The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP016622	Parageobacillus thermoglucosidasius strain Wild Type chromosome, complete genome	3873105	946622	956422	3873105		Synechococcus_phage(50.0%)	9	NA	NA
WP_003253332.1|946622_947918_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	35.2	3.5e-19
WP_042384021.1|947994_948717_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4R1E8	Synechococcus_phage	43.0	9.2e-46
WP_013401753.1|948709_948964_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	A0A0E3FKD5	Synechococcus_phage	38.3	1.9e-06
WP_003253326.1|948960_949647_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_013401752.1|949630_951859_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	42.5	5.3e-169
WP_042384018.1|951834_953247_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.6	8.6e-48
WP_042384016.1|953261_954302_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	44.1	2.0e-70
WP_013401749.1|954298_954868_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	40.2	1.9e-30
WP_042384014.1|954883_956422_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	53.0	3.3e-77
>prophage 2
NZ_CP016622	Parageobacillus thermoglucosidasius strain Wild Type chromosome, complete genome	3873105	1523720	1547817	3873105	integrase,transposase	Brevibacillus_phage(33.33%)	30	1519904:1519919	1555860:1555875
1519904:1519919	attL	TATTCGTACAAAAAAC	NA	NA	NA	NA
WP_052518160.1|1523720_1524035_-|integrase	site-specific integrase	integrase	S5MNZ2	Brevibacillus_phage	66.3	2.3e-25
WP_052518158.1|1524018_1524942_-|integrase	tyrosine-type recombinase/integrase	integrase	S5MNZ2	Brevibacillus_phage	37.6	3.2e-43
WP_042383584.1|1526245_1526431_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155267339.1|1526540_1526717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042383583.1|1526784_1526994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042383582.1|1526971_1527211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155267338.1|1527667_1527811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042383580.1|1528153_1528621_+	hypothetical protein	NA	A0A0N6W8H7	Bacillus_phage	53.5	1.1e-36
WP_072000104.1|1528781_1529156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042383579.1|1529363_1529555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042383578.1|1529579_1530008_+	ArpU family transcriptional regulator	NA	S6AVV9	Thermus_phage	65.2	1.6e-45
WP_042383572.1|1531637_1532030_-	helix-turn-helix domain containing protein	NA	NA	NA	NA	NA
WP_045844641.1|1532210_1533449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042383568.1|1534031_1535309_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_042383567.1|1535852_1536461_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_042383719.1|1536611_1537199_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_052518154.1|1537218_1537953_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_052518151.1|1537946_1538438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042383566.1|1538439_1539699_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_125010315.1|1539941_1540364_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155267337.1|1540471_1540612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003252231.1|1540673_1540913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042383563.1|1540955_1541315_-	response regulator	NA	NA	NA	NA	NA
WP_003252226.1|1541896_1542409_+	DUF3231 family protein	NA	NA	NA	NA	NA
WP_003250680.1|1542785_1544021_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	62.3	3.4e-141
WP_045844660.1|1544157_1544556_-	hypothetical protein	NA	Q4ZD55	Staphylococcus_phage	36.7	9.6e-05
WP_035502272.1|1544764_1545025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042384991.1|1545361_1546282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003252218.1|1546902_1547391_+	DUF1648 domain-containing protein	NA	NA	NA	NA	NA
WP_080561277.1|1547679_1547817_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
1555860:1555875	attR	GTTTTTTGTACGAATA	NA	NA	NA	NA
>prophage 3
NZ_CP016622	Parageobacillus thermoglucosidasius strain Wild Type chromosome, complete genome	3873105	3186145	3196952	3873105		Pandoravirus(25.0%)	13	NA	NA
WP_003249589.1|3186145_3187165_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	41.7	8.6e-66
WP_042384049.1|3187157_3188684_-	anthranilate synthase component I	NA	A0A0B5J984	Pandoravirus	29.8	1.0e-30
WP_042384172.1|3188868_3189273_-	chorismate mutase	NA	NA	NA	NA	NA
WP_013876725.1|3189281_3190385_-	3-dehydroquinate synthase	NA	E5ERI4	Ostreococcus_lucimarinus_virus	24.6	4.1e-21
WP_013876724.1|3190384_3191551_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	36.7	1.8e-43
WP_013400511.1|3191669_3192443_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_003249570.1|3192571_3193018_-	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	45.8	1.4e-28
WP_013400510.1|3193117_3194083_-	heptaprenyl diphosphate synthase component II	NA	A0A1V0SE37	Indivirus	24.4	7.8e-08
WP_013400509.1|3194097_3194802_-	demethylmenaquinone methyltransferase	NA	NA	NA	NA	NA
WP_003249566.1|3194806_3195622_-	heptaprenyl diphosphate synthase component 1	NA	NA	NA	NA	NA
WP_003249564.1|3195712_3195937_-	trp RNA-binding attenuation protein MtrB	NA	NA	NA	NA	NA
WP_013400508.1|3195971_3196538_-	GTP cyclohydrolase I FolE	NA	E7DN69	Pneumococcus_phage	55.4	2.2e-50
WP_003249561.1|3196679_3196952_-	HU family DNA-binding protein	NA	A0A0H3UZA0	Geobacillus_virus	72.2	1.3e-29
>prophage 4
NZ_CP016622	Parageobacillus thermoglucosidasius strain Wild Type chromosome, complete genome	3873105	3259416	3269219	3873105		Staphylococcus_phage(44.44%)	13	NA	NA
WP_042384113.1|3259416_3260556_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	34.2	8.5e-22
WP_042384115.1|3260749_3261661_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	43.1	6.2e-39
WP_052518169.1|3261904_3262216_+	DUF2935 domain-containing protein	NA	A0A2I2L551	Orpheovirus	41.7	7.5e-13
WP_003249427.1|3262259_3262751_-	YpuI family protein	NA	NA	NA	NA	NA
WP_003249426.1|3262774_3263194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003249425.1|3263257_3263848_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	39.2	3.9e-18
WP_013876685.1|3263834_3264605_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	42.1	3.9e-10
WP_003249423.1|3264721_3265237_+	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_003249422.1|3265249_3265597_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_042384118.1|3265716_3266184_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	63.5	4.2e-44
WP_042384121.1|3266256_3267450_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	53.8	1.6e-116
WP_042384123.1|3267470_3268118_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	48.8	1.3e-43
WP_003249415.1|3268133_3269219_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	37.5	7.0e-58
>prophage 5
NZ_CP016622	Parageobacillus thermoglucosidasius strain Wild Type chromosome, complete genome	3873105	3771272	3779683	3873105	holin	Staphylococcus_phage(57.14%)	12	NA	NA
WP_003248519.1|3771272_3772859_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	63.8	9.9e-194
WP_003248518.1|3772887_3773130_-	DUF2584 domain-containing protein	NA	NA	NA	NA	NA
WP_003248515.1|3773159_3773948_-	S9 family peptidase	NA	A0A2H4PQM6	Staphylococcus_phage	39.4	7.9e-35
WP_003248509.1|3774048_3775047_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003248508.1|3775065_3775839_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.9	1.3e-34
WP_013400212.1|3775822_3776632_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_013400211.1|3776646_3777108_-	nucleoside triphosphatase YtkD	NA	A0A2H4PQM4	Staphylococcus_phage	36.0	1.4e-18
WP_003248503.1|3777202_3777526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013400210.1|3777599_3777995_-|holin	phage holin family protein	holin	A0A0N7GFE6	Paenibacillus_phage	47.5	1.7e-25
WP_003248499.1|3778119_3778560_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	76.0	2.2e-58
WP_003248497.1|3778812_3779286_-	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_013400209.1|3779452_3779683_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	65.8	4.5e-23
>prophage 1
NZ_CP016623	Parageobacillus thermoglucosidasius strain Wild Type plasmid pNCI001, complete sequence	83925	33012	81358	83925	transposase,bacteriocin,integrase	uncultured_virus(27.27%)	42	34824:34845	62271:62292
WP_008880572.1|33012_34182_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	35.6	5.3e-27
34824:34845	attL	AAGAAATAAACGTTGGTTGATT	NA	NA	NA	NA
WP_013401939.1|35035_35323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013401940.1|35306_36104_-	ParA family protein	NA	A0A0K2FLP4	Brevibacillus_phage	48.5	1.8e-66
WP_042385971.1|36346_37750_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_042385973.1|37967_39083_+	DUF917 domain-containing protein	NA	NA	NA	NA	NA
WP_042385974.1|39086_40478_+	hydantoinase	NA	NA	NA	NA	NA
WP_013401944.1|40551_41868_+	cytosine permease	NA	NA	NA	NA	NA
WP_013401945.1|41884_42982_+	DUF917 domain-containing protein	NA	NA	NA	NA	NA
WP_042385977.1|42978_44538_+	hydantoinase/oxoprolinase family protein	NA	NA	NA	NA	NA
WP_013401947.1|44799_45330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013401948.1|45474_45696_+	DUF1659 domain-containing protein	NA	NA	NA	NA	NA
WP_013401949.1|45710_45923_+	DUF2922 domain-containing protein	NA	NA	NA	NA	NA
WP_013401950.1|45975_46125_+	YvrJ family protein	NA	NA	NA	NA	NA
WP_013878200.1|46143_46623_+	M15 family metallopeptidase	NA	A0A0H3V0Q8	Geobacillus_virus	55.3	7.4e-44
WP_042385980.1|47229_47799_+|integrase	site-specific integrase	integrase	A0A1B1P7Y2	Bacillus_phage	46.8	9.2e-33
WP_042385981.1|48996_50157_+	replication initiation protein	NA	A0A218MNI2	uncultured_virus	25.8	1.4e-08
WP_042385984.1|50422_50665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042385990.1|51208_52123_+	catechol 2,3-dioxygenase	NA	NA	NA	NA	NA
WP_042385992.1|52158_52365_+	4-oxalocrotonate tautomerase family protein	NA	NA	NA	NA	NA
WP_042385995.1|52543_53746_+	flavin-dependent monooxygenase	NA	NA	NA	NA	NA
WP_042386002.1|53907_54393_+	flavin reductase family protein	NA	NA	NA	NA	NA
WP_042386008.1|54608_54911_+	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	NA	NA	NA	NA
WP_042386010.1|54922_56851_+	XylR N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_099092721.1|57190_57982_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_042386013.1|58021_58906_+	acetaldehyde dehydrogenase (acetylating)	NA	E5EQ71	Micromonas_sp._RCC1109_virus	35.0	8.0e-44
WP_042386016.1|58921_59950_+	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	35.9	1.5e-49
WP_042386025.1|59970_60762_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_013401954.1|60825_61506_+	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_013401955.1|63659_64535_-	hypothetical protein	NA	A0A288WFX2	Bacillus_phage	27.9	8.0e-20
62271:62292	attR	AATCAACCAACGTTTATTTCTT	NA	NA	NA	NA
WP_013401956.1|66141_66423_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_013401957.1|66443_66866_+	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
WP_013401958.1|67289_67493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013401959.1|69776_70079_+	DUF2089 family protein	NA	NA	NA	NA	NA
WP_013401960.1|70081_70366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041269328.1|70465_71356_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_013401961.1|71704_71851_-|bacteriocin	aureocin A53 family class IId bacteriocin	bacteriocin	NA	NA	NA	NA
WP_013401962.1|72428_72929_+	PH domain-containing protein	NA	NA	NA	NA	NA
WP_013401963.1|72947_74435_+	PH domain-containing protein	NA	NA	NA	NA	NA
WP_013401964.1|75497_76451_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	36.4	9.9e-40
WP_013401966.1|77640_78039_+	DUF4064 domain-containing protein	NA	NA	NA	NA	NA
WP_065868250.1|78345_79515_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	35.6	9.1e-27
WP_042386297.1|80170_81358_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	28.3	1.1e-27
