The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP014936	Pediococcus claussenii strain TMW 2.54 chromosome, complete genome	1886832	589859	597960	1886832		Bacillus_phage(33.33%)	8	NA	NA
WP_014216054.1|589859_591191_+	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	25.4	1.3e-26
WP_014216055.1|591247_591580_-	AzlD domain-containing protein	NA	NA	NA	NA	NA
WP_014216056.1|591599_592385_-	branched-chain amino acid ABC transporter	NA	NA	NA	NA	NA
WP_014216057.1|592504_593806_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	27.8	7.8e-11
WP_014216058.1|593952_595077_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	29.7	8.4e-30
WP_014216059.1|595324_596014_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	8.2e-36
WP_014216060.1|596099_596597_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	H2EF51	Moumouvirus	34.0	1.2e-15
WP_014216061.1|596817_597960_-	guanosine monophosphate reductase	NA	A0A1V0SHK8	Klosneuvirus	34.5	3.1e-64
>prophage 2
NZ_CP014936	Pediococcus claussenii strain TMW 2.54 chromosome, complete genome	1886832	1363835	1371569	1886832		Bacillus_phage(33.33%)	8	NA	NA
WP_148265538.1|1363835_1364951_+	peptide chain release factor 2	NA	B5LLF2	Mycobacterium_phage	43.2	8.4e-06
WP_014215020.1|1364963_1365662_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	38.8	2.1e-39
WP_014215021.1|1365642_1367025_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	29.8	2.1e-22
WP_014215022.1|1367292_1368171_+	phosphate ABC transporter substrate-binding protein PstS family protein	NA	H6WG65	Cyanophage	30.4	4.9e-09
WP_014215023.1|1368177_1369098_+	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_014215024.1|1369094_1369982_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_014215025.1|1369995_1370796_+	phosphate ABC transporter ATP-binding protein	NA	M1IC18	Acanthocystis_turfacea_Chlorella_virus	31.8	2.4e-07
WP_014215026.1|1370813_1371569_+	phosphate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.1	1.6e-16
>prophage 3
NZ_CP014936	Pediococcus claussenii strain TMW 2.54 chromosome, complete genome	1886832	1411668	1442435	1886832	portal,tRNA,head,terminase,integrase,capsid	Lactobacillus_phage(17.65%)	34	1429625:1429645	1443427:1443447
WP_014215062.1|1411668_1412139_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_014215063.1|1412131_1412623_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_014215064.1|1412615_1413152_-	exonuclease	NA	M1PFD8	Streptococcus_phage	43.3	3.9e-25
WP_014215065.1|1413229_1414141_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_014215066.1|1414173_1415073_+	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_014215067.1|1415317_1416169_+	TIGR00159 family protein	NA	NA	NA	NA	NA
WP_065868811.1|1416165_1416963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014215069.1|1416991_1418353_+	phosphoglucosamine mutase	NA	A0A127AWJ1	Bacillus_phage	27.4	8.1e-19
WP_014215070.1|1418561_1420376_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	36.8	1.2e-94
WP_014215071.1|1420635_1420950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014215072.1|1421027_1421408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148265539.1|1421590_1421935_+	metalloregulator ArsR/SmtB family transcription factor	NA	NA	NA	NA	NA
WP_014215074.1|1421946_1423623_+	oleate hydratase	NA	NA	NA	NA	NA
WP_014215075.1|1423754_1424600_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_041534573.1|1424916_1426113_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.3	2.8e-15
WP_014215077.1|1426096_1426861_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_041534574.1|1426927_1427878_+	2-hydroxyacid dehydrogenase	NA	M1H9J0	Paramecium_bursaria_Chlorella_virus	33.1	3.8e-31
WP_014215079.1|1428033_1428846_-	LicD family protein	NA	A0A1V0SD50	Indivirus	39.2	1.5e-07
1429625:1429645	attL	ACTTAGTCAAAAACTTAGTCA	NA	NA	NA	NA
WP_014215081.1|1429662_1430814_-|integrase	site-specific integrase	integrase	A0A097PAS9	Streptococcus_pyogenes_phage	36.9	1.3e-54
WP_014215082.1|1431013_1431832_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_041534575.1|1431993_1432200_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_014215083.1|1432174_1432444_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_041534576.1|1432683_1432920_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014215084.1|1432888_1433752_+	Bifunctional DNA primase/polymerase, phage related protein	NA	A0A1P8BMS4	Lactococcus_phage	26.3	2.8e-09
WP_050899561.1|1433708_1435271_+	hypothetical protein	NA	V5US55	Enterococcus_phage	30.5	6.9e-30
WP_081478598.1|1435736_1436147_+	hypothetical protein	NA	D6PSV8	Lactobacillus_phage	34.6	6.6e-09
WP_014215087.1|1436162_1436372_+	hypothetical protein	NA	D7RWL9	Brochothrix_phage	43.1	6.6e-05
WP_041534578.1|1436361_1436574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041534579.1|1436573_1436918_+|head	phage head closure protein	head	A0A2P0ZLF0	Lactobacillus_phage	29.4	3.1e-07
WP_014215090.1|1436917_1437295_+	HNH endonuclease	NA	A0A1J0MFT4	Staphylococcus_phage	38.5	4.4e-15
WP_156681833.1|1437484_1437952_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JH50	uncultured_Caudovirales_phage	29.1	5.4e-07
WP_014215092.1|1437948_1439658_+|terminase	terminase large subunit	terminase	E9LUI0	Lactobacillus_phage	41.1	4.7e-117
WP_056971116.1|1439812_1440949_+|portal	phage portal protein	portal	A0A2H4J8V4	uncultured_Caudovirales_phage	35.9	2.8e-49
WP_041534581.1|1440920_1442435_+|capsid	phage major capsid protein	capsid	A0A060AI54	Enterococcus_phage	35.2	9.6e-37
1443427:1443447	attR	ACTTAGTCAAAAACTTAGTCA	NA	NA	NA	NA
>prophage 4
NZ_CP014936	Pediococcus claussenii strain TMW 2.54 chromosome, complete genome	1886832	1732254	1767027	1886832	portal,head,terminase,tail,capsid,protease	Lactobacillus_phage(66.67%)	47	NA	NA
WP_065868822.1|1732254_1732689_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0M7RF74	Lactobacillus_phage	31.2	3.3e-06
WP_065868823.1|1732697_1733042_-	helix-turn-helix transcriptional regulator	NA	A0A097QQ00	Enterococcus_phage	42.5	1.1e-17
WP_065868824.1|1733302_1733491_+	hypothetical protein	NA	A0A2P0ZL97	Lactobacillus_phage	48.4	4.4e-08
WP_065868825.1|1733508_1733961_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065868826.1|1733990_1734200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065868827.1|1734185_1734587_-	DUF2513 domain-containing protein	NA	A0A2H4J4K9	uncultured_Caudovirales_phage	35.7	6.1e-15
WP_065868828.1|1734644_1735337_+	hypothetical protein	NA	A0A1C9LX27	Streptococcus_phage	41.5	6.3e-36
WP_156768837.1|1735377_1735518_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065868829.1|1735514_1735709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065868830.1|1735776_1736109_+	DUF771 domain-containing protein	NA	NA	NA	NA	NA
WP_065868831.1|1736200_1736407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065868832.1|1736369_1736864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156768840.1|1736954_1738022_+	N-6 DNA methylase	NA	B8R693	Lactobacillus_phage	51.1	1.6e-99
WP_065868833.1|1738200_1738662_+	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_065868834.1|1738658_1739396_+	AAA family ATPase	NA	B4XYS4	Lactobacillus_phage	56.8	9.6e-67
WP_065868835.1|1739395_1739914_+	DUF669 domain-containing protein	NA	A0A1P8VVN0	Streptococcus_phage	47.7	1.0e-30
WP_065868836.1|1739932_1740730_+	hypothetical protein	NA	A0A0N7IRA7	Lactobacillus_phage	59.2	1.0e-37
WP_065868837.1|1740719_1741964_+	DNA helicase	NA	A0A2D1GP91	Lactobacillus_phage	35.6	1.3e-63
WP_065868838.1|1741960_1742374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065868839.1|1742366_1742768_+	RusA family crossover junction endodeoxyribonuclease	NA	A8YQM5	Lactobacillus_phage	44.1	4.9e-25
WP_065868840.1|1742779_1743016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065868841.1|1743018_1743330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065868842.1|1743341_1743683_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_065868843.1|1743685_1743883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156768838.1|1743879_1744026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065868844.1|1744136_1744598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065868845.1|1744823_1745219_+	hypothetical protein	NA	A0A2H4JEJ9	uncultured_Caudovirales_phage	32.0	7.8e-07
WP_065868846.1|1745377_1746064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065868847.1|1746139_1746526_-	hypothetical protein	NA	A0A0N9RRE8	Paenibacillus_phage	33.8	3.9e-11
WP_065868848.1|1746567_1746756_-	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_065868849.1|1746862_1747363_+	HNH endonuclease	NA	E9LUP7	Lactobacillus_phage	52.0	4.0e-40
WP_065868850.1|1747553_1747997_+|terminase	phage terminase small subunit P27 family	terminase	Q5K5J8	Oenococcus_phage	53.2	3.5e-32
WP_065868851.1|1747996_1749877_+|terminase	terminase large subunit	terminase	E9LUP9	Lactobacillus_phage	71.9	1.1e-271
WP_083195953.1|1749877_1750054_+	DUF1056 family protein	NA	NA	NA	NA	NA
WP_065868852.1|1750056_1751223_+|portal	phage portal protein	portal	E9LUQ1	Lactobacillus_phage	63.7	3.3e-138
WP_065868853.1|1751200_1751920_+|protease	Clp protease ClpP	protease	E9LUQ2	Lactobacillus_phage	63.9	3.1e-78
WP_065868854.1|1751919_1753134_+|capsid	phage major capsid protein	capsid	E9LUQ3	Lactobacillus_phage	70.4	2.7e-159
WP_065868855.1|1753152_1753491_+|head,tail	phage gp6-like head-tail connector protein	head,tail	E9LUQ4	Lactobacillus_phage	50.4	3.8e-18
WP_065868856.1|1753477_1753831_+|head	phage head closure protein	head	E9LUQ5	Lactobacillus_phage	44.7	3.6e-19
WP_065868857.1|1753823_1754270_+	hypothetical protein	NA	E9LUQ6	Lactobacillus_phage	41.1	4.1e-20
WP_065868858.1|1754274_1754646_+	DUF806 family protein	NA	E9LUQ7	Lactobacillus_phage	36.0	2.8e-14
WP_065868859.1|1754647_1755283_+	hypothetical protein	NA	Q3L0S7	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	40.1	9.3e-26
WP_065868860.1|1755358_1755739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083195954.1|1755771_1755975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065868861.1|1755975_1761885_+	tape measure protein	NA	A0A0A7DMV4	Lactobacillus_phage	47.1	5.4e-128
WP_065868862.1|1761895_1763647_+	hypothetical protein	NA	A0A059T682	Listeria_phage	26.9	2.8e-40
WP_065868863.1|1763658_1767027_+	hypothetical protein	NA	A0A2K9V592	Lactobacillus_phage	30.3	1.4e-72
>prophage 5
NZ_CP014936	Pediococcus claussenii strain TMW 2.54 chromosome, complete genome	1886832	1799701	1811746	1886832	tRNA	Staphylococcus_phage(33.33%)	13	NA	NA
WP_014215377.1|1799701_1800178_+	nucleoside deoxyribosyltransferase	NA	A0A1G5S9Z4	Enterococcus_phage	38.2	2.9e-16
WP_014215378.1|1800258_1801137_-	YitT family protein	NA	M1Q1P6	Streptococcus_phage	41.4	3.3e-58
WP_041534608.1|1801248_1802451_+|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	34.6	8.1e-47
WP_014215380.1|1802452_1804327_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	30.4	5.3e-53
WP_014215381.1|1804339_1805290_+	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	60.8	3.2e-115
WP_014215382.1|1805302_1805785_+	dihydrofolate reductase	NA	A0A0N9S8H6	Staphylococcus_phage	38.8	2.5e-23
WP_014215383.1|1805857_1806703_+	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	32.8	9.8e-15
WP_014215384.1|1806771_1806993_+	YozE family protein	NA	NA	NA	NA	NA
WP_014215385.1|1806998_1808411_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	30.3	9.0e-21
WP_014215386.1|1808581_1809484_+	lipase/acylhydrolase	NA	NA	NA	NA	NA
WP_014215387.1|1809486_1810098_+	YpmS family protein	NA	NA	NA	NA	NA
WP_014215388.1|1810140_1811007_+	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
WP_014215389.1|1810987_1811746_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	39.2	9.4e-25
>prophage 1
NZ_CP014937	Pediococcus claussenii strain TMW 2.54 plasmid pL254-1, complete sequence	37848	0	4843	37848	transposase	Enterococcus_phage(100.0%)	5	NA	NA
WP_003561820.1|678_1557_-|transposase	IS982-like element ISLpl4 family transposase	transposase	NA	NA	NA	NA
WP_056992669.1|1681_2476_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003561820.1|2649_3528_+|transposase	IS982-like element ISLpl4 family transposase	transposase	NA	NA	NA	NA
WP_003649837.1|3835_4051_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017866972.1|4057_4843_-	AAA family ATPase	NA	F0PIG8	Enterococcus_phage	35.6	2.0e-30
>prophage 2
NZ_CP014937	Pediococcus claussenii strain TMW 2.54 plasmid pL254-1, complete sequence	37848	15815	28826	37848	holin,transposase	Bacillus_phage(25.0%)	13	NA	NA
WP_003593323.1|15815_16763_-	glycosyltransferase family 2 protein	NA	I1TED8	Salmonella_phage	37.2	1.4e-46
WP_003593325.1|16744_17416_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_065868900.1|17405_18056_-	cytochrome O ubiquinol oxidase	NA	NA	NA	NA	NA
WP_065868901.1|18272_19631_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	28.0	2.0e-17
WP_003580213.1|19640_20336_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.7	8.3e-36
WP_003581777.1|20503_21427_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	8.7e-33
WP_065868902.1|21538_23377_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	28.9	2.6e-68
WP_024855727.1|23650_24580_-|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW47	unidentified_phage	34.4	3.0e-25
WP_076619057.1|25152_25314_+	LtrC-like protein	NA	NA	NA	NA	NA
WP_057808145.1|25483_26731_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	30.2	1.0e-39
WP_016511417.1|26910_27015_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_024855730.1|27357_28134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065868903.1|28241_28826_+	recombinase family protein	NA	M4QQC6	Vibrio_phage	42.4	5.9e-19
>prophage 3
NZ_CP014937	Pediococcus claussenii strain TMW 2.54 plasmid pL254-1, complete sequence	37848	31933	37049	37848	transposase	Lactobacillus_phage(50.0%)	5	NA	NA
WP_119782930.1|31933_32467_-|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	98.1	1.5e-85
WP_016374491.1|32598_32724_-|transposase	IS3 family transposase	transposase	Q6J1X3	Lactobacillus_phage	92.7	1.4e-15
WP_133278329.1|32825_34187_+	MFS transporter	NA	NA	NA	NA	NA
WP_065868904.1|34326_35010_+|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	51.8	2.1e-60
WP_065868907.1|35684_37049_+	NAD(FAD)-dependent dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	22.9	5.3e-10
