The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP014933	Pediococcus claussenii strain TMW 2.53 chromosome, complete genome	1889038	587722	595823	1889038		Bacillus_phage(33.33%)	8	NA	NA
WP_014216054.1|587722_589054_+	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	25.4	1.3e-26
WP_014216055.1|589110_589443_-	AzlD domain-containing protein	NA	NA	NA	NA	NA
WP_014216056.1|589462_590248_-	branched-chain amino acid ABC transporter	NA	NA	NA	NA	NA
WP_014216057.1|590367_591669_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	27.8	7.8e-11
WP_014216058.1|591815_592940_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	29.7	8.4e-30
WP_014216059.1|593187_593877_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	8.2e-36
WP_014216060.1|593962_594460_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	H2EF51	Moumouvirus	34.0	1.2e-15
WP_014216061.1|594680_595823_-	guanosine monophosphate reductase	NA	A0A1V0SHK8	Klosneuvirus	34.5	3.1e-64
>prophage 2
NZ_CP014933	Pediococcus claussenii strain TMW 2.53 chromosome, complete genome	1889038	1366041	1373775	1889038		Bacillus_phage(33.33%)	8	NA	NA
WP_148265538.1|1366041_1367157_+	peptide chain release factor 2	NA	B5LLF2	Mycobacterium_phage	43.2	8.4e-06
WP_014215020.1|1367169_1367868_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	38.8	2.1e-39
WP_014215021.1|1367848_1369231_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	29.8	2.1e-22
WP_014215022.1|1369498_1370377_+	phosphate ABC transporter substrate-binding protein PstS family protein	NA	H6WG65	Cyanophage	30.4	4.9e-09
WP_014215023.1|1370383_1371304_+	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_014215024.1|1371300_1372188_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_014215025.1|1372201_1373002_+	phosphate ABC transporter ATP-binding protein	NA	M1IC18	Acanthocystis_turfacea_Chlorella_virus	31.8	2.4e-07
WP_014215026.1|1373019_1373775_+	phosphate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.1	1.6e-16
>prophage 3
NZ_CP014933	Pediococcus claussenii strain TMW 2.53 chromosome, complete genome	1889038	1413874	1444641	1889038	integrase,capsid,terminase,portal,tRNA,head	Lactobacillus_phage(17.65%)	33	1431831:1431851	1445633:1445653
WP_014215062.1|1413874_1414345_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_014215063.1|1414337_1414829_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_014215064.1|1414821_1415358_-	exonuclease	NA	M1PFD8	Streptococcus_phage	43.3	3.9e-25
WP_014215065.1|1415435_1416347_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_014215066.1|1416379_1417279_+	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_014215067.1|1417523_1418375_+	TIGR00159 family protein	NA	NA	NA	NA	NA
WP_014215068.1|1418371_1419169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014215069.1|1419197_1420559_+	phosphoglucosamine mutase	NA	A0A127AWJ1	Bacillus_phage	27.4	8.1e-19
WP_014215070.1|1420767_1422582_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	36.8	1.2e-94
WP_014215071.1|1422841_1423156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014215072.1|1423233_1423614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148265539.1|1423796_1424141_+	metalloregulator ArsR/SmtB family transcription factor	NA	NA	NA	NA	NA
WP_014215074.1|1424152_1425829_+	oleate hydratase	NA	NA	NA	NA	NA
WP_014215075.1|1425960_1426806_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_041534573.1|1427122_1428319_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.3	2.8e-15
WP_014215077.1|1428302_1429067_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_041534574.1|1429133_1430084_+	2-hydroxyacid dehydrogenase	NA	M1H9J0	Paramecium_bursaria_Chlorella_virus	33.1	3.8e-31
WP_014215079.1|1430239_1431052_-	LicD family protein	NA	A0A1V0SD50	Indivirus	39.2	1.5e-07
1431831:1431851	attL	ACTTAGTCAAAAACTTAGTCA	NA	NA	NA	NA
WP_014215081.1|1431868_1433020_-|integrase	site-specific integrase	integrase	A0A097PAS9	Streptococcus_pyogenes_phage	36.9	1.3e-54
WP_014215082.1|1433219_1434038_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014215083.1|1434380_1434650_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_041534576.1|1434889_1435126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014215084.1|1435094_1435958_+	Bifunctional DNA primase/polymerase, phage related protein	NA	A0A1P8BMS4	Lactococcus_phage	26.3	2.8e-09
WP_050899561.1|1435914_1437477_+	hypothetical protein	NA	V5US55	Enterococcus_phage	30.5	6.9e-30
WP_081478598.1|1437942_1438353_+	hypothetical protein	NA	D6PSV8	Lactobacillus_phage	34.6	6.6e-09
WP_014215087.1|1438368_1438578_+	hypothetical protein	NA	D7RWL9	Brochothrix_phage	43.1	6.6e-05
WP_041534578.1|1438567_1438780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041534579.1|1438779_1439124_+|head	phage head closure protein	head	A0A2P0ZLF0	Lactobacillus_phage	29.4	3.1e-07
WP_014215090.1|1439123_1439501_+	HNH endonuclease	NA	A0A1J0MFT4	Staphylococcus_phage	38.5	4.4e-15
WP_156681833.1|1439690_1440158_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JH50	uncultured_Caudovirales_phage	29.1	5.4e-07
WP_014215092.1|1440154_1441864_+|terminase	terminase large subunit	terminase	E9LUI0	Lactobacillus_phage	41.1	4.7e-117
WP_056971116.1|1442018_1443155_+|portal	phage portal protein	portal	A0A2H4J8V4	uncultured_Caudovirales_phage	35.9	2.8e-49
WP_041534581.1|1443126_1444641_+|capsid	phage major capsid protein	capsid	A0A060AI54	Enterococcus_phage	35.2	9.6e-37
1445633:1445653	attR	ACTTAGTCAAAAACTTAGTCA	NA	NA	NA	NA
>prophage 4
NZ_CP014933	Pediococcus claussenii strain TMW 2.53 chromosome, complete genome	1889038	1734459	1769232	1889038	capsid,terminase,portal,protease,tail,head	Lactobacillus_phage(66.67%)	47	NA	NA
WP_065868822.1|1734459_1734894_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0M7RF74	Lactobacillus_phage	31.2	3.3e-06
WP_065868823.1|1734902_1735247_-	helix-turn-helix transcriptional regulator	NA	A0A097QQ00	Enterococcus_phage	42.5	1.1e-17
WP_065868824.1|1735507_1735696_+	hypothetical protein	NA	A0A2P0ZL97	Lactobacillus_phage	48.4	4.4e-08
WP_065868825.1|1735713_1736166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065868826.1|1736195_1736405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065868827.1|1736390_1736792_-	DUF2513 domain-containing protein	NA	A0A2H4J4K9	uncultured_Caudovirales_phage	35.7	6.1e-15
WP_065868828.1|1736849_1737542_+	hypothetical protein	NA	A0A1C9LX27	Streptococcus_phage	41.5	6.3e-36
WP_156768837.1|1737582_1737723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065868829.1|1737719_1737914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065868830.1|1737981_1738314_+	DUF771 domain-containing protein	NA	NA	NA	NA	NA
WP_065868831.1|1738405_1738612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065868832.1|1738574_1739069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156768840.1|1739159_1740227_+	N-6 DNA methylase	NA	B8R693	Lactobacillus_phage	51.1	1.6e-99
WP_065868833.1|1740405_1740867_+	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_065868834.1|1740863_1741601_+	AAA family ATPase	NA	B4XYS4	Lactobacillus_phage	56.8	9.6e-67
WP_065868835.1|1741600_1742119_+	DUF669 domain-containing protein	NA	A0A1P8VVN0	Streptococcus_phage	47.7	1.0e-30
WP_065868836.1|1742137_1742935_+	hypothetical protein	NA	A0A0N7IRA7	Lactobacillus_phage	59.2	1.0e-37
WP_065868837.1|1742924_1744169_+	DNA helicase	NA	A0A2D1GP91	Lactobacillus_phage	35.6	1.3e-63
WP_065868838.1|1744165_1744579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065868839.1|1744571_1744973_+	RusA family crossover junction endodeoxyribonuclease	NA	A8YQM5	Lactobacillus_phage	44.1	4.9e-25
WP_065868840.1|1744984_1745221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065868841.1|1745223_1745535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065868842.1|1745546_1745888_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_065868843.1|1745890_1746088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156768838.1|1746084_1746231_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065868844.1|1746341_1746803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065868845.1|1747028_1747424_+	hypothetical protein	NA	A0A2H4JEJ9	uncultured_Caudovirales_phage	32.0	7.8e-07
WP_065868846.1|1747582_1748269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065868847.1|1748344_1748731_-	hypothetical protein	NA	A0A0N9RRE8	Paenibacillus_phage	33.8	3.9e-11
WP_065868848.1|1748772_1748961_-	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_065868849.1|1749067_1749568_+	HNH endonuclease	NA	E9LUP7	Lactobacillus_phage	52.0	4.0e-40
WP_065868850.1|1749758_1750202_+|terminase	phage terminase small subunit P27 family	terminase	Q5K5J8	Oenococcus_phage	53.2	3.5e-32
WP_065868851.1|1750201_1752082_+|terminase	terminase large subunit	terminase	E9LUP9	Lactobacillus_phage	71.9	1.1e-271
WP_083195953.1|1752082_1752259_+	DUF1056 family protein	NA	NA	NA	NA	NA
WP_065868852.1|1752261_1753428_+|portal	phage portal protein	portal	E9LUQ1	Lactobacillus_phage	63.7	3.3e-138
WP_065868853.1|1753405_1754125_+|protease	Clp protease ClpP	protease	E9LUQ2	Lactobacillus_phage	63.9	3.1e-78
WP_065868854.1|1754124_1755339_+|capsid	phage major capsid protein	capsid	E9LUQ3	Lactobacillus_phage	70.4	2.7e-159
WP_065868855.1|1755357_1755696_+|head,tail	phage gp6-like head-tail connector protein	head,tail	E9LUQ4	Lactobacillus_phage	50.4	3.8e-18
WP_065868856.1|1755682_1756036_+|head	phage head closure protein	head	E9LUQ5	Lactobacillus_phage	44.7	3.6e-19
WP_065868857.1|1756028_1756475_+	hypothetical protein	NA	E9LUQ6	Lactobacillus_phage	41.1	4.1e-20
WP_065868858.1|1756479_1756851_+	DUF806 family protein	NA	E9LUQ7	Lactobacillus_phage	36.0	2.8e-14
WP_065868859.1|1756852_1757488_+	hypothetical protein	NA	Q3L0S7	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	40.1	9.3e-26
WP_065868860.1|1757563_1757944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083195954.1|1757976_1758180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065868861.1|1758180_1764090_+	tape measure protein	NA	A0A0A7DMV4	Lactobacillus_phage	47.1	5.4e-128
WP_065868862.1|1764100_1765852_+	hypothetical protein	NA	A0A059T682	Listeria_phage	26.9	2.8e-40
WP_065868863.1|1765863_1769232_+	hypothetical protein	NA	A0A2K9V592	Lactobacillus_phage	30.3	1.4e-72
>prophage 5
NZ_CP014933	Pediococcus claussenii strain TMW 2.53 chromosome, complete genome	1889038	1801906	1813951	1889038	tRNA	Staphylococcus_phage(33.33%)	13	NA	NA
WP_014215377.1|1801906_1802383_+	nucleoside deoxyribosyltransferase	NA	A0A1G5S9Z4	Enterococcus_phage	38.2	2.9e-16
WP_014215378.1|1802463_1803342_-	YitT family protein	NA	M1Q1P6	Streptococcus_phage	41.4	3.3e-58
WP_041534608.1|1803453_1804656_+|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	34.6	8.1e-47
WP_014215380.1|1804657_1806532_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	30.4	5.3e-53
WP_014215381.1|1806544_1807495_+	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	60.8	3.2e-115
WP_014215382.1|1807507_1807990_+	dihydrofolate reductase	NA	A0A0N9S8H6	Staphylococcus_phage	38.8	2.5e-23
WP_014215383.1|1808062_1808908_+	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	32.8	9.8e-15
WP_014215384.1|1808976_1809198_+	YozE family protein	NA	NA	NA	NA	NA
WP_014215385.1|1809203_1810616_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	30.3	9.0e-21
WP_014215386.1|1810786_1811689_+	lipase/acylhydrolase	NA	NA	NA	NA	NA
WP_014215387.1|1811691_1812303_+	YpmS family protein	NA	NA	NA	NA	NA
WP_014215388.1|1812345_1813212_+	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
WP_014215389.1|1813192_1813951_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	39.2	9.4e-25
>prophage 1
NZ_CP014934	Pediococcus claussenii strain TMW 2.53 plasmid pL253-1, complete sequence	37848	0	4842	37848	transposase	Enterococcus_phage(100.0%)	5	NA	NA
WP_003561820.1|677_1556_-|transposase	IS982-like element ISLpl4 family transposase	transposase	NA	NA	NA	NA
WP_056992669.1|1680_2475_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003561820.1|2648_3527_+|transposase	IS982-like element ISLpl4 family transposase	transposase	NA	NA	NA	NA
WP_003649837.1|3834_4050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017866972.1|4056_4842_-	AAA family ATPase	NA	F0PIG8	Enterococcus_phage	35.6	2.0e-30
>prophage 2
NZ_CP014934	Pediococcus claussenii strain TMW 2.53 plasmid pL253-1, complete sequence	37848	15814	28825	37848	holin,transposase	Bacillus_phage(25.0%)	13	NA	NA
WP_003593323.1|15814_16762_-	glycosyltransferase family 2 protein	NA	I1TED8	Salmonella_phage	37.2	1.4e-46
WP_003593325.1|16743_17415_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_065868900.1|17404_18055_-	cytochrome O ubiquinol oxidase	NA	NA	NA	NA	NA
WP_065868901.1|18271_19630_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	28.0	2.0e-17
WP_003580213.1|19639_20335_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.7	8.3e-36
WP_003581777.1|20502_21426_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	8.7e-33
WP_065868902.1|21537_23376_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	28.9	2.6e-68
WP_024855727.1|23649_24579_-|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW47	unidentified_phage	34.4	3.0e-25
WP_076619057.1|25151_25313_+	LtrC-like protein	NA	NA	NA	NA	NA
WP_057808145.1|25482_26730_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	30.2	1.0e-39
WP_016511417.1|26909_27014_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_024855730.1|27356_28133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065868903.1|28240_28825_+	recombinase family protein	NA	M4QQC6	Vibrio_phage	42.4	5.9e-19
>prophage 3
NZ_CP014934	Pediococcus claussenii strain TMW 2.53 plasmid pL253-1, complete sequence	37848	31932	37048	37848	transposase	Lactobacillus_phage(50.0%)	5	NA	NA
WP_119782930.1|31932_32466_-|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	98.1	1.5e-85
WP_016374491.1|32597_32723_-|transposase	IS3 family transposase	transposase	Q6J1X3	Lactobacillus_phage	92.7	1.4e-15
WP_133278329.1|32824_34186_+	MFS transporter	NA	NA	NA	NA	NA
WP_065868904.1|34325_35009_+|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	51.8	2.1e-60
WP_065868907.1|35683_37048_+	NAD(FAD)-dependent dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	22.9	5.3e-10
