The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP010883	Vibrio parahaemolyticus strain CHN25 chromosome 1, complete sequence	3416467	740638	747340	3416467		Staphylococcus_phage(50.0%)	7	NA	NA
WP_005483011.1|740638_741778_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	41.7	1.3e-62
WP_005496257.1|741795_743046_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.9	3.6e-98
WP_005482986.1|743173_743623_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_025625922.1|743630_744755_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	36.0	4.0e-48
WP_005483039.1|744767_745421_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	37.5	1.6e-33
WP_020840184.1|745590_746700_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	39.6	2.0e-63
WP_005440184.1|746869_747340_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	49.3	1.7e-32
>prophage 2
NZ_CP010883	Vibrio parahaemolyticus strain CHN25 chromosome 1, complete sequence	3416467	804961	846755	3416467	plate,tRNA,tail,head	Vibrio_phage(91.11%)	59	NA	NA
WP_005496173.1|804961_805552_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_005496171.1|805703_806648_-	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	36.9	1.1e-43
WP_021484829.1|806676_807549_-	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_015296355.1|807545_808184_-	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_005496164.1|808318_809575_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_005456867.1|809604_810693_+	peptide chain release factor 1	NA	NA	NA	NA	NA
WP_020904133.1|810696_811554_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_005468486.1|811595_811979_+	SirB2 family protein	NA	NA	NA	NA	NA
WP_005481357.1|811984_812794_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_005457350.1|812848_813700_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	41.1	4.4e-47
WP_062853710.1|815212_815659_-	S24 family peptidase	NA	A0A2I7S9A5	Vibrio_phage	87.9	6.6e-71
WP_062853662.1|816120_816378_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	61.4	7.5e-19
WP_062853661.1|816389_818381_+	DDE endonuclease	NA	A0A2I7S9A8	Vibrio_phage	76.1	2.0e-300
WP_065870363.1|818416_819364_+	AAA family ATPase	NA	M4M9P4	Vibrio_phage	86.3	1.4e-150
WP_065870364.1|819372_819612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153993905.1|819615_819768_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065870365.1|819776_820166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065870366.1|820158_820482_+	hypothetical protein	NA	A0A2I7S9B1	Vibrio_phage	48.6	6.6e-20
WP_065870367.1|820492_820696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065870368.1|820697_821333_+	DUF3164 family protein	NA	A0A2D1GNM4	Pseudomonas_phage	42.0	2.2e-43
WP_062853654.1|821345_821618_+	hypothetical protein	NA	M1PJ71	Vibrio_phage	63.6	1.7e-24
WP_065870369.1|821610_821829_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_065870370.1|821821_822055_+	hypothetical protein	NA	M4MCS5	Vibrio_phage	66.2	4.3e-21
WP_065870371.1|822208_822688_+	hypothetical protein	NA	M4MHH2	Vibrio_phage	69.4	1.5e-52
WP_065870372.1|822684_823221_+	hypothetical protein	NA	F6MIJ5	Haemophilus_phage	39.5	2.3e-25
WP_062853649.1|823419_823656_+	hypothetical protein	NA	M4M9N5	Vibrio_phage	57.7	1.8e-19
WP_065871023.1|823661_824009_+	hypothetical protein	NA	A0A2I7RZB2	Vibrio_phage	76.4	7.5e-46
WP_065870373.1|824013_824547_+	regulatory protein GemA	NA	M4MB83	Vibrio_phage	68.0	8.8e-62
WP_065870374.1|824615_825017_+	transcriptional regulator	NA	M4MHG9	Vibrio_phage	77.9	2.3e-54
WP_065870375.1|825103_825670_+	N-acetylmuramidase	NA	A0A2I7S9B9	Vibrio_phage	72.6	1.1e-73
WP_062853644.1|825669_825942_+	hypothetical protein	NA	A0A2I7S9C2	Vibrio_phage	56.5	1.1e-20
WP_062853643.1|825926_826523_+	hypothetical protein	NA	M1NVP4	Vibrio_phage	54.1	1.5e-41
WP_062853642.1|826522_826738_+	TraR/DksA family transcriptional regulator	NA	M4MHG5	Vibrio_phage	68.6	6.1e-22
WP_062853641.1|826737_827043_+	DUF2730 family protein	NA	M4M9P7	Vibrio_phage	42.3	3.6e-12
WP_065870376.1|827051_827345_+	hypothetical protein	NA	A0A2I7S9D8	Vibrio_phage	83.3	1.5e-39
WP_065870377.1|827354_827933_+	DUF3486 family protein	NA	A0A2I7S9D1	Vibrio_phage	74.3	6.0e-72
WP_062853638.1|827932_828124_+	hypothetical protein	NA	M4MB75	Vibrio_phage	57.6	6.0e-13
WP_065870378.1|828244_829807_+	hypothetical protein	NA	M4MHG0	Vibrio_phage	77.3	9.0e-232
WP_065870379.1|829803_831366_+	DUF935 domain-containing protein	NA	M4M9P3	Vibrio_phage	78.8	5.8e-239
WP_065870380.1|831358_832138_+	hypothetical protein	NA	A0A2I7S9F9	Vibrio_phage	80.5	8.7e-127
WP_065870381.1|832440_833400_+	peptidase	NA	A0A2I7S9C6	Vibrio_phage	53.5	6.0e-93
WP_062853633.1|833399_834299_+|head	phage head protein	head	A0A2I7S9D0	Vibrio_phage	79.9	5.2e-139
WP_065870382.1|834377_834635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065870383.1|834637_835177_+	hypothetical protein	NA	M1Q569	Vibrio_phage	63.6	3.6e-55
WP_065870384.1|835204_835795_+	hypothetical protein	NA	M4M9M3	Vibrio_phage	57.0	3.2e-20
WP_065870385.1|835813_836248_+	DUF1320 domain-containing protein	NA	A0A2I7S9E9	Vibrio_phage	88.2	1.9e-67
WP_065870386.1|836247_836790_+	phage virion morphogenesis protein	NA	A0A2I7S9D7	Vibrio_phage	79.9	1.6e-79
WP_065870387.1|836786_837383_+	hypothetical protein	NA	A0A2I7S9D4	Vibrio_phage	75.3	1.8e-84
WP_079879898.1|837414_837633_+	DUF2635 domain-containing protein	NA	A0A2I7S9K4	Vibrio_phage	47.4	6.0e-09
WP_065870389.1|837635_839114_+|tail	phage tail protein	tail	M1Q565	Vibrio_phage	88.4	1.8e-253
WP_065870390.1|839129_839483_+|tail	phage tail protein	tail	A0A2I7S9D5	Vibrio_phage	74.1	3.9e-42
WP_065870391.1|839482_839842_+	hypothetical protein	NA	A0A2I7S9E0	Vibrio_phage	72.0	5.7e-41
WP_079879899.1|840051_841647_+	tape measure protein	NA	A0A2I7S9D9	Vibrio_phage	66.9	2.7e-183
WP_065870392.1|841658_842978_+	multidrug DMT transporter permease	NA	A0A2I7S9E8	Vibrio_phage	75.8	7.7e-192
WP_065870393.1|842970_844065_+|tail	phage tail protein	tail	A0A2I7S9G1	Vibrio_phage	80.4	5.8e-169
WP_065870394.1|844065_844671_+|plate	phage baseplate assembly protein V	plate	A0A2I7S9F6	Vibrio_phage	82.2	2.3e-90
WP_062853623.1|844673_845126_+	hypothetical protein	NA	M4MB61	Vibrio_phage	84.5	1.5e-65
WP_062853622.1|845115_846183_+|plate	baseplate J/gp47 family protein	plate	M4MHE1	Vibrio_phage	82.8	1.3e-168
WP_062853621.1|846167_846755_+	YmfQ family protein	NA	M4M9M8	Vibrio_phage	76.9	3.8e-90
>prophage 3
NZ_CP010883	Vibrio parahaemolyticus strain CHN25 chromosome 1, complete sequence	3416467	1130783	1214557	3416467	head,terminase,integrase,capsid,protease,tRNA,portal,tail	Vibrio_phage(70.45%)	83	1130628:1130650	1166509:1166531
1130628:1130650	attL	ATGTTAAAGCTGATTACTTTCAT	NA	NA	NA	NA
WP_065870448.1|1130783_1131806_-|integrase	tyrosine-type recombinase/integrase	integrase	R9TMQ4	Vibrio_phage	54.7	2.2e-101
WP_065870449.1|1131809_1132337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065870450.1|1132329_1132689_-	STAS-like domain-containing protein	NA	NA	NA	NA	NA
WP_065870451.1|1132675_1133851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065870452.1|1133977_1135564_-	DUF4041 domain-containing protein	NA	A0A142LP25	Marinitoga_camini_virus	63.8	2.8e-79
WP_065870453.1|1135598_1136249_-	phage repressor protein CI	NA	R9TR74	Vibrio_phage	68.2	9.3e-82
WP_045588167.1|1136396_1136609_+	hypothetical protein	NA	R9TMQ7	Vibrio_phage	75.7	1.2e-22
WP_029559289.1|1136720_1137260_+	phage regulatory protein (CII)	NA	U3PIJ8	Vibrio_phage	60.3	1.6e-55
WP_065870454.1|1137269_1137605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065870455.1|1137670_1138183_+	hypothetical protein	NA	U3PB56	Vibrio_phage	50.6	3.0e-27
WP_065870456.1|1138179_1138632_+	DUF3850 domain-containing protein	NA	D2XJW3	Escherichia_phage	44.7	1.4e-07
WP_065870457.1|1138628_1139171_+	DNA methyltransferase	NA	U3PDF3	Vibrio_phage	82.9	1.7e-84
WP_079879902.1|1139269_1141822_+	replication endonuclease	NA	A0A166YHE2	Vibrio_phage	64.3	1.1e-306
WP_065870458.1|1141868_1142273_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141106056.1|1142279_1142549_-	hypothetical protein	NA	A0A2I7R204	Vibrio_phage	70.5	5.7e-09
WP_065870460.1|1142561_1143137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079879903.1|1144002_1144275_+	hypothetical protein	NA	U3PDF9	Vibrio_phage	63.5	5.7e-17
WP_079765352.1|1144276_1144528_-	ogr/Delta-like zinc finger family protein	NA	R9TNQ2	Vibrio_phage	85.5	1.9e-35
WP_065870462.1|1144606_1145635_-|portal	phage portal protein	portal	A0A2I7RNI9	Vibrio_phage	73.8	1.4e-148
WP_065870463.1|1145631_1147407_-|terminase	terminase	terminase	A0A2I7RNI3	Vibrio_phage	90.3	1.1e-307
WP_065870464.1|1147573_1148431_+|capsid	phage capsid protein	capsid	A0A2I7RNH1	Vibrio_phage	61.7	3.8e-91
WP_065870465.1|1148430_1149435_+|capsid	phage major capsid protein, P2 family	capsid	R9TPZ5	Vibrio_phage	62.5	9.0e-108
WP_065870466.1|1149445_1150162_+|terminase	terminase	terminase	A0A2I7RNJ0	Vibrio_phage	84.4	9.6e-104
WP_065870467.1|1150276_1150696_+|head	head completion/stabilization protein	head	A0A2I7RNH7	Vibrio_phage	75.5	1.4e-51
WP_065870468.1|1150692_1151184_+|tail	phage tail protein	tail	A0A2I7RNH2	Vibrio_phage	86.9	1.1e-77
WP_065870469.1|1151167_1151824_+	virion morphogenesis protein	NA	A0A2I7RNI6	Vibrio_phage	82.1	1.9e-98
WP_065870470.1|1151827_1152958_+	DUF2586 family protein	NA	A0A2I7RNI8	Vibrio_phage	84.3	1.8e-181
WP_065870471.1|1152961_1153411_+	DUF2597 family protein	NA	A0A2I7RNI0	Vibrio_phage	95.3	7.4e-78
WP_065302675.1|1153423_1153642_+	molecular chaperone DnaK	NA	A0A2I7RNJ6	Vibrio_phage	72.1	1.2e-22
WP_065870472.1|1153638_1154136_+	hypothetical protein	NA	A0A2I7S7C4	Vibrio_phage	48.1	3.7e-22
WP_065870473.1|1154132_1154363_+	hypothetical protein	NA	W6B371	Vibrio_phage	41.2	1.7e-06
WP_025517570.1|1154365_1154650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047508669.1|1154646_1154910_+	hypothetical protein	NA	A0A1D9C9R9	Salinivibrio_phage	55.3	1.7e-18
WP_158213473.1|1154927_1155092_+	hypothetical protein	NA	Q1I0Y8	Pasteurella_virus	45.3	1.2e-06
WP_065870474.1|1155103_1156990_+|tail	phage tail tape measure protein	tail	A0A1D9C9V3	Salinivibrio_phage	59.5	5.4e-223
WP_031856781.1|1156989_1157331_+	DUF2590 family protein	NA	A0A2I7RNH9	Vibrio_phage	81.8	1.8e-44
WP_065870475.1|1157330_1158518_+	hypothetical protein	NA	A0A2I7RNJ7	Vibrio_phage	82.0	4.1e-192
WP_065870476.1|1158504_1159107_+	hemolysin	NA	A0A2I7RNJ4	Vibrio_phage	85.0	3.7e-101
WP_065870477.1|1159120_1161979_+	hypothetical protein	NA	A0A2I7RNJ3	Vibrio_phage	79.6	1.2e-128
WP_065870478.1|1162138_1162675_+	adenine glycosylase	NA	A0A2I7RNK5	Vibrio_phage	68.0	3.0e-62
WP_065870479.1|1162684_1163374_+	hypothetical protein	NA	A0A2I7RNK1	Vibrio_phage	76.8	1.5e-106
WP_065870480.1|1163364_1164036_+	hypothetical protein	NA	A0A2I7RNK2	Vibrio_phage	73.6	4.5e-95
WP_065870481.1|1164037_1164235_+	hypothetical protein	NA	A0A2I7RNJ8	Vibrio_phage	78.5	3.7e-18
WP_141106055.1|1164909_1166148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005456217.1|1166621_1166786_-	pleiotropic regulatory protein RsmS	NA	NA	NA	NA	NA
1166509:1166531	attR	ATGTTAAAGCTGATTACTTTCAT	NA	NA	NA	NA
WP_065870483.1|1166785_1167331_-	prepilin peptidase	NA	NA	NA	NA	NA
WP_005456200.1|1167327_1168113_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_065870484.1|1168127_1170203_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	25.8	6.9e-46
WP_021449333.1|1170717_1171743_+	porin	NA	NA	NA	NA	NA
WP_020840327.1|1171819_1172497_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_020840328.1|1172609_1173308_-	pseudouridine synthase	NA	NA	NA	NA	NA
WP_025520620.1|1173619_1175845_+	NADP-dependent isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_005456215.1|1175975_1176194_-	cold shock domain-containing protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	56.7	1.2e-14
WP_005456259.1|1176893_1177214_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	46.9	1.1e-14
WP_005495889.1|1177261_1179532_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	43.3	1.7e-167
WP_025520618.1|1179665_1180706_+	serine hydrolase	NA	NA	NA	NA	NA
WP_001040192.1|1180772_1180991_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_024699955.1|1181072_1181774_-	arginyltransferase	NA	NA	NA	NA	NA
WP_065870485.1|1181770_1182481_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_005495881.1|1182520_1182997_+	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_065870486.1|1183158_1184439_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_005495879.1|1184496_1184745_-	YciN family protein	NA	NA	NA	NA	NA
WP_005457230.1|1185209_1187840_+	type I DNA topoisomerase	NA	A0A2P1ELA0	Moumouvirus	34.3	4.3e-85
WP_005457246.1|1188435_1189653_+	glucose-1-phosphate adenylyltransferase	NA	A0A1D7XFC1	Escherichia_phage	28.2	2.2e-07
WP_025515343.1|1189642_1191100_+	glycogen synthase GlgA	NA	NA	NA	NA	NA
WP_005495870.1|1191222_1192026_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_005483105.1|1192067_1192388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025506042.1|1192387_1193080_-	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_005457243.1|1193291_1193882_-	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_005457245.1|1194354_1195359_-	HTH-type transcriptional repressor PurR	NA	NA	NA	NA	NA
WP_020904011.1|1195796_1196444_-	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_005457237.1|1196709_1197423_+	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	31.6	1.3e-23
WP_005457224.1|1197492_1198278_-	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_065871028.1|1198392_1199184_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_005483103.1|1199186_1200524_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_065870487.1|1200504_1201230_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_025543151.1|1201232_1205696_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_005457241.1|1206219_1207188_-	alpha-L-glutamate ligase-like protein	NA	NA	NA	NA	NA
WP_005495851.1|1207191_1208697_-	inactive transglutaminase family protein	NA	NA	NA	NA	NA
WP_005457212.1|1208708_1209455_-|protease	ATP-dependent zinc protease	protease	NA	NA	NA	NA
WP_005483112.1|1209676_1210648_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_024699946.1|1210760_1211498_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	NA	NA	NA	NA
WP_005483110.1|1212778_1214557_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	27.0	5.3e-10
>prophage 4
NZ_CP010883	Vibrio parahaemolyticus strain CHN25 chromosome 1, complete sequence	3416467	1731651	1816821	3416467	head,terminase,integrase,capsid,portal,tRNA,protease,tail	Vibrio_phage(33.33%)	90	1743570:1743586	1760305:1760321
WP_005477636.1|1731651_1732545_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	68.4	4.1e-104
WP_005495023.1|1732638_1733586_-	universal stress protein UspE	NA	NA	NA	NA	NA
WP_005477663.1|1733765_1734512_-	FNR family transcription factor	NA	NA	NA	NA	NA
WP_065871038.1|1734602_1735280_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005457379.1|1735288_1735453_-	cbb3-type cytochrome oxidase assembly protein CcoS	NA	NA	NA	NA	NA
WP_065870651.1|1735467_1737831_-	cadmium-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	30.3	1.1e-76
WP_005495014.1|1737835_1738312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020840623.1|1738417_1739392_-	cytochrome-c oxidase, cbb3-type subunit III	NA	NA	NA	NA	NA
WP_005396487.1|1739391_1739565_-	CcoQ/FixQ family Cbb3-type cytochrome c oxidase assembly chaperone	NA	NA	NA	NA	NA
WP_005457377.1|1739574_1740195_-	cytochrome-c oxidase, cbb3-type subunit II	NA	NA	NA	NA	NA
WP_005477654.1|1740207_1741635_-	cytochrome-c oxidase, cbb3-type subunit I	NA	NA	NA	NA	NA
WP_005457383.1|1741891_1742248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065870655.1|1742361_1743543_+	histidine kinase	NA	NA	NA	NA	NA
WP_065870657.1|1743532_1745263_+	response regulator	NA	A0A1V0SGX0	Hokovirus	31.3	7.8e-43
1743570:1743586	attL	CATTACAAGAAGCGTTA	NA	NA	NA	NA
WP_065870658.1|1745433_1745613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065870659.1|1745806_1746199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065870660.1|1746211_1746454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065870661.1|1746727_1748986_-	AAA family ATPase	NA	A0A0K2FLP8	Brevibacillus_phage	26.9	7.8e-43
WP_065870662.1|1748985_1749411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025796163.1|1749418_1749877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065870663.1|1749873_1752393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065871039.1|1752394_1754002_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_065870664.1|1754012_1755536_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_021448551.1|1756037_1756361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005494983.1|1756473_1756785_-	DUF3634 family protein	NA	NA	NA	NA	NA
WP_005494981.1|1756795_1757245_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_065870665.1|1757455_1759093_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_005390081.1|1759163_1759682_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_005494976.1|1759795_1759969_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_065870666.1|1760140_1761865_-	DUF3466 family protein	NA	NA	NA	NA	NA
1760305:1760321	attR	CATTACAAGAAGCGTTA	NA	NA	NA	NA
WP_005458252.1|1761872_1763792_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	28.8	1.6e-52
WP_011105882.1|1763769_1764012_-	glutaredoxin family protein	NA	NA	NA	NA	NA
WP_005494968.1|1764040_1766164_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_005494967.1|1766660_1767203_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_005458264.1|1767371_1768382_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_065870667.1|1768690_1773532_-	NAD-glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_074534427.1|1773733_1773952_-	DUF2835 domain-containing protein	NA	NA	NA	NA	NA
WP_065870668.1|1774017_1776645_-	aminopeptidase N	NA	NA	NA	NA	NA
WP_029848917.1|1776716_1776953_-	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
WP_065870669.1|1777929_1778445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065870670.1|1778441_1779197_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_065870671.1|1779348_1779795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065870672.1|1779924_1780533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065870673.1|1780593_1781394_-	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
WP_079879852.1|1781544_1781910_-	peptidase M15	NA	A0A2I7RAT1	Vibrio_phage	62.0	1.1e-34
WP_065870674.1|1781918_1782449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005490094.1|1782448_1783456_-	radical SAM protein	NA	NA	NA	NA	NA
WP_065870675.1|1783471_1783846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065870676.1|1783849_1789000_-	hypothetical protein	NA	M4MHT9	Vibrio_phage	29.5	3.9e-98
WP_065870677.1|1789003_1789402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065870678.1|1789404_1789944_-	hypothetical protein	NA	M4MD40	Vibrio_phage	38.7	1.5e-21
WP_029860508.1|1789955_1790537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065870679.1|1790548_1792843_-|tail	phage tail tape measure protein	tail	A0A1J0GVM4	Pseudoalteromonas_phage	24.1	6.1e-11
WP_005490199.1|1792858_1793152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005490240.1|1793196_1793532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005490045.1|1793598_1794054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005490113.1|1794066_1794390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065870680.1|1794437_1795046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029848884.1|1795038_1795383_-|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
WP_065870681.1|1795395_1795944_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2I7S7I1	Vibrio_phage	27.3	2.3e-09
WP_023667249.1|1795959_1797150_-|capsid	phage major capsid protein	capsid	M4MA06	Vibrio_phage	34.3	4.7e-39
WP_005490062.1|1797244_1798093_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2I7S7P2	Vibrio_phage	36.0	1.6e-28
WP_065870682.1|1798055_1799381_-|portal	phage portal protein	portal	M4MHV5	Vibrio_phage	38.8	3.1e-76
WP_023667246.1|1799390_1801151_-|terminase	terminase large subunit	terminase	A0A0K1LKI4	Staphylococcus_phage	35.9	1.1e-81
WP_029860027.1|1801274_1801469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029848887.1|1801478_1801913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079856377.1|1802055_1802466_-|terminase	phage terminase small subunit P27 family	terminase	K7PHI2	Enterobacteria_phage	27.6	7.6e-05
WP_065870683.1|1802554_1802965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005490181.1|1803245_1803437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065870684.1|1803647_1804292_+	antirestriction protein	NA	G0YPX7	Erwinia_phage	31.4	2.9e-11
WP_005490250.1|1804347_1804560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065870685.1|1804659_1805148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079879853.1|1805873_1806287_-	HNH endonuclease	NA	A0A2H4J3B4	uncultured_Caudovirales_phage	32.5	2.9e-12
WP_005490042.1|1806334_1806517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005490248.1|1806555_1806819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065870686.1|1806903_1807755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065870687.1|1807845_1808433_-	deoxynucleoside kinase	NA	A0A1V0S992	Catovirus	28.9	4.3e-09
WP_005490154.1|1808432_1808720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100084493.1|1808719_1808917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029853619.1|1808924_1809518_-	deoxynucleoside kinase	NA	A0A249Y6S3	Cherax_quadricarinatus_iridovirus	28.3	1.6e-08
WP_029848890.1|1809652_1809925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029848891.1|1809921_1810209_-	hypothetical protein	NA	A0A142K9B6	Gordonia_phage	53.7	1.8e-08
WP_005490210.1|1810412_1810634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005490170.1|1810621_1811464_-	exonuclease	NA	F1D0G7	Vibrio_phage	42.4	3.3e-55
WP_065870688.1|1811473_1811761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005490177.1|1811803_1812052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005490208.1|1812035_1812233_-	DUF1382 family protein	NA	NA	NA	NA	NA
WP_005490066.1|1812398_1812830_-	tellurite resistance protein	NA	Q1MVI3	Enterobacteria_phage	47.9	7.2e-30
WP_065870689.1|1813126_1815178_-	DNA polymerase	NA	A0A0F7DD46	Delftia_phage	40.8	5.5e-144
WP_023667234.1|1815177_1816821_-	toprim domain-containing protein	NA	L7TLT7	Rhizobium_phage	48.3	5.2e-121
>prophage 5
NZ_CP010883	Vibrio parahaemolyticus strain CHN25 chromosome 1, complete sequence	3416467	2837028	2854202	3416467	tRNA	uncultured_Mediterranean_phage(18.18%)	15	NA	NA
WP_005455546.1|2837028_2839611_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	37.9	1.0e-78
WP_065870915.1|2839753_2840221_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_005478550.1|2840344_2841388_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	60.7	8.1e-112
WP_065870916.1|2841588_2842071_-	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	48.7	1.7e-27
WP_065870917.1|2842155_2844717_+	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	23.7	1.3e-33
WP_005478537.1|2844796_2845786_-	RNA polymerase sigma factor RpoS	NA	F4YCU2	Synechococcus_phage	35.2	6.9e-36
WP_065870918.1|2845866_2846790_-	peptidoglycan DD-metalloendopeptidase family protein	NA	D7RWE0	Brochothrix_phage	35.2	4.1e-06
WP_005455562.1|2846804_2847431_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	52.1	1.3e-35
WP_021450028.1|2847430_2848207_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	52.4	6.6e-66
WP_021450029.1|2848206_2849250_-|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
WP_005380896.1|2849296_2849773_-	2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase	NA	NA	NA	NA	NA
WP_024702351.1|2849790_2850495_-	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	A0A2H4UTB4	Bodo_saltans_virus	23.6	4.5e-05
WP_005455577.1|2850496_2850778_-	cell division protein FtsB	NA	NA	NA	NA	NA
WP_005455579.1|2851181_2852483_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	59.2	4.2e-134
WP_005455581.1|2852561_2854202_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	52.4	4.2e-155
>prophage 1
NZ_CP010884	Vibrio parahaemolyticus strain CHN25 chromosome 2, complete sequence	1843316	935059	943260	1843316		Vibrio_phage(100.0%)	14	NA	NA
WP_029849354.1|935059_935428_-	hypothetical protein	NA	A0A1W6UGD7	Vibrio_phage	63.6	1.7e-35
WP_065871318.1|935624_935897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025441867.1|935896_936121_+	hypothetical protein	NA	G8IRU4	Vibrio_phage	56.1	9.2e-13
WP_029803951.1|936113_937370_+	replication protein	NA	G8IRU5	Vibrio_phage	62.0	5.0e-148
WP_065871319.1|937375_937702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025441870.1|937698_937944_+	hypothetical protein	NA	R9TMT7	Vibrio_phage	43.9	6.3e-07
WP_065871320.1|937972_938164_+	hypothetical protein	NA	R9TRU5	Vibrio_phage	53.3	3.2e-06
WP_065871321.1|938297_939797_+	chemotaxis protein	NA	NA	NA	NA	NA
WP_025441873.1|939796_940129_+	DUF2523 domain-containing protein	NA	NA	NA	NA	NA
WP_065871322.1|940132_941557_+	toxin	NA	Q64EV0	Vibrio_phage	51.7	1.8e-122
WP_025441875.1|941655_941865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065871323.1|942193_942658_-	hypothetical protein	NA	A0A1W6UFZ4	Vibrio_phage	43.7	4.4e-33
WP_065871324.1|942689_943064_-	phage protein	NA	A0A1W6UG37	Vibrio_phage	91.9	8.9e-61
WP_114139625.1|943020_943260_-	hypothetical protein	NA	A0A1W6UFY8	Vibrio_phage	74.7	3.1e-27
>prophage 1
NZ_CP010885	Vibrio parahaemolyticus strain CHN25 plasmid P1, complete sequence	92495	76708	82627	92495	transposase	Vibrio_phage(50.0%)	7	NA	NA
WP_065871618.1|76708_76963_-	hypothetical protein	NA	A0A2I7S7Y8	Vibrio_phage	63.1	1.2e-24
WP_029792981.1|76979_77474_-	hypothetical protein	NA	A0A067ZG68	Vibrio_phage	40.5	9.7e-23
WP_025443162.1|77499_77751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065871619.1|78326_79307_-	restriction endonuclease	NA	A0A0P0ZG22	Escherichia_phage	42.3	8.9e-68
WP_065871620.1|79436_80948_+	N-6 DNA methylase	NA	A0A2L1IV91	Escherichia_phage	42.3	3.6e-100
WP_114139638.1|81029_82210_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	66.0	6.6e-118
WP_065871622.1|82426_82627_-	hypothetical protein	NA	A0A1J0MDC3	Vibrio_phage	44.6	9.7e-06
