1P8CWU2	Bacillus_phage	84.7	3.1e-29
WP_061891109.1|1890805_1891435_+	hypothetical protein	NA	A0A1P8CWV5	Bacillus_phage	49.3	7.0e-50
WP_003231000.1|1891480_1891660_-	hypothetical protein	NA	A0A1P8CWV7	Bacillus_phage	96.6	3.6e-28
WP_068947530.1|1891730_1891982_+	hypothetical protein	NA	A0A1P8CWV6	Bacillus_phage	98.8	3.5e-37
WP_068947531.1|1891985_1892201_+	hypothetical protein	NA	O64089	Bacillus_phage	90.1	3.3e-28
WP_068947532.1|1892211_1892343_+	hypothetical protein	NA	A0A1P8CWV9	Bacillus_phage	90.7	7.9e-17
1893681:1893698	attR	AAAAAAACAATTCTTAAA	NA	NA	NA	NA
>prophage 5
NZ_CP016894	Bacillus subtilis strain HJ0-6, complete genome	4235115	1895732	1949604	4235115	integrase	Bacillus_phage(94.74%)	92	1895698:1895719	1912044:1912065
1895698:1895719	attL	AAAGATAAAAAATATGTATATA	NA	NA	NA	NA
WP_004399418.1|1895732_1895933_+	hypothetical protein	NA	O64096	Bacillus_phage	100.0	9.0e-28
WP_068947535.1|1895935_1896253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019712296.1|1896301_1896514_+	helix-turn-helix transcriptional regulator	NA	O64098	Bacillus_phage	95.7	1.6e-27
WP_068947536.1|1896503_1897580_+|integrase	site-specific integrase	integrase	O64099	Bacillus_phage	99.2	1.0e-197
WP_068947537.1|1897686_1899069_+	hypothetical protein	NA	O64100	Bacillus_phage	99.1	1.8e-260
WP_003231032.1|1899092_1900070_+	hypothetical protein	NA	O64101	Bacillus_phage	99.7	4.0e-177
WP_004399410.1|1900258_1900483_-	helix-turn-helix transcriptional regulator	NA	O64102	Bacillus_phage	100.0	1.9e-34
WP_017697044.1|1900665_1900884_+	hypothetical protein	NA	O64103	Bacillus_phage	98.6	2.5e-31
WP_017697045.1|1900953_1901151_+	hypothetical protein	NA	O64104	Bacillus_phage	98.5	6.8e-28
WP_003231036.1|1901262_1901457_+	hypothetical protein	NA	O64105	Bacillus_phage	100.0	1.9e-27
WP_041352905.1|1901545_1901881_+	hypothetical protein	NA	A0A1P8CWX6	Bacillus_phage	92.8	1.8e-44
WP_068947538.1|1901877_1902348_+	hypothetical protein	NA	A0A2I6UHP7	Bacillus_phage	45.7	9.3e-23
WP_068947539.1|1902472_1902658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041352077.1|1902660_1903089_+	hypothetical protein	NA	A0A1P8CWY3	Bacillus_phage	91.0	5.6e-67
WP_068947540.1|1903130_1903886_+	antirepressor	NA	A0A1P8CWY0	Bacillus_phage	82.9	7.0e-113
WP_068947541.1|1904275_1904914_+	DUF3920 family protein	NA	NA	NA	NA	NA
WP_017697056.1|1904956_1905247_+	hypothetical protein	NA	A0A127AWI5	Bacillus_phage	45.6	9.7e-15
WP_017697057.1|1905435_1905651_+	hypothetical protein	NA	A0A1P8CX01	Bacillus_phage	80.3	7.7e-25
WP_017697058.1|1905666_1906041_-	hypothetical protein	NA	A0A1P8CWZ2	Bacillus_phage	64.5	4.9e-35
WP_017697059.1|1906196_1906454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068947542.1|1906517_1907273_+	Rha family transcriptional regulator	NA	Q4ZC33	Staphylococcus_virus	42.5	4.3e-54
WP_068947543.1|1907312_1907573_+	hypothetical protein	NA	U5PXA4	Bacillus_phage	53.7	1.4e-20
WP_068947544.1|1907691_1908504_-	ATP-dependent DNA ligase	NA	O64130	Bacillus_phage	94.4	6.5e-149
WP_068947545.1|1908573_1909248_-	SOS response-associated peptidase	NA	A0A1P8CX02	Bacillus_phage	98.6	5.9e-79
WP_068947546.1|1909305_1909527_+	hypothetical protein	NA	A0A1P8CWZ6	Bacillus_phage	93.1	3.0e-32
WP_068947547.1|1909577_1910030_+	hypothetical protein	NA	A0A2P0ZLC1	Lactobacillus_phage	45.3	1.2e-14
WP_068947548.1|1910327_1910849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068947549.1|1910887_1911121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068947550.1|1911193_1911574_+	hypothetical protein	NA	O64137	Bacillus_phage	93.7	1.5e-63
WP_068947551.1|1911631_1911928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032721749.1|1912099_1912471_+	hypothetical protein	NA	O64139	Bacillus_phage	94.3	2.0e-60
1912044:1912065	attR	AAAGATAAAAAATATGTATATA	NA	NA	NA	NA
WP_068947552.1|1912492_1913407_+	hypothetical protein	NA	O64140	Bacillus_phage	89.8	2.8e-156
WP_004399537.1|1913489_1914461_+	ATP-binding protein	NA	A0A1P8CX29	Bacillus_phage	100.0	1.7e-180
WP_042976136.1|1914503_1914974_+	hypothetical protein	NA	A0A1P8CX08	Bacillus_phage	98.7	1.5e-86
WP_068947553.1|1914988_1916503_+	hypothetical protein	NA	A0A1P8CWZ7	Bacillus_phage	99.4	4.0e-285
WP_068947554.1|1916518_1917655_+	hypothetical protein	NA	A0A1P8CX05	Bacillus_phage	99.5	3.9e-224
WP_068947555.1|1917654_1919385_+	single-stranded-DNA-specific exonuclease RecJ	NA	A0A1P8CX07	Bacillus_phage	97.6	0.0e+00
WP_068947556.1|1919397_1923315_+	DNA polymerase III subunit alpha	NA	A0A1P8CX14	Bacillus_phage	96.2	0.0e+00
WP_080481955.1|1923343_1924060_+	hypothetical protein	NA	O64147	Bacillus_phage	91.6	1.8e-118
WP_068947558.1|1924168_1924327_+	hypothetical protein	NA	A0A1P8CX11	Bacillus_phage	88.5	1.6e-19
WP_041336515.1|1924363_1924561_+	hypothetical protein	NA	O64149	Bacillus_phage	96.9	2.1e-29
WP_019712328.1|1924593_1924809_+	hypothetical protein	NA	O64150	Bacillus_phage	98.6	3.0e-37
WP_041338484.1|1924801_1924957_+	hypothetical protein	NA	A0A1P8CX36	Bacillus_phage	94.1	5.7e-22
WP_068947559.1|1924956_1925454_+	hypothetical protein	NA	A0A1P8CX28	Bacillus_phage	96.4	1.1e-85
WP_068947560.1|1925462_1925981_+	5'-3'-deoxyribonucleotidase	NA	A0A1P8CX15	Bacillus_phage	94.2	6.7e-91
WP_004399507.1|1926012_1926132_+	hypothetical protein	NA	O64154	Bacillus_phage	100.0	1.7e-13
WP_128992112.1|1926251_1926815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068947562.1|1926858_1927077_+	hypothetical protein	NA	A0A1P8CX26	Bacillus_phage	97.2	6.2e-30
WP_032721780.1|1927079_1927445_+	hypothetical protein	NA	O64156	Bacillus_phage	97.5	3.5e-62
WP_068947563.1|1927484_1927712_+	hypothetical protein	NA	A0A1P8CX31	Bacillus_phage	98.6	3.9e-35
WP_068947649.1|1927724_1927907_+	hypothetical protein	NA	O64158	Bacillus_phage	98.3	4.5e-26
WP_068947564.1|1927973_1928186_+	hypothetical protein	NA	O64159	Bacillus_phage	97.1	2.3e-34
WP_061891143.1|1928220_1928484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068947565.1|1928508_1929057_+	metallophosphoesterase	NA	A0A223LD99	Bacillus_phage	59.6	2.8e-55
WP_155117805.1|1929117_1929297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041336502.1|1929339_1929747_+	hypothetical protein	NA	A0A1P8CX27	Bacillus_phage	60.4	2.2e-33
WP_041336500.1|1929761_1930109_+	hypothetical protein	NA	O64164	Bacillus_phage	94.8	2.0e-54
WP_041056316.1|1930122_1930248_+	hypothetical protein	NA	O64165	Bacillus_phage	80.5	5.3e-10
WP_100244384.1|1930454_1931174_+	site-specific DNA-methyltransferase	NA	A0A0H3UZL7	Geobacillus_virus	59.7	3.6e-74
WP_068947566.1|1931279_1931471_+	hypothetical protein	NA	S6BUY9	Bacillus_phage	53.2	4.3e-11
WP_080481956.1|1931485_1931698_+	DUF1653 domain-containing protein	NA	A0A1P8CX21	Bacillus_phage	78.6	2.5e-28
WP_068947567.1|1931711_1931846_+	hypothetical protein	NA	O64168	Bacillus_phage	90.9	4.0e-16
WP_068947568.1|1931865_1932060_+	hypothetical protein	NA	O64169	Bacillus_phage	96.9	2.2e-31
WP_068947569.1|1932100_1932283_+	hypothetical protein	NA	F8WPL1	Bacillus_phage	66.7	1.3e-17
WP_068947570.1|1932360_1932708_+	hypothetical protein	NA	A0A1P8CX44	Bacillus_phage	55.0	3.3e-25
WP_068947571.1|1932707_1933103_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A1P8CX56	Bacillus_phage	93.9	2.6e-63
WP_128992191.1|1933110_1933788_+	ribonucleotide-diphosphate reductase subunit alpha	NA	A0A1P8CX40	Bacillus_phage	87.1	3.3e-106
WP_041052703.1|1936375_1936897_+	HNH endonuclease	NA	A0A1P8CX39	Bacillus_phage	91.9	4.5e-87
WP_061891157.1|1937477_1937720_+	thiol reductase thioredoxin	NA	A0A1P8CX24	Bacillus_phage	91.1	2.4e-35
WP_061891158.1|1937712_1937964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061891159.1|1937963_1938470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041052700.1|1938519_1938882_+	hypothetical protein	NA	A0A172JI43	Bacillus_phage	43.8	4.2e-15
WP_041052698.1|1938953_1939382_+	dUTP diphosphatase	NA	A0A1P8CX51	Bacillus_phage	94.4	1.8e-73
WP_017697107.1|1939469_1939652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033880504.1|1939803_1939959_+	hypothetical protein	NA	A0A1P8CX64	Bacillus_phage	86.3	1.3e-18
WP_033885274.1|1939976_1940270_+	hypothetical protein	NA	A0A1P8CX63	Bacillus_phage	92.8	1.1e-42
WP_068947573.1|1940412_1940757_+	hypothetical protein	NA	A0A1P8CX52	Bacillus_phage	92.1	3.8e-50
WP_068947574.1|1940813_1941653_+	thymidylate synthase	NA	A0A1P8CX42	Bacillus_phage	96.8	5.3e-162
WP_017697111.1|1941652_1942174_+	dihydrofolate reductase	NA	A0A0H3UYW4	Geobacillus_virus	44.7	2.4e-35
WP_068947575.1|1942298_1942649_+	hypothetical protein	NA	A0A1P8CX43	Bacillus_phage	94.9	1.6e-51
WP_068947577.1|1943398_1943578_+	hypothetical protein	NA	A0A1P8CX65	Bacillus_phage	89.6	1.9e-16
WP_042976081.1|1944011_1944224_-	alpha/beta-type small acid-soluble spore protein	NA	A0A1P8CX76	Bacillus_phage	100.0	4.1e-31
WP_068947578.1|1944391_1944727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068947579.1|1944933_1945155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068947650.1|1945181_1945517_+	hypothetical protein	NA	F8WPK8	Bacillus_phage	67.0	9.1e-41
WP_068947580.1|1945549_1946227_+	DUF559 domain-containing protein	NA	A0A0S2SXZ1	Bacillus_phage	37.3	9.9e-10
WP_009967444.1|1946272_1946485_+	hypothetical protein	NA	O64192	Bacillus_phage	100.0	5.2e-34
WP_010886533.1|1946568_1946754_+	hypothetical protein	NA	O64193	Bacillus_phage	100.0	2.1e-26
WP_080481958.1|1946755_1946998_-	helix-turn-helix transcriptional regulator	NA	O64194	Bacillus_phage	98.8	3.6e-39
WP_068947582.1|1947072_1947672_+	hypothetical protein	NA	O64195	Bacillus_phage	89.8	1.1e-92
WP_155117806.1|1947668_1947815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068947583.1|1947903_1949604_+	resolvase	NA	B8R885	Bacillus_phage	24.3	4.7e-16
>prophage 6
NZ_CP016894	Bacillus subtilis strain HJ0-6, complete genome	4235115	1954695	2034129	4235115	portal,terminase,coat,holin,protease,capsid,tail,plate,integrase,head	Bacillus_phage(67.74%)	79	1948490:1948507	2022811:2022828
1948490:1948507	attL	ACGAAGAAGAAAAAGAAA	NA	NA	NA	NA
WP_068947584.1|1954695_1955850_-|integrase	site-specific integrase	integrase	A0A0M5M609	Bacillus_phage	39.7	2.8e-65
WP_038427666.1|1956157_1957339_+	helix-turn-helix transcriptional regulator	NA	Q2I8D6	Bacillus_phage	27.4	2.6e-13
WP_154230814.1|1957277_1957490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038427668.1|1957711_1958125_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_038427669.1|1958302_1958503_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_038427671.1|1958545_1958875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154230815.1|1958932_1959088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038427672.1|1959084_1959711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068947586.1|1959979_1960879_+	replication protein	NA	V5UQV4	Oenococcus_phage	37.9	2.7e-31
WP_068947587.1|1960862_1961693_+	ATP-binding protein	NA	A0A0U3U1U1	Bacillus_phage	34.7	4.2e-34
WP_038427676.1|1961998_1962547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154230816.1|1962654_1962795_+	BH0509 family protein	NA	NA	NA	NA	NA
WP_038427677.1|1963041_1963239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038427678.1|1963281_1963608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038427680.1|1963604_1963865_+	hypothetical protein	NA	A0A2H4JA61	uncultured_Caudovirales_phage	47.4	3.3e-06
WP_038427681.1|1963973_1965116_+	DUF3578 domain-containing protein	NA	NA	NA	NA	NA
WP_038427682.1|1965105_1965789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068947588.1|1965998_1966448_+	ArpU family transcriptional regulator	NA	S6AVV9	Thermus_phage	56.6	4.4e-38
WP_038427685.1|1966447_1966990_+|integrase	tyrosine-type recombinase/integrase	integrase	D2XR58	Bacillus_phage	63.9	5.8e-61
WP_068947589.1|1967207_1967786_+	DUF4145 domain-containing protein	NA	NA	NA	NA	NA
WP_068947590.1|1968167_1968632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068947591.1|1969081_1970476_+	metal-binding protein	NA	NA	NA	NA	NA
WP_068947592.1|1970777_1971143_+	HNH endonuclease	NA	A0A1U7Q1S7	Geobacillus_virus	53.3	8.8e-29
WP_038427692.1|1971370_1971886_+|terminase	phage terminase small subunit P27 family	terminase	A6M947	Geobacillus_virus	43.4	2.2e-33
WP_068947593.1|1971882_1973592_+|terminase	terminase large subunit	terminase	A0A0S2GLF0	Bacillus_phage	62.3	1.2e-205
WP_068947594.1|1973780_1975061_+|portal	phage portal protein	portal	D6R3Y6	Bacillus_phage	63.3	1.2e-152
WP_068947595.1|1975023_1975650_+|head,protease	HK97 family phage prohead protease	head,protease	Q9ZXF7	Bacillus_phage	75.4	4.9e-80
WP_032725456.1|1975688_1976984_+|capsid	phage major capsid protein	capsid	A0A0A7RTL2	Clostridium_phage	48.3	5.2e-92
WP_068947596.1|1977007_1977469_+	collagen-like protein	NA	D6R3Z0	Bacillus_phage	58.9	1.8e-10
WP_041057207.1|1977486_1977789_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0S2GLH6	Bacillus_phage	46.3	2.1e-12
WP_041057204.1|1977778_1978093_+|head	phage head closure protein	head	A0A2H4JCB1	uncultured_Caudovirales_phage	36.3	2.9e-12
WP_032725460.1|1978092_1978491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041057199.1|1978487_1978880_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_059335732.1|1978894_1979506_+|tail	phage tail protein	tail	J7KKC8	Streptococcus_phage	35.1	3.6e-11
WP_068947597.1|1979572_1979950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068947598.1|1980149_1984637_+|tail	phage tail tape measure protein	tail	A6M961	Geobacillus_virus	41.5	1.5e-66
WP_068947599.1|1985453_1987157_+	alkaline phosphatase	NA	D6R400	Bacillus_phage	55.5	1.6e-178
WP_068947600.1|1987208_1989107_+	teichoic acid biosynthesis protein	NA	A0A185AMX0	Staphylococcus_phage	33.0	1.9e-42
WP_038427704.1|1989122_1989431_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068947601.1|1989613_1991197_+|plate	phage baseplate upper protein	plate	A0A1P8CWR7	Bacillus_phage	48.0	2.8e-63
WP_038427706.1|1991210_1991579_+	hypothetical protein	NA	Q9ZXE0	Bacillus_phage	47.6	3.5e-17
WP_080282461.1|1991578_1991752_+	XkdX family protein	NA	Q9ZXD9	Bacillus_phage	75.4	2.5e-18
WP_119900114.1|1991902_1992154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038427709.1|1992219_1992642_+|holin	holin	holin	D6R405	Bacillus_phage	82.7	2.4e-54
WP_038427711.1|1992685_1993663_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A218KC88	Bacillus_phage	68.7	7.0e-65
WP_038427712.1|1993703_1994003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068947602.1|1994009_1995857_-	ribonuclease YeeF family protein	NA	A0A1P8CWI7	Bacillus_phage	55.9	1.3e-120
WP_029726441.1|1996952_1997243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029726440.1|1997481_1997970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068947603.1|1999002_2004348_+	S-layer family protein	NA	NA	NA	NA	NA
WP_029726887.1|2004451_2005123_-	glycosyl transferase	NA	NA	NA	NA	NA
WP_029726888.1|2005119_2005827_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_029726889.1|2005813_2006920_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_051673223.1|2006916_2008293_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_153912179.1|2009046_2009211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029726893.1|2009487_2010024_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_029726894.1|2010102_2011005_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_029726895.1|2011082_2011463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003231687.1|2012005_2012236_+	helix-turn-helix transcriptional regulator	NA	A0A1P8CWU2	Bacillus_phage	82.4	2.0e-23
WP_029726896.1|2012232_2012871_+	DUF3885 domain-containing protein	NA	NA	NA	NA	NA
WP_003231681.1|2013139_2013304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029726897.1|2013433_2013904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029726898.1|2014431_2014962_+	N-acetyltransferase	NA	A0A1P8CWJ6	Bacillus_phage	82.9	2.5e-77
WP_017697653.1|2015964_2017356_+	MFS transporter	NA	NA	NA	NA	NA
WP_029726899.1|2017386_2018988_+	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_029726900.1|2019124_2020279_-	ROK family protein	NA	NA	NA	NA	NA
WP_003231664.1|2020520_2021858_+	xylose isomerase	NA	NA	NA	NA	NA
WP_038427718.1|2022008_2023508_+	xylulokinase	NA	NA	NA	NA	NA
2022811:2022828	attR	ACGAAGAAGAAAAAGAAA	NA	NA	NA	NA
WP_038427719.1|2023992_2024628_-	endonuclease YncB	NA	A0A1P8CWK6	Bacillus_phage	68.1	5.0e-72
WP_029317843.1|2025041_2026457_+	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_015713988.1|2026558_2027743_-	alanine racemase	NA	NA	NA	NA	NA
WP_029726906.1|2028208_2028670_+	DUF2691 family protein	NA	NA	NA	NA	NA
WP_003245820.1|2028699_2029134_+	dUTP diphosphatase	NA	A0A1P8CX51	Bacillus_phage	93.0	2.0e-72
WP_029726907.1|2029775_2030036_-|coat	spore coat protein CotU	coat	NA	NA	NA	NA
WP_003231643.1|2030437_2030602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029317846.1|2030876_2031716_+	thymidylate synthase	NA	A0A1P8CX42	Bacillus_phage	98.6	1.9e-164
WP_121572629.1|2032443_2033166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029726909.1|2033326_2033683_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024573164.1|2033928_2034129_-|coat	spore coat protein CotC	coat	NA	NA	NA	NA
>prophage 7
NZ_CP016894	Bacillus subtilis strain HJ0-6, complete genome	4235115	2416907	2423003	4235115		Staphylococcus_phage(66.67%)	8	NA	NA
WP_003223904.1|2416907_2417501_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	35.4	2.0e-14
WP_015714192.1|2417490_2418246_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	25.8	9.4e-09
WP_015251790.1|2418526_2419051_+	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_003223910.1|2419064_2419439_-	GNAT family N-acetyltransferase RibT	NA	NA	NA	NA	NA
WP_003223915.1|2419551_2420016_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	60.0	5.5e-44
WP_014480160.1|2420048_2421245_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	54.9	4.1e-115
WP_029726753.1|2421259_2421907_-	riboflavin synthase subunit alpha	NA	A0A2H4PQS5	Staphylococcus_phage	45.9	8.5e-43
WP_004398763.1|2421917_2423003_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	36.1	5.1e-56
>prophage 8
NZ_CP016894	Bacillus subtilis strain HJ0-6, complete genome	4235115	2658343	2697548	4235115	portal,terminase,holin,tail,capsid,plate	uncultured_Caudovirales_phage(29.03%)	56	NA	NA
WP_068947614.1|2658343_2659939_+	type II toxin-antitoxin system toxin ribonuclease YqcG	NA	A0A1P8CWI7	Bacillus_phage	60.5	6.5e-76
WP_009967790.1|2659953_2660532_+	type II toxin-antitoxin system antitoxin YqcF	NA	NA	NA	NA	NA
WP_009967791.1|2660649_2660796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003229947.1|2660792_2661155_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004399085.1|2661170_2661650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017697459.1|2661814_2662633_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A218KC88	Bacillus_phage	73.8	3.8e-64
WP_017697460.1|2662677_2663100_-|holin	holin family protein	holin	D6R405	Bacillus_phage	72.9	1.7e-47
WP_032722160.1|2663145_2664039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003229944.1|2664126_2664291_-	XkdX family protein	NA	A0A2H4JAA1	uncultured_Caudovirales_phage	67.9	2.7e-14
WP_009967793.1|2664287_2664623_-|portal	phage portal protein	portal	NA	NA	NA	NA
WP_032722161.1|2664632_2665733_-	hypothetical protein	NA	M4ZRP1	Bacillus_phage	56.1	1.7e-19
WP_032722163.1|2665736_2666009_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032722164.1|2666005_2666584_-	YmfQ family protein	NA	A0A2H4J717	uncultured_Caudovirales_phage	33.8	1.9e-14
WP_032722165.1|2666567_2667614_-|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	44.0	4.8e-72
WP_032722166.1|2667606_2668032_-	DUF2634 domain-containing protein	NA	A0A0A8WJV8	Clostridium_phage	33.3	5.6e-11
WP_032722167.1|2668044_2668311_-	DUF2577 domain-containing protein	NA	NA	NA	NA	NA
WP_032722168.1|2668307_2669288_-	hypothetical protein	NA	H7BV96	unidentified_phage	32.3	1.6e-40
WP_032722169.1|2669300_2669960_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A090DBR9	Clostridium_phage	34.7	2.1e-25
WP_043940167.1|2669952_2674710_-	transglycosylase SLT domain-containing protein	NA	A0A1L2JY60	Aeribacillus_phage	47.2	1.8e-44
WP_003229934.1|2674712_2674850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017697468.1|2674891_2675341_-|portal	phage portal protein	portal	A0A0A7RTY8	Clostridium_phage	40.2	5.9e-11
WP_106610765.1|2675497_2675584_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_017697469.1|2675842_2676286_-|tail	phage tail tube protein	tail	A0A0K2CNG3	Brevibacillus_phage	45.4	2.5e-25
WP_017697470.1|2676288_2677689_-|portal	phage portal protein	portal	S5MNC1	Brevibacillus_phage	39.3	4.8e-75
WP_033880532.1|2677689_2677881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017697472.1|2677877_2678315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017697473.1|2678327_2678831_-	HK97 gp10 family phage protein	NA	A0A249XXA4	Clostridium_phage	47.5	1.7e-38
WP_017697474.1|2678827_2679190_-	DUF3599 family protein	NA	NA	NA	NA	NA
WP_017697475.1|2679186_2679582_-	DUF3199 family protein	NA	NA	NA	NA	NA
WP_068947615.1|2679586_2679898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068947616.1|2679908_2680844_-|capsid	major capsid protein	capsid	A0A1B1P7E3	Bacillus_phage	65.4	8.6e-105
WP_068947617.1|2680862_2681837_-|portal	phage portal protein	portal	A0A1B1P7E4	Bacillus_phage	56.6	6.3e-58
WP_040082428.1|2681993_2682899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068947618.1|2682943_2683861_-	hypothetical protein	NA	A0A1B1P7D7	Bacillus_phage	39.6	5.2e-54
WP_068947619.1|2683857_2685390_-|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	52.0	1.0e-147
WP_072692701.1|2685393_2686689_-|terminase	PBSX family phage terminase large subunit	terminase	A0A2P1JTW5	Anoxybacillus_phage	63.2	1.6e-154
WP_017697483.1|2686681_2687401_-	hypothetical protein	NA	A0A2P1JTW4	Anoxybacillus_phage	61.3	1.3e-60
WP_068947621.1|2687476_2688235_-	DNA-directed RNA polymerase	NA	NA	NA	NA	NA
WP_017697601.1|2688350_2688818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017697600.1|2688961_2689417_-	hypothetical protein	NA	A0A2H4J4R7	uncultured_Caudovirales_phage	73.5	3.1e-60
WP_017697599.1|2689507_2690266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017697598.1|2690475_2690835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017697597.1|2690982_2691192_-	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	68.7	2.7e-19
WP_017697596.1|2691273_2691702_-	RusA family crossover junction endodeoxyribonuclease	NA	S6B1L9	Thermus_phage	67.2	1.6e-42
WP_072692702.1|2691796_2691946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072692704.1|2691936_2692878_-	ATP-binding protein	NA	A6XMI1	Bacillus_virus	52.2	2.1e-58
WP_128992198.1|2692759_2693437_-	DnaD domain protein	NA	A0A2H4J6G9	uncultured_Caudovirales_phage	32.2	1.1e-05
WP_017697591.1|2693513_2694368_-	recombinase RecT	NA	A0A2H4JCY8	uncultured_Caudovirales_phage	77.6	5.1e-120
WP_068947622.1|2694370_2695330_-	YqaJ viral recombinase family protein	NA	A0A2H4JA52	uncultured_Caudovirales_phage	74.2	1.3e-135
WP_068947623.1|2695435_2695630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122060486.1|2695589_2695763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015714340.1|2695759_2696017_-	hypothetical protein	NA	A0A2H4J4M9	uncultured_Caudovirales_phage	42.2	6.4e-10
WP_068947624.1|2696013_2696583_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J884	uncultured_Caudovirales_phage	61.0	1.5e-64
WP_003229902.1|2696656_2696797_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068947625.1|2696829_2697039_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_021480133.1|2697194_2697548_+	helix-turn-helix domain-containing protein	NA	A0A0A7RTK4	Clostridium_phage	48.6	8.0e-11
>prophage 9
NZ_CP016894	Bacillus subtilis strain HJ0-6, complete genome	4235115	2838940	2892411	4235115	tRNA,protease,coat	uncultured_Mediterranean_phage(12.5%)	56	NA	NA
WP_003229725.1|2838940_2840086_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	44.0	3.4e-87
WP_003229723.1|2840112_2841141_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_003222669.1|2841170_2841371_-	DUF2905 domain-containing protein	NA	NA	NA	NA	NA
WP_003229718.1|2841363_2842368_-	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	30.8	1.1e-07
WP_003229717.1|2842378_2842984_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_003229715.1|2843122_2843635_-	sporulation cell-cell signaling protein BofC	NA	NA	NA	NA	NA
WP_003246197.1|2843682_2844990_-	MFS transporter	NA	NA	NA	NA	NA
WP_029318179.1|2845060_2846086_-	inositol 2-dehydrogenase	NA	NA	NA	NA	NA
WP_003246159.1|2846323_2846971_+	serine/threonine protein kinase	NA	A0A2R3ZQF2	Marseillevirus	26.3	5.4e-05
WP_003229707.1|2847016_2847139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029318180.1|2847223_2847670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004398683.1|2847676_2847817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038427814.1|2847979_2849434_+	alanine:cation symporter family protein	NA	NA	NA	NA	NA
WP_004398802.1|2849474_2850197_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_029727125.1|2850299_2850896_-	spore germination protein SgpA	NA	NA	NA	NA	NA
WP_029727124.1|2851043_2852207_-|coat	spore coat assembly protein SafA	coat	NA	NA	NA	NA
WP_038427815.1|2852323_2853430_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_029318181.1|2853416_2854286_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_029727122.1|2854239_2855835_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_029727121.1|2855937_2857125_+	cysteine desulfurase NifS	NA	A0A141ZJV0	Faustovirus	27.4	1.7e-33
WP_004398582.1|2857084_2857627_+	transcription repressor NadR	NA	NA	NA	NA	NA
WP_029727120.1|2857650_2858508_-	prephenate dehydratase	NA	NA	NA	NA	NA
WP_003222630.1|2858524_2858968_-	transcriptional regulator ThrR	NA	NA	NA	NA	NA
WP_029727119.1|2859028_2860315_-	GTPase ObgE	NA	NA	NA	NA	NA
WP_004399131.1|2860348_2860927_-	sporulation initiation phosphotransferase Sop0B	NA	NA	NA	NA	NA
WP_003229671.1|2861004_2861127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003222623.1|2861247_2861532_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_003229669.1|2861544_2861883_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_003229668.1|2861885_2862194_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_004398649.1|2862340_2863207_-	stage IV sporulation protein SpoIVFB	NA	NA	NA	NA	NA
WP_029727118.1|2863199_2863994_-	stage IV sporulation protein SpoIVFA	NA	NA	NA	NA	NA
WP_004398624.1|2864142_2864949_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_004398901.1|2864950_2865631_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_004398811.1|2865683_2866202_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_003222609.1|2866198_2867071_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_003229650.1|2867101_2868115_-	rod shape-determining protein MreB	NA	NA	NA	NA	NA
WP_015251546.1|2868206_2868902_-	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_004398496.1|2868938_2869508_-	septum formation protein Maf	NA	NA	NA	NA	NA
WP_038427816.1|2869660_2870656_-	stage II sporulation protein SpoIIB	NA	NA	NA	NA	NA
WP_072692713.1|2870789_2871536_-	prepilin peptidase	NA	NA	NA	NA	NA
WP_038427817.1|2871677_2872970_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_029727115.1|2873029_2875672_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	42.6	4.9e-161
WP_003222590.1|2876119_2876311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029727114.1|2876329_2877355_-|coat	spore coat protein CotN	coat	NA	NA	NA	NA
WP_029727113.1|2877387_2879115_-|coat	spore coat morphogenetic protein SpoVID	coat	NA	NA	NA	NA
WP_015384279.1|2879245_2880538_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_029727112.1|2880567_2881542_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_029727111.1|2881538_2882327_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_072692716.1|2882316_2883261_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_003222575.1|2883293_2884124_-	protein HemX	NA	NA	NA	NA	NA
WP_004399038.1|2884131_2885499_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_014477563.1|2885728_2886226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003229621.1|2886247_2886835_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_029726365.1|2886831_2889156_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	43.7	2.6e-182
WP_029726366.1|2889336_2890995_-|protease	ATP-dependent protease LonB	protease	A0A1V0SHJ7	Hokovirus	33.7	8.1e-05
WP_003229613.1|2891148_2892411_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	64.9	1.3e-148
>prophage 10
NZ_CP016894	Bacillus subtilis strain HJ0-6, complete genome	4235115	3467127	3474862	4235115	holin	Organic_Lake_phycodnavirus(50.0%)	9	NA	NA
WP_038427914.1|3467127_3467808_-|holin	choline ABC transporter permease OpuBD	holin	NA	NA	NA	NA
WP_038427915.1|3467824_3468745_-	osmoprotectant ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003228370.1|3468756_3469410_-|holin	choline ABC transporter permease OpuBB	holin	NA	NA	NA	NA
WP_038427916.1|3469426_3470572_-|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	F2Y2R6	Organic_Lake_phycodnavirus	32.3	6.0e-15
WP_014478002.1|3470855_3471389_+	GbsR/MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_038427917.1|3471420_3472095_-|holin	glycine betaine/carnitine/choline/choline sulfate ABC transporter permease OpuCD	holin	NA	NA	NA	NA
WP_072692820.1|3472112_3473024_-	osmoprotectant ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_038427919.1|3473043_3473697_-|holin	glycine betaine/carnitine/choline/choline sulfate ABC transporter permease OpuCB	holin	NA	NA	NA	NA
WP_003243370.1|3473719_3474862_-|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	W6JKT0	Anomala_cuprea_entomopoxvirus	29.3	6.2e-12
>prophage 11
NZ_CP016894	Bacillus subtilis strain HJ0-6, complete genome	4235115	3848607	3927428	4235115	bacteriocin,tRNA,protease,coat	Bacillus_phage(25.0%)	80	NA	NA
WP_038427988.1|3848607_3850278_-|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003243604.1|3850274_3850703_-	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
WP_003222002.1|3851015_3851147_+|bacteriocin	subtilosin A family bacteriocin	bacteriocin	NA	NA	NA	NA
WP_010886632.1|3851103_3851256_+|bacteriocin	bacteriocin-like protein SboX	bacteriocin	NA	NA	NA	NA
WP_038427989.1|3851280_3852627_+	subtilosin maturase AlbA	NA	NA	NA	NA	NA
WP_003222006.1|3852639_3852801_+|bacteriocin	antilisterial bacteriocin subtilosin biosynthesis protein AlbB	bacteriocin	NA	NA	NA	NA
WP_029726076.1|3852797_3853517_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.2	5.6e-19
WP_038427990.1|3853509_3854820_+|bacteriocin	antilisterial bacteriocin subtilosin biosynthesis protein AlbD	bacteriocin	NA	NA	NA	NA
WP_072692833.1|3854809_3855970_+	insulinase family protein	NA	NA	NA	NA	NA
WP_003227558.1|3855974_3857255_+	insulinase family protein	NA	NA	NA	NA	NA
WP_038427991.1|3857251_3857953_+|bacteriocin	antilisterial bacteriocin subtilosin biosynthesis protein AlbG	bacteriocin	NA	NA	NA	NA
WP_038427992.1|3857958_3859332_-	YncE family protein	NA	NA	NA	NA	NA
WP_038427993.1|3859374_3860730_-	YncE family protein	NA	NA	NA	NA	NA
WP_009968328.1|3860726_3860957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029318693.1|3860959_3862105_+	response regulator aspartate phosphatase RapF	NA	A0A1P8CWN8	Bacillus_phage	43.0	1.4e-77
WP_009968329.1|3862088_3862208_+	phosphatase RapF inhibitor PhrF	NA	NA	NA	NA	NA
WP_038427994.1|3862460_3862940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015714893.1|3863088_3863877_+	membrane protein	NA	NA	NA	NA	NA
WP_015714894.1|3863863_3864538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038427995.1|3864538_3865345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015714896.1|3865347_3865995_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	40.0	7.7e-28
WP_015714897.1|3865987_3866548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003227545.1|3866596_3867469_-	agmatinase	NA	NA	NA	NA	NA
WP_003227543.1|3867529_3868360_-	spermidine synthase	NA	NA	NA	NA	NA
WP_038427996.1|3868560_3870636_+	penicillin-binding protein	NA	NA	NA	NA	NA
WP_015250981.1|3870928_3871447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003243167.1|3871460_3872120_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003222038.1|3872228_3872417_+	2-hydroxymuconate tautomerase	NA	NA	NA	NA	NA
WP_003242889.1|3872459_3872879_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003243399.1|3872998_3874915_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	43.2	6.2e-142
WP_003243441.1|3875759_3877160_-	MFS transporter	NA	NA	NA	NA	NA
WP_003243988.1|3877159_3877630_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_003227524.1|3877741_3878242_-	YwgA family protein	NA	NA	NA	NA	NA
WP_003243873.1|3878277_3879579_-	HD domain-containing protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	28.9	4.2e-25
WP_003222050.1|3879740_3879965_-	DUF1450 domain-containing protein	NA	NA	NA	NA	NA
WP_029726231.1|3880179_3880956_+	prespore-specific transcription regulator RsfA	NA	A0A1D6X8E5	Bacillus_phage	50.0	7.6e-06
WP_029726230.1|3881099_3881990_-	DMT family transporter	NA	NA	NA	NA	NA
WP_003227511.1|3882157_3883003_-	octanoyl-[GcvH]:protein N-octanoyltransferase	NA	NA	NA	NA	NA
WP_029726229.1|3883051_3883951_-	cysJI operon transcriptional regulator CysL	NA	A0A2H4J8I9	uncultured_Caudovirales_phage	42.5	3.6e-07
WP_003235941.1|3884096_3885068_-	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_003227507.1|3885337_3886102_+	heme-dependent peroxidase	NA	NA	NA	NA	NA
WP_038427997.1|3886234_3887014_+	NADPH-dependent reductase BacG	NA	NA	NA	NA	NA
WP_038427998.1|3887028_3888228_-	transaminase BacF	NA	NA	NA	NA	NA
WP_014481236.1|3888228_3889413_-	bacilysin exporter BacE	NA	NA	NA	NA	NA
WP_038427999.1|3889409_3890828_-	alanine--anticapsin ligase	NA	NA	NA	NA	NA
WP_038428162.1|3890846_3891608_-	dihydroanticapsin 7-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.3	2.6e-22
WP_038428000.1|3891610_3892318_-	3-((4R)-4-hydroxycyclohexa-1, 5-dien-1-yl)-2-oxopropanoate isomerase	NA	NA	NA	NA	NA
WP_009968341.1|3892307_3892922_-	prephenate decarboxylase	NA	NA	NA	NA	NA
WP_038428001.1|3893073_3894312_-	MFS transporter	NA	NA	NA	NA	NA
WP_015250969.1|3894521_3895934_-	amino acid permease	NA	NA	NA	NA	NA
WP_038428002.1|3895933_3897634_-	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_014478322.1|3897718_3899266_-	L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_015250966.1|3899492_3900767_-	glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_003227472.1|3900944_3901409_-	biofilm-surface layer protein BslB	NA	NA	NA	NA	NA
WP_014481242.1|3901732_3902188_-|coat	spore coat polysaccharide biosynthesis protein SpsL	coat	NA	NA	NA	NA
WP_015250965.1|3902180_3903032_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	38.9	3.7e-38
WP_003244201.1|3903045_3903993_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	43.8	4.4e-72
WP_014478328.1|3903992_3904733_-	NTP transferase domain-containing protein	NA	I7I009	Enterobacteria_phage	41.9	4.5e-48
WP_038428003.1|3904757_3905777_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_038428004.1|3905779_3906502_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_029726215.1|3906494_3907616_-|coat	spore coat biosynthesis protein SpsE	coat	NA	NA	NA	NA
WP_029726214.1|3907615_3908485_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_014481249.1|3908485_3909655_-	DegT/DnrJ/EryC1/StrS aminotransferase family protein	NA	A0A1D8KU11	Synechococcus_phage	28.1	1.2e-15
WP_029726213.1|3909675_3911100_-	CDP-glycerol glycerophosphotransferase family protein	NA	NA	NA	NA	NA
WP_068947645.1|3911104_3911875_-|coat	spore coat dTDP-glycosyltransferase SpsA	coat	A0A0F7L2F7	uncultured_marine_virus	28.6	3.4e-06
WP_014481253.1|3912194_3912740_+|coat	spore coat protein GerQ	coat	NA	NA	NA	NA
WP_003227446.1|3912783_3913155_-	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_029726212.1|3913216_3914539_-	purine permease	NA	NA	NA	NA	NA
WP_029726211.1|3914558_3914876_-	YwdI family protein	NA	NA	NA	NA	NA
WP_029726210.1|3915043_3916414_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_014478341.1|3916438_3917116_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	45.7	1.8e-48
WP_015250953.1|3917128_3917935_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_014665830.1|3918125_3918941_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_003243437.1|3919031_3919280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029726209.1|3919373_3920813_-	sucrose-6-phosphate hydrolase	NA	F8WPR5	Bacillus_phage	26.4	3.1e-21
WP_029726208.1|3920809_3922195_-	PTS system sucrose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_014481261.1|3922496_3923267_+	formate/nitrite transporter family protein	NA	NA	NA	NA	NA
WP_003227423.1|3923305_3924136_-	sac operon transcriptional antiterminator SacT	NA	NA	NA	NA	NA
WP_003222155.1|3924175_3924478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029726207.1|3925007_3927428_+|protease	serine protease Vpr	protease	A0A217EQY2	Bacillus_phage	38.2	5.3e-21
