The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP014673	Thermoclostridium stercorarium subsp. leptospartum DSM 9219 chromosome, complete genome	3148357	141463	234717	3148357	tRNA,transposase	Enterobacteria_phage(18.75%)	69	NA	NA
WP_034842267.1|141463_142426_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_065820459.1|142759_145789_+	Ig-like domain-containing protein	NA	NA	NA	NA	NA
WP_083197740.1|146142_146646_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_034842249.1|146671_148006_+	exopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_065820460.1|148105_151219_+	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_065820461.1|151218_152376_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_065820462.1|152377_152995_+	sugar transferase	NA	NA	NA	NA	NA
WP_065820463.1|153017_153548_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_065820464.1|153537_154491_+	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_065820465.1|155279_156257_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_065820466.1|156253_157477_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_065820467.1|157541_158330_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_065820468.1|158359_159328_+	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	36.9	6.2e-13
WP_065820469.1|159320_160505_+	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_065820470.1|160549_161392_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_003511744.1|161545_162616_-|transposase	IS30-like element ISCth3 family transposase	transposase	H7BUM7	unidentified_phage	36.7	6.1e-54
WP_065820472.1|163638_164631_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	52.3	2.5e-94
WP_065820473.1|164720_166559_+	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	32.7	4.0e-29
WP_065820474.1|166651_168175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065820475.1|168470_170753_+	S-layer homology domain-containing protein	NA	NA	NA	NA	NA
WP_015357883.1|170833_173545_-	glycoside hydrolase family 2	NA	NA	NA	NA	NA
WP_015357884.1|173686_173893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015357885.1|174007_175099_-	phosphodiester glycosidase family protein	NA	NA	NA	NA	NA
WP_034836550.1|175162_175648_+	histidine kinase	NA	NA	NA	NA	NA
WP_065820476.1|175666_177238_+	response regulator	NA	NA	NA	NA	NA
WP_015357888.1|177254_177452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015357889.1|177624_178935_+	nucleotide sugar dehydrogenase	NA	NA	NA	NA	NA
WP_015357890.1|178998_179451_+	large-conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_015357891.1|179467_179986_+	antiterminator LoaP	NA	NA	NA	NA	NA
WP_015357892.1|180014_180989_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_065820477.1|180994_182056_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_034836540.1|182080_183364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144050611.1|183431_183791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065820478.1|183987_187710_-	bacterial Ig-like domain-containing protein	NA	NA	NA	NA	NA
WP_065820479.1|188290_189589_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_015357897.1|189858_190173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034836533.1|190169_191030_-	cell wall hydrolase	NA	A0A0K2FM09	Brevibacillus_phage	36.3	2.5e-10
WP_034836530.1|191871_192519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015357901.1|192736_192997_+	DUF3343 domain-containing protein	NA	NA	NA	NA	NA
WP_034836523.1|193323_194106_+	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_015357904.1|194130_195012_+	sulfate adenylyltransferase subunit 2	NA	NA	NA	NA	NA
WP_034836519.1|195070_196885_+	GTP-binding protein	NA	A0A1V0SGC3	Hokovirus	32.2	3.3e-44
WP_015357906.1|196916_197324_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_157882726.1|197326_197512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015357909.1|197919_198675_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_015357910.1|198917_202163_+	SNF2 helicase associated domain-containing protein	NA	A0A2L0WU59	Oxyplax_ochracea_nucleopolyhedrovirus	26.1	1.8e-40
WP_034836513.1|202262_203333_+	peptide chain release factor 1	NA	A0A0S4KWG0	Pseudomonas_phage	47.5	7.8e-09
WP_015357913.1|203497_204349_-	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_015357914.1|204478_204886_-	hemerythrin family protein	NA	NA	NA	NA	NA
WP_157882751.1|207483_208534_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	31.7	5.1e-21
WP_015358103.1|208600_209827_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	30.7	9.2e-14
WP_157882727.1|209794_209938_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054632796.1|210430_211531_+	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_003512473.1|212463_213684_+|transposase	IS256-like element ISCth5 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	49.0	5.6e-96
WP_015358154.1|213920_214361_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_144050590.1|214374_215706_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_065820480.1|215786_216587_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	50.8	9.5e-60
WP_065820481.1|216579_217806_-|transposase	IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	33.2	2.6e-48
WP_144050590.1|217915_219247_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_015358154.1|219260_219701_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_034844281.1|220505_220826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034844279.1|220885_223996_+	DUF499 domain-containing protein	NA	NA	NA	NA	NA
WP_034844278.1|223995_224565_+	DUF3780 domain-containing protein	NA	A0A1P8DTE9	Proteus_phage	42.4	1.1e-30
WP_065820482.1|224579_227471_+	DUF1156 domain-containing protein	NA	NA	NA	NA	NA
WP_157882728.1|227476_228016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065820484.1|228139_230854_+	DEAD/DEAH box helicase family protein	NA	A0A2H4J643	uncultured_Caudovirales_phage	23.6	7.2e-19
WP_083197741.1|231261_231864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157882729.1|231932_232733_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_003512473.1|233496_234717_-|transposase	IS256-like element ISCth5 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	49.0	5.6e-96
>prophage 2
NZ_CP014673	Thermoclostridium stercorarium subsp. leptospartum DSM 9219 chromosome, complete genome	3148357	321574	377281	3148357	protease,tRNA,transposase	unidentified_phage(16.67%)	48	NA	NA
WP_015358002.1|321574_324007_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	40.7	2.2e-131
WP_015358003.1|324230_324665_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_015358004.1|324686_325079_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_015358007.1|325517_326654_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	40.6	3.0e-51
WP_065820502.1|326925_329772_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	59.3	0.0e+00
WP_015358009.1|329786_330203_+	YjbQ family protein	NA	NA	NA	NA	NA
WP_003511744.1|330333_331404_+|transposase	IS30-like element ISCth3 family transposase	transposase	H7BUM7	unidentified_phage	36.7	6.1e-54
WP_015358010.1|331946_332579_+	ECF transporter S component	NA	NA	NA	NA	NA
WP_015358011.1|332611_333109_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_065820503.1|333209_333482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015358013.1|333496_334204_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_015358014.1|334287_334836_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_015358015.1|335081_336044_+	ROK family glucokinase	NA	NA	NA	NA	NA
WP_015358016.1|336057_336858_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_065820504.1|336854_337115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015358018.1|337932_341715_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	27.4	3.8e-42
WP_015358019.1|341729_345269_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	25.6	2.3e-65
WP_034840716.1|345304_345625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015358021.1|345851_346574_+	TraX family protein	NA	NA	NA	NA	NA
WP_015358022.1|346714_348676_+	BMP family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_015358023.1|348672_349260_-	metallophosphoesterase family protein	NA	NA	NA	NA	NA
WP_015358024.1|349343_350222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065820505.1|350239_351532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034840723.1|351855_353127_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_015358027.1|353137_354934_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.8	7.1e-47
WP_015358028.1|354934_356689_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.2	2.5e-57
WP_065820506.1|356968_357862_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_015358030.1|357936_358287_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_015358031.1|358298_358898_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_003512473.1|360128_361349_+|transposase	IS256-like element ISCth5 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	49.0	5.6e-96
WP_065820507.1|362031_362382_+	DsrE family protein	NA	NA	NA	NA	NA
WP_065820508.1|362472_362964_+	copper chaperone Copz family protein	NA	NA	NA	NA	NA
WP_065820509.1|363294_363675_+	DUF1232 domain-containing protein	NA	NA	NA	NA	NA
WP_065820510.1|363690_364416_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_003511744.1|364659_365730_-|transposase	IS30-like element ISCth3 family transposase	transposase	H7BUM7	unidentified_phage	36.7	6.1e-54
WP_065820511.1|366101_366851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065820512.1|366873_367305_+	EamA family transporter	NA	NA	NA	NA	NA
WP_065820513.1|368736_369225_+	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_065820514.1|370201_370870_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_014253531.1|371070_371712_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_065820515.1|371832_372150_+	hypothetical protein	NA	A0A097BYE2	Leuconostoc_phage	51.2	1.3e-17
WP_065820516.1|372410_372671_+	TfoX/Sxy family protein	NA	NA	NA	NA	NA
WP_065820517.1|372766_373210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065820518.1|373363_373975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065820519.1|374035_374506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065820520.1|374524_375139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015358103.1|375340_376567_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	30.7	9.2e-14
WP_015358154.1|376840_377281_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP014673	Thermoclostridium stercorarium subsp. leptospartum DSM 9219 chromosome, complete genome	3148357	842254	893696	3148357	tRNA,transposase,protease	unidentified_phage(16.67%)	38	NA	NA
WP_003511744.1|842254_843325_-|transposase	IS30-like element ISCth3 family transposase	transposase	H7BUM7	unidentified_phage	36.7	6.1e-54
WP_065820479.1|843733_845032_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_015358493.1|845594_846296_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_051492578.1|846437_847547_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_065821178.1|848479_849013_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065820611.1|849541_849916_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_065820612.1|849924_850791_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	32.8	1.1e-24
WP_065820613.1|850798_851404_+	ABC-2 transporter permease	NA	NA	NA	NA	NA
WP_065820615.1|851810_852749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065820616.1|852772_853732_-	ribosomal small subunit Rsm22	NA	NA	NA	NA	NA
WP_015358503.1|854056_854575_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_065820617.1|854576_855644_+	undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase	NA	NA	NA	NA	NA
WP_034842934.1|855753_856227_+	helix-hairpin-helix domain-containing protein	NA	NA	NA	NA	NA
WP_015358506.1|856327_858265_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	34.2	3.2e-117
WP_015358507.1|858365_858620_-	YkuS family protein	NA	NA	NA	NA	NA
WP_015358508.1|858802_859615_-	HAD-IIA family hydrolase	NA	NA	NA	NA	NA
WP_015358509.1|859783_860353_-	glycerol-3-phosphate responsive antiterminator	NA	NA	NA	NA	NA
WP_034842929.1|860494_861037_-	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_015358511.1|861276_862053_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015358512.1|862122_862767_+	bifunctional 2-keto-4-hydroxyglutarate aldolase/2-keto-3-deoxy-6-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_015358513.1|862824_863925_+	sugar kinase	NA	NA	NA	NA	NA
WP_065820619.1|870169_874216_-	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_015484922.1|874202_875279_-	carbamoyl phosphate synthase small subunit	NA	R4TGJ8	Halovirus	36.5	8.8e-53
WP_034838403.1|875324_876731_-	amidophosphoribosyltransferase	NA	A0A1B1ISH6	uncultured_Mediterranean_phage	32.8	7.0e-58
WP_065820479.1|877096_878395_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_015358520.1|878769_879222_+	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_015358519.1|879304_879511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065820479.1|879980_881279_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_065820620.1|881745_883113_+	glycoside hydrolase family 28 protein	NA	NA	NA	NA	NA
WP_015358522.1|883136_884225_+	DUF362 domain-containing protein	NA	NA	NA	NA	NA
WP_015358523.1|884264_884735_-	CYTH domain-containing protein	NA	A0A2I7SAN4	Vibrio_phage	38.0	1.4e-15
WP_065820479.1|884972_886271_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_015358524.1|886633_888310_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_034838387.1|888365_889238_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_015358526.1|889253_890204_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_015358527.1|890596_891691_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015484924.1|891734_892706_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_015358529.1|892700_893696_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 4
NZ_CP014673	Thermoclostridium stercorarium subsp. leptospartum DSM 9219 chromosome, complete genome	3148357	971421	980423	3148357		Bacillus_phage(83.33%)	6	NA	NA
WP_034843652.1|971421_973905_+	EAL domain-containing protein	NA	W8CYM9	Bacillus_phage	29.0	1.5e-07
WP_015358593.1|974121_975870_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.7	1.8e-50
WP_015358594.1|975844_977722_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.5	6.3e-54
WP_015358595.1|977764_978457_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	34.4	4.2e-24
WP_015358596.1|978453_979365_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	25.1	1.2e-18
WP_015358597.1|979499_980423_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	46.3	6.4e-44
>prophage 5
NZ_CP014673	Thermoclostridium stercorarium subsp. leptospartum DSM 9219 chromosome, complete genome	3148357	1283800	1295219	3148357		Bacillus_phage(42.86%)	9	NA	NA
WP_065821183.1|1283800_1284655_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.8	4.4e-55
WP_015358849.1|1284705_1284948_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A0K2CZ86	Paenibacillus_phage	60.0	1.4e-19
WP_015358850.1|1285237_1285825_+	spore maturation protein A	NA	NA	NA	NA	NA
WP_034837886.1|1285827_1286358_+	spore maturation protein	NA	NA	NA	NA	NA
WP_065820702.1|1286486_1287173_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	43.2	5.6e-53
WP_015358853.1|1287172_1288642_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	35.5	3.0e-43
WP_015358854.1|1288707_1289475_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A172JHR8	Bacillus_phage	31.5	3.7e-21
WP_065820703.1|1289834_1291220_+	trypsin-like peptidase domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	30.2	2.7e-22
WP_015358856.1|1291463_1295219_+	phosphoribosylformylglycinamidine synthase	NA	A6N228	Microbacterium_phage	25.8	3.1e-36
>prophage 6
NZ_CP014673	Thermoclostridium stercorarium subsp. leptospartum DSM 9219 chromosome, complete genome	3148357	1299214	1360634	3148357	transposase	Bacillus_phage(23.08%)	52	NA	NA
WP_065820479.1|1299214_1300513_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_065820704.1|1303152_1303515_+	BlaI/MecI/CopY family transcriptional regulator	NA	NA	NA	NA	NA
WP_083197756.1|1303517_1303979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157882736.1|1303926_1304865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065821184.1|1304993_1305428_+	flavodoxin	NA	NA	NA	NA	NA
WP_034837945.1|1305398_1306106_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	39.4	1.8e-38
WP_034837864.1|1306269_1307181_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	42.5	1.5e-40
WP_034837861.1|1307180_1307936_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_065820706.1|1307946_1308678_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_065820707.1|1309281_1311093_+	chitobiase/beta-hexosaminidase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_015358866.1|1311205_1311931_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_065820708.1|1312209_1312689_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_054632594.1|1312693_1314430_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.2	2.2e-45
WP_065820709.1|1314429_1316358_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.4	3.8e-46
WP_015358871.1|1316741_1317113_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_015358872.1|1317270_1318203_+	YesL family protein	NA	NA	NA	NA	NA
WP_034837844.1|1318264_1319020_-	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
WP_015358874.1|1319052_1319931_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_015358875.1|1319936_1320938_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_003511744.1|1321665_1322736_-|transposase	IS30-like element ISCth3 family transposase	transposase	H7BUM7	unidentified_phage	36.7	6.1e-54
WP_015358876.1|1323032_1323386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015358877.1|1323401_1324745_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_034837838.1|1324820_1325066_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_015358879.1|1325140_1325371_+	KH domain-containing protein	NA	NA	NA	NA	NA
WP_015358880.1|1325605_1325932_+	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	42.9	3.1e-17
WP_034837835.1|1326054_1327362_+	amidohydrolase	NA	NA	NA	NA	NA
WP_015358882.1|1327400_1329161_-	fibronectin/fibrinogen-binding protein	NA	A0A1J0F9J4	Only_Syngen_Nebraska_virus	47.1	4.3e-12
WP_015358883.1|1329575_1330379_+	CvpA family protein	NA	NA	NA	NA	NA
WP_065820710.1|1330530_1332492_+	S-layer protein	NA	NA	NA	NA	NA
WP_015358885.1|1332513_1334046_+	S-layer homology domain-containing protein	NA	NA	NA	NA	NA
WP_054632597.1|1334137_1335625_+	S41 family peptidase	NA	NA	NA	NA	NA
WP_015358887.1|1335660_1336818_+	PQQ-binding-like beta-propeller repeat protein	NA	NA	NA	NA	NA
WP_015358888.1|1336882_1337827_+	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_015358889.1|1337843_1338914_+	class I mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_015358890.1|1339036_1339243_+	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_083191807.1|1339393_1340506_+|transposase	IS30-like element ISCth2 family transposase	transposase	H7BWC8	unidentified_phage	52.5	6.1e-89
WP_034844286.1|1340815_1342078_+	sodium ion-translocating decarboxylase subunit beta	NA	NA	NA	NA	NA
WP_015358892.1|1342444_1345288_+	glycoside hydrolase family 3 C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_015358893.1|1345297_1346326_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_015358894.1|1346407_1347175_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_015358896.1|1347546_1349880_-	alpha-xylosidase	NA	NA	NA	NA	NA
WP_015358897.1|1350036_1350903_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_015358898.1|1350938_1351349_+	DUF3842 family protein	NA	NA	NA	NA	NA
WP_015358899.1|1351368_1351971_+	nicotinate-nucleotide adenylyltransferase	NA	G3MA22	Bacillus_virus	29.5	6.7e-18
WP_015358900.1|1351973_1352555_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_015358901.1|1352623_1353235_+	signal peptidase I	NA	NA	NA	NA	NA
WP_065820712.1|1354040_1355270_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	30.7	9.2e-14
WP_003512473.1|1355451_1356672_+|transposase	IS256-like element ISCth5 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	49.0	5.6e-96
WP_015358905.1|1357013_1358081_+	site-specific DNA-methyltransferase	NA	S4VS49	Pandoravirus	35.8	3.2e-31
WP_015484978.1|1358112_1358451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015358907.1|1358447_1359020_-	MjaI family restriction endonuclease	NA	NA	NA	NA	NA
WP_003512473.1|1359413_1360634_+|transposase	IS256-like element ISCth5 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	49.0	5.6e-96
>prophage 7
NZ_CP014673	Thermoclostridium stercorarium subsp. leptospartum DSM 9219 chromosome, complete genome	3148357	1563264	1617901	3148357	coat,integrase,tRNA,transposase,protease	Bacillus_phage(21.43%)	54	1563233:1563257	1616981:1617005
1563233:1563257	attL	TGTAAATTGCAATATTAAATGCCGT	NA	NA	NA	NA
WP_065820772.1|1563264_1564995_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_065820773.1|1565035_1565623_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_065820774.1|1565684_1567547_-	molecular chaperone HtpG	NA	A0A1V0SAD6	Catovirus	26.9	8.7e-56
WP_065820775.1|1567733_1568795_-	flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase	NA	NA	NA	NA	NA
WP_015359104.1|1568796_1570083_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_015359105.1|1570122_1571322_-	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_015359106.1|1571338_1572235_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_015359107.1|1572250_1572991_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	44.4	3.5e-24
WP_015359108.1|1573076_1574615_-	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_015359109.1|1574627_1575149_-	prepilin peptidase	NA	NA	NA	NA	NA
WP_065820776.1|1575132_1576440_-	pilus assembly protein	NA	NA	NA	NA	NA
WP_015359111.1|1576436_1579514_-	viral A-type inclusion repeat-containing protein	NA	NA	NA	NA	NA
WP_065820777.1|1579510_1580188_-	pilus assembly protein	NA	NA	NA	NA	NA
WP_015359113.1|1580184_1580379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065820778.1|1580399_1581275_-	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_015359115.1|1581289_1582063_-	type II secretion system F domain protein	NA	NA	NA	NA	NA
WP_015359116.1|1582254_1583754_-	HAMP domain-containing sensor histidine kinase	NA	W8CYF6	Bacillus_phage	26.8	7.0e-24
WP_015359117.1|1583737_1584424_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	39.2	3.0e-38
WP_015485000.1|1584453_1584969_-	DUF4342 domain-containing protein	NA	NA	NA	NA	NA
WP_015359119.1|1585114_1586077_-	acetylxylan esterase	NA	NA	NA	NA	NA
WP_015359120.1|1586253_1587468_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_065820779.1|1588044_1588377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065820479.1|1588698_1589997_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_065820780.1|1590243_1590642_-	hypothetical protein	NA	G8C7U5	Escherichia_phage	43.7	3.5e-23
WP_059032505.1|1590665_1590941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083197789.1|1590961_1591909_-	DUF5131 family protein	NA	A0A1B1IPY1	uncultured_Mediterranean_phage	30.6	1.1e-30
WP_065820782.1|1592008_1592296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065820783.1|1592618_1592894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029688724.1|1593048_1593264_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_065820784.1|1593283_1593481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065820785.1|1593477_1594227_+	Fic family protein	NA	NA	NA	NA	NA
WP_065820787.1|1594853_1595369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065820788.1|1595646_1596063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065820789.1|1596059_1599515_-	tape measure protein	NA	M1IEW1	Bacillus_virus	32.1	7.8e-26
WP_065820790.1|1599683_1599986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065820791.1|1599991_1600435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065820792.1|1600452_1601136_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_157882737.1|1601256_1601691_-	hypothetical protein	NA	H7BVX7	unidentified_phage	53.2	2.8e-26
WP_015358103.1|1601949_1603176_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	30.7	9.2e-14
WP_083197760.1|1603182_1603593_-	DUF4373 domain-containing protein	NA	A0A0H4TKJ7	Bacillus_phage	61.5	4.6e-42
WP_065820794.1|1603638_1603857_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_065820795.1|1604002_1604575_+	helix-turn-helix transcriptional regulator	NA	A0A2R2ZGJ3	Clostridioides_phage	36.5	3.2e-09
WP_065820796.1|1604642_1605158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065820797.1|1605211_1606318_+|integrase	site-specific integrase	integrase	Q8SBN2	Clostridium_phage	57.0	7.8e-113
WP_065820798.1|1606397_1607936_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	31.7	1.8e-22
WP_015359123.1|1608146_1608302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015359124.1|1608393_1609617_-	putative glycoside hydrolase	NA	NA	NA	NA	NA
WP_065820799.1|1609806_1610676_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_065821189.1|1610989_1611133_+	DUF3787 domain-containing protein	NA	NA	NA	NA	NA
WP_015359127.1|1611262_1611436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065820800.1|1611624_1615140_-	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_065820801.1|1615458_1616688_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	30.7	9.2e-14
WP_015485002.1|1617421_1617610_+	hypothetical protein	NA	NA	NA	NA	NA
1616981:1617005	attR	ACGGCATTTAATATTGCAATTTACA	NA	NA	NA	NA
WP_015359129.1|1617622_1617901_+|coat	spore coat protein	coat	NA	NA	NA	NA
>prophage 8
NZ_CP014673	Thermoclostridium stercorarium subsp. leptospartum DSM 9219 chromosome, complete genome	3148357	1971686	2036296	3148357	transposase,integrase	Corynebacterium_phage(14.29%)	50	2006341:2006364	2007239:2007262
WP_065820866.1|1971686_1972958_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	34.0	9.4e-54
WP_015359429.1|1973373_1973817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015359430.1|1973898_1974588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034836289.1|1976276_1978040_+	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	36.7	1.4e-63
WP_034836286.1|1978296_1979322_-	chemotaxis response regulator protein-glutamate methylesterase	NA	NA	NA	NA	NA
WP_065820869.1|1979348_1980164_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_034836283.1|1980311_1980806_-	purine-binding chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_065820870.1|1980836_1983149_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_015359437.1|1983094_1983541_-	MFS transporter	NA	NA	NA	NA	NA
WP_015359438.1|1983735_1985580_-	asparagine synthase (glutamine-hydrolyzing)	NA	F2Y1H0	Organic_Lake_phycodnavirus	25.7	1.7e-27
WP_015359439.1|1985703_1987314_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	51.6	2.9e-148
WP_015359440.1|1987420_1987990_-	ANTAR domain-containing protein	NA	NA	NA	NA	NA
WP_054632751.1|1988024_1989344_-	glutamine synthetase	NA	NA	NA	NA	NA
WP_015359443.1|1989437_1990154_-	glutamate synthase	NA	NA	NA	NA	NA
WP_015359444.1|1990223_1991729_-	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_051492258.1|1991719_1992856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169316010.1|1993462_1994470_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	44.9	1.2e-64
WP_065820871.1|1994485_1996588_+	glutamine synthetase III	NA	NA	NA	NA	NA
WP_015359448.1|1996777_1998043_+	adenylosuccinate synthase	NA	A0A2L2DKW2	Acanthamoeba_polyphaga_mimivirus	31.5	2.2e-55
WP_083191811.1|1998237_1999323_-	chemotaxis response regulator protein-glutamate methylesterase	NA	NA	NA	NA	NA
WP_065820872.1|2000129_2003213_-	hypothetical protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	47.8	1.7e-16
WP_065820873.1|2003254_2005345_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_065820874.1|2005358_2005787_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_034836250.1|2005815_2006169_-	response regulator	NA	Q8QKV7	Ectocarpus_siliculosus_virus	27.8	1.2e-06
2006341:2006364	attL	GTAACAATATGTCCATTTTGTTAC	NA	NA	NA	NA
WP_065820875.1|2006579_2007140_+|integrase	tyrosine-type recombinase/integrase	integrase	H0USV4	Bacillus_phage	46.2	1.8e-33
WP_065820876.1|2007618_2007846_-	hypothetical protein	NA	NA	NA	NA	NA
2007239:2007262	attR	GTAACAAAATGGACATATTGTTAC	NA	NA	NA	NA
WP_015359458.1|2008142_2009318_-	carboxynorspermidine decarboxylase	NA	NA	NA	NA	NA
WP_015359459.1|2009328_2010528_-	saccharopine dehydrogenase family protein	NA	NA	NA	NA	NA
WP_015359460.1|2010621_2011473_-	agmatinase	NA	NA	NA	NA	NA
WP_015359461.1|2011465_2012311_-	polyamine aminopropyltransferase	NA	NA	NA	NA	NA
WP_015359462.1|2012313_2013756_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_015359464.1|2014053_2014584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065821194.1|2014621_2015935_-	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	29.7	1.6e-24
WP_015358154.1|2016250_2016691_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_144050590.1|2016704_2018036_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_065820877.1|2018188_2019412_+|transposase	IS256-like element ISCth5 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	49.0	9.6e-96
WP_065820878.1|2019461_2019800_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_065820879.1|2019850_2022835_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	22.6	6.5e-21
WP_065820880.1|2022851_2024687_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_065820881.1|2024679_2026050_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_065820882.1|2026046_2028065_-	SAM-dependent DNA methyltransferase	NA	A0A220A2U4	Liberibacter_phage	26.7	5.6e-32
WP_065820883.1|2028272_2029241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065820884.1|2029396_2029633_-	DUF4829 domain-containing protein	NA	NA	NA	NA	NA
WP_065820885.1|2029769_2029994_-	type I addiction module toxin, SymE family	NA	NA	NA	NA	NA
WP_065820886.1|2030021_2030315_-	stage V sporulation protein S	NA	NA	NA	NA	NA
WP_065820887.1|2030683_2032747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011838013.1|2032847_2033135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065820888.1|2033784_2034072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065820889.1|2034077_2035004_-	ParM/StbA family protein	NA	NA	NA	NA	NA
WP_065820877.1|2035072_2036296_-|transposase	IS256-like element ISCth5 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	49.0	9.6e-96
>prophage 9
NZ_CP014673	Thermoclostridium stercorarium subsp. leptospartum DSM 9219 chromosome, complete genome	3148357	2169436	2206077	3148357	tRNA,head,transposase,tail,protease	uncultured_virus(33.33%)	32	NA	NA
WP_065820926.1|2169436_2170630_-|protease	26S protease regulatory subunit	protease	G8DDJ2	Micromonas_pusilla_virus	40.1	3.3e-48
WP_015359565.1|2170945_2171860_-	radical SAM protein	NA	NA	NA	NA	NA
WP_015359566.1|2171944_2172646_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_144050622.1|2172844_2173141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034836399.1|2173264_2173444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157882740.1|2173545_2173719_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_015359571.1|2174017_2174335_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_065820928.1|2174906_2177012_-	glutamine synthetase III	NA	NA	NA	NA	NA
WP_015359574.1|2177670_2179086_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_015359575.1|2179082_2180543_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_015359576.1|2180539_2180833_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_015359577.1|2180895_2182641_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_015359579.1|2183550_2184054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015359581.1|2184348_2184561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015359583.1|2185185_2185629_-	flavin reductase	NA	NA	NA	NA	NA
WP_157882741.1|2185774_2186263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083197768.1|2186776_2187466_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015359589.1|2188389_2190345_+	carbohydrate-binding protein	NA	NA	NA	NA	NA
WP_015359590.1|2190892_2191018_-	acetyltransferase, GNAT family	NA	NA	NA	NA	NA
WP_015359591.1|2191031_2191280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015359592.1|2191648_2192383_+	DUF3788 domain-containing protein	NA	NA	NA	NA	NA
WP_065820930.1|2192524_2193193_-|head,tail	phage head-tail adapter protein	head,tail	NA	NA	NA	NA
WP_065820931.1|2194041_2195268_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	30.7	9.2e-14
WP_065820932.1|2196086_2196329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065820933.1|2196472_2197471_-	DUF4065 domain-containing protein	NA	A0A0N9SGM1	Paenibacillus_phage	37.1	3.6e-16
WP_065820934.1|2197510_2197921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065820937.1|2198918_2199500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065820938.1|2199599_2200868_-	amidase domain-containing protein	NA	NA	NA	NA	NA
WP_065820939.1|2201367_2202438_-|transposase	IS30-like element ISCth3 family transposase	transposase	H7BUM7	unidentified_phage	36.7	1.4e-53
WP_065820940.1|2202640_2203312_-	hypothetical protein	NA	F8J1F0	Lactobacillus_phage	44.4	9.5e-13
WP_065820941.1|2203308_2203779_-	DMT family transporter	NA	NA	NA	NA	NA
WP_065820931.1|2204850_2206077_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	30.7	9.2e-14
>prophage 10
NZ_CP014673	Thermoclostridium stercorarium subsp. leptospartum DSM 9219 chromosome, complete genome	3148357	2211214	2265515	3148357	holin,terminase,capsid,head,portal,tail,transposase,protease	Erysipelothrix_phage(75.68%)	64	NA	NA
WP_083197773.1|2211214_2212729_-|transposase	IS21-like element ISCth12 family transposase	transposase	NA	NA	NA	NA
WP_157882743.1|2212804_2213290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065820946.1|2215060_2215867_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_065820947.1|2215909_2216776_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_065820948.1|2216880_2217462_+	chromate transporter	NA	NA	NA	NA	NA
WP_065820949.1|2217458_2218022_+	chromate transporter	NA	NA	NA	NA	NA
WP_065821197.1|2218154_2218514_-	dinitrogenase iron-molybdenum cofactor	NA	NA	NA	NA	NA
WP_065820950.1|2218975_2219824_-	Mrp/NBP35 family ATP-binding protein	NA	NA	NA	NA	NA
WP_065820951.1|2219879_2220611_-	ZIP family metal transporter	NA	NA	NA	NA	NA
WP_065820952.1|2220642_2221464_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_065820953.1|2221460_2222345_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_065820954.1|2222322_2223183_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_065820955.1|2223184_2223553_-	NifB/NifX family molybdenum-iron cluster-binding protein	NA	NA	NA	NA	NA
WP_065820956.1|2223527_2223926_-	iron-sulfur cluster assembly scaffold protein	NA	NA	NA	NA	NA
WP_065820957.1|2223928_2224303_-	DUF134 domain-containing protein	NA	NA	NA	NA	NA
WP_065820958.1|2224435_2224753_-	DUF5320 domain-containing protein	NA	NA	NA	NA	NA
WP_065820959.1|2224770_2225007_-	DUF5320 domain-containing protein	NA	NA	NA	NA	NA
WP_065820960.1|2225193_2226762_-	recombinase family protein	NA	A0A2K5B2B4	Erysipelothrix_phage	57.9	5.2e-171
WP_083197774.1|2226724_2227216_-	recombinase	NA	A0A2K5B2B3	Erysipelothrix_phage	40.1	5.9e-20
WP_065820962.1|2227179_2228739_-	recombinase family protein	NA	A0A2K5B2B2	Erysipelothrix_phage	52.9	1.0e-150
WP_065820963.1|2228800_2229019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065820964.1|2229072_2230077_-	N-acetylmuramoyl-L-alanine amidase	NA	H7BV89	unidentified_phage	67.3	1.7e-10
WP_065820965.1|2230073_2230493_-|holin	phage holin family protein	holin	A0A2K5B2A2	Erysipelothrix_phage	69.9	7.2e-51
WP_065820966.1|2230579_2233048_-	glycosyl hydrolase	NA	A0A2K5B2A1	Erysipelothrix_phage	68.6	0.0e+00
WP_065820967.1|2233044_2233620_-	hypothetical protein	NA	A0A2K5B2A0	Erysipelothrix_phage	52.4	3.1e-52
WP_003520677.1|2233629_2233824_-	hypothetical protein	NA	A0A2K5B299	Erysipelothrix_phage	66.2	2.2e-18
WP_065820968.1|2233834_2236357_-|tail	phage tail protein	tail	A0A2K5B298	Erysipelothrix_phage	63.0	0.0e+00
WP_065820969.1|2236361_2237135_-|tail	phage tail family protein	tail	A0A2I4R672	Erysipelothrix_phage	51.9	3.2e-73
WP_065820970.1|2237148_2239335_-|tail	phage tail protein	tail	A0A2K5B297	Erysipelothrix_phage	38.5	2.4e-12
WP_003520671.1|2239362_2239554_-	hypothetical protein	NA	A0A2K5B296	Erysipelothrix_phage	75.6	3.9e-12
WP_003516030.1|2239550_2239934_-	hypothetical protein	NA	A0A2K5B295	Erysipelothrix_phage	68.8	8.9e-40
WP_013782353.1|2239933_2240533_-|tail	phage tail protein	tail	A0A2K5B294	Erysipelothrix_phage	74.2	6.8e-79
WP_013782354.1|2240538_2240883_-	hypothetical protein	NA	A0A2K5B293	Erysipelothrix_phage	55.0	5.7e-30
WP_003516027.1|2240879_2241311_-	HK97 gp10 family phage protein	NA	A0A2K5B292	Erysipelothrix_phage	62.9	4.2e-46
WP_013782355.1|2241325_2241661_-|head,tail	head-tail adaptor protein	head,tail	A0A2K5B291	Erysipelothrix_phage	57.8	1.0e-28
WP_013782356.1|2241663_2241972_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2K5B290	Erysipelothrix_phage	75.5	2.3e-38
WP_013297316.1|2241993_2243196_-|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	78.2	4.9e-177
WP_013782357.1|2243209_2243935_-|protease	Clp protease ClpP	protease	A0A2K5B288	Erysipelothrix_phage	64.1	1.1e-75
WP_013782358.1|2243873_2245196_-|portal	phage portal protein	portal	A0A2K5B287	Erysipelothrix_phage	75.2	1.4e-188
WP_013782359.1|2245192_2246845_-|terminase	terminase large subunit	terminase	A0A2K5B285	Erysipelothrix_phage	77.2	1.7e-249
WP_028992635.1|2246899_2247094_-	DUF5049 domain-containing protein	NA	NA	NA	NA	NA
WP_004400073.1|2247097_2247565_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_004400072.1|2247626_2248526_-	amidoligase family protein	NA	A0A2K9V489	Faecalibacterium_phage	41.1	3.3e-53
WP_065820971.1|2248667_2248898_-	DUF4314 domain-containing protein	NA	NA	NA	NA	NA
WP_013782363.1|2248894_2249230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065820972.1|2249222_2249915_-	virulence factor	NA	A0A2K5B280	Erysipelothrix_phage	35.7	7.5e-29
WP_065820973.1|2250031_2251285_-	DNA modification methylase	NA	A0A2I4R670	Erysipelothrix_phage	46.5	3.0e-100
WP_065820974.1|2251290_2252589_-	DNA modification methylase	NA	A0A2I4R670	Erysipelothrix_phage	40.5	4.8e-77
WP_065820975.1|2252563_2252746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065821198.1|2252745_2253297_-|terminase	P27 family phage terminase small subunit	terminase	A0A2K5B277	Erysipelothrix_phage	67.6	6.9e-70
WP_065820976.1|2253417_2253777_-	HNH endonuclease	NA	A0A2K5B276	Erysipelothrix_phage	63.9	1.5e-41
WP_065820977.1|2254268_2254724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014256659.1|2254814_2255117_-	VRR-NUC domain-containing protein	NA	I3VYX6	Thermoanaerobacterium_phage	65.2	2.6e-26
WP_065820978.1|2255417_2257973_-	DNA primase	NA	D6R422	Bacillus_phage	39.4	4.4e-50
WP_004400050.1|2257969_2258395_-	hypothetical protein	NA	A0A2K5B270	Erysipelothrix_phage	61.7	1.7e-47
WP_065820979.1|2258410_2259232_-	phage antirepressor KilAC domain-containing protein	NA	A0A1Q1PVZ8	Staphylococcus_phage	49.8	2.7e-70
WP_065820980.1|2259236_2261159_-	bifunctional 3'-5' exonuclease/DNA polymerase	NA	S4U8J4	Listeria_phage	27.0	5.4e-45
WP_011838170.1|2261215_2261968_-	hypothetical protein	NA	I3VYY1	Thermoanaerobacterium_phage	43.6	1.0e-47
WP_065820981.1|2262089_2262530_-	hypothetical protein	NA	I3VYY4	Thermoanaerobacterium_phage	45.3	2.1e-24
WP_083197775.1|2262495_2263854_-	DEAD/DEAH box helicase	NA	I3VYY6	Thermoanaerobacterium_phage	50.4	6.6e-114
WP_156946390.1|2263820_2263991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065820982.1|2264146_2264653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065820983.1|2264805_2265015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_028306832.1|2265287_2265515_+	helix-turn-helix transcriptional regulator	NA	A0A2K5B261	Erysipelothrix_phage	52.9	1.8e-11
