The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	0	26237	4211343		Tupanvirus(25.0%)	8	NA	NA
WP_010886402.1|8765_19529_-	surfactin non-ribosomal peptide synthetase SrfAA	NA	A0A2K9L3I8	Tupanvirus	26.9	1.9e-155
WP_003246265.1|20102_20465_-	transcriptional activator HxlR	NA	NA	NA	NA	NA
WP_003246452.1|20697_21330_+	3-hexulose-6-phosphate synthase	NA	NA	NA	NA	NA
WP_003246343.1|21335_21893_+	6-phospho-3-hexuloisomerase	NA	NA	NA	NA	NA
WP_003246498.1|22003_23725_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	45.3	3.6e-16
WP_003246436.1|23892_24342_+	DNA-entry nuclease	NA	F8WPS9	Bacillus_phage	67.0	8.5e-42
WP_003246342.1|24368_24767_+	DNA-entry nuclease inhibitor	NA	NA	NA	NA	NA
WP_003246242.1|24803_26237_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	30.6	1.3e-51
>prophage 2
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	36060	38193	4211343		Escherichia_phage(100.0%)	1	NA	NA
WP_003246484.1|36060_38193_+	assimilatory nitrate reductase catalytic subunit	NA	A0A077SK27	Escherichia_phage	22.7	7.7e-16
>prophage 3
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	42627	43638	4211343		Tupanvirus(100.0%)	1	NA	NA
WP_003234643.1|42627_43638_-	ferredoxin--NADP(+) reductase	NA	A0A2K9L4X0	Tupanvirus	27.7	4.6e-19
>prophage 4
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	51033	58208	4211343		Staphylococcus_phage(25.0%)	8	NA	NA
WP_003246421.1|51033_51945_-	Proline dehydrogenase 2	NA	A0A2H4PQT6	Staphylococcus_phage	42.6	1.6e-66
WP_003246492.1|52135_52918_-	nucleotidyltransferase domain-containing protein	NA	A0A2D1GQQ2	Pseudomonas_phage	44.9	9.9e-46
WP_003246400.1|53001_53958_-	acetylxylan esterase	NA	NA	NA	NA	NA
WP_003246430.1|54029_55004_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	25.2	9.2e-17
WP_003246488.1|55121_55883_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003246473.1|55910_56471_-	shikimate kinase	NA	NA	NA	NA	NA
WP_003246258.1|56746_57340_+	tunicamycin resistance protein TmrB	NA	NA	NA	NA	NA
WP_003246440.1|57389_58208_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	61.1	1.6e-91
>prophage 5
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	74226	75483	4211343		Bacillus_virus(100.0%)	1	NA	NA
WP_003246301.1|74226_75483_-	glycine betaine/L-proline ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	41.1	3.1e-33
>prophage 6
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	81697	87149	4211343		Caulobacter_phage(60.0%)	7	NA	NA
WP_003246458.1|81697_82471_-	TerC family protein	NA	S5MAL1	Bacillus_phage	64.3	5.0e-82
WP_003241242.1|82521_83100_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	38.8	1.3e-29
WP_003234723.1|83134_83716_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	41.7	6.7e-31
WP_003246350.1|83737_84337_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	31.0	5.3e-23
WP_003246351.1|84620_85616_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003246340.1|85653_86496_-	zinc ABC transporter permease ZnuB	NA	NA	NA	NA	NA
WP_003234730.1|86453_87149_-	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.1	1.6e-18
>prophage 7
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	90944	92692	4211343		Bacillus_phage(50.0%)	2	NA	NA
WP_003246478.1|90944_92066_-	response regulator aspartate phosphatase RapJ	NA	A0A1P8CWN8	Bacillus_phage	31.7	1.6e-49
WP_009966473.1|92188_92692_+	peptidoglycan L-alanyl-D-glutamate endopeptidase CwlK	NA	A0A2H4J4U2	uncultured_Caudovirales_phage	50.8	4.9e-30
>prophage 8
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	99326	100067	4211343		Staphylococcus_phage(100.0%)	1	NA	NA
WP_003234757.1|99326_100067_-	sodium ABC transporter ATP-binding protein NatA	NA	A0A2H4PQG7	Staphylococcus_phage	31.5	5.4e-25
>prophage 9
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	109719	110448	4211343		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_003246495.1|109719_110448_-	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	25.0	5.8e-16
>prophage 10
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	115486	118119	4211343		Bacillus_phage(66.67%)	3	NA	NA
WP_003246292.1|115486_116410_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	44.0	7.9e-42
WP_003246497.1|116501_117437_-	two-component system sensor histidine kinase YcbM	NA	W8CYF6	Bacillus_phage	28.5	2.3e-25
WP_009966453.1|117438_118119_-	two-component system response regulator YcbL	NA	W8CYM9	Bacillus_phage	33.2	2.1e-31
>prophage 11
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	139693	141589	4211343		Vibrio_phage(100.0%)	1	NA	NA
WP_003246270.1|139693_141589_+	PTS glucose transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	42.3	9.0e-08
>prophage 12
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	162600	163482	4211343		Staphylococcus_phage(100.0%)	1	NA	NA
WP_003246382.1|162600_163482_+	glycerophosphodiester phosphodiesterase	NA	I6XE30	Staphylococcus_phage	38.9	2.2e-41
>prophage 13
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	172506	175238	4211343		Orpheovirus(50.0%)	4	NA	NA
WP_003234892.1|172506_173277_+	serine/threonine protein kinase	NA	A0A2I2L4H4	Orpheovirus	32.0	5.6e-09
WP_009966423.1|173261_173525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010886392.1|173583_174546_-	two-component system sensor histidine kinase YbdK	NA	NA	NA	NA	NA
WP_003234895.1|174566_175238_-	two-component system response regulator YbdK	NA	W8CYM9	Bacillus_phage	32.0	4.9e-25
>prophage 14
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	178863	179583	4211343		Cedratvirus(100.0%)	1	NA	NA
WP_003234899.1|178863_179583_-	sporulation killing factor ABC transporter ATP-binding protein SkfE	NA	A0A285PWH2	Cedratvirus	28.6	7.5e-16
>prophage 15
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	191605	196219	4211343		Acanthamoeba_polyphaga_mimivirus(50.0%)	5	NA	NA
WP_003246311.1|191605_192145_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	46.7	5.3e-22
WP_003234924.1|192131_192767_-	bifunctional transcriptional activator/DNA repair enzyme AdaA	NA	NA	NA	NA	NA
WP_003234926.1|193037_193949_+	DNA-3-methyladenine glycosidase II	NA	NA	NA	NA	NA
WP_020861257.1|194229_194370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003234943.1|194416_196219_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	Q84421	Paramecium_bursaria_Chlorella_virus	39.8	3.1e-103
>prophage 16
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	217976	219413	4211343		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_003234986.1|217976_219413_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	57.5	1.0e-141
>prophage 17
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	239178	239892	4211343		Bacillus_phage(100.0%)	1	NA	NA
WP_004399672.1|239178_239892_-	N-acetylmuramoyl-L-alanine amidase CwlD	NA	A0A0N6W8I1	Bacillus_phage	30.5	4.8e-15
>prophage 18
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	244370	246061	4211343		Staphylococcus_phage(50.0%)	2	NA	NA
WP_003235106.1|244370_245240_-	energy-coupling factor ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.8	4.0e-11
WP_004399689.1|245215_246061_-	energy-coupling factor ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.5	1.2e-20
>prophage 19
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	263741	274585	4211343		Streptococcus_phage(33.33%)	6	NA	NA
WP_003235056.1|263741_265820_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	28.2	7.4e-64
WP_003225784.1|265873_266344_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_003225781.1|266385_266802_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_003225778.1|266915_267164_-	50S ribosomal protein L7ae-like protein	NA	NA	NA	NA	NA
WP_004399688.1|267342_270942_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	25.1	2.8e-66
WP_009966326.1|271003_274585_-	DNA-directed RNA polymerase subunit beta	NA	A0A1B1ISA9	uncultured_Mediterranean_phage	23.7	1.2e-48
>prophage 20
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	278080	278614	4211343		Bacillus_virus(100.0%)	1	NA	NA
WP_003225764.1|278080_278614_-	transcription termination/antitermination protein NusG	NA	G3MAW2	Bacillus_virus	30.8	9.2e-11
>prophage 21
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	281653	283054	4211343	tRNA	Catovirus(100.0%)	1	NA	NA
WP_004399682.1|281653_283054_-|tRNA	cysteine--tRNA ligase	tRNA	A0A1V0SAQ2	Catovirus	31.4	1.0e-61
>prophage 22
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	290499	292932	4211343	protease	Klebsiella_phage(100.0%)	1	NA	NA
WP_003235011.1|290499_292932_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A0A8J958	Klebsiella_phage	40.1	1.5e-132
>prophage 23
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	306277	307777	4211343	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_003242743.1|306277_307777_-|tRNA	lysine--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	39.4	1.4e-96
>prophage 24
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	311629	319520	4211343	protease	Acinetobacter_phage(25.0%)	7	NA	NA
WP_003243797.1|311629_312214_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	58.5	5.5e-65
WP_003242468.1|312227_313640_-	anthranilate synthase component I family protein	NA	S4VT78	Pandoravirus	31.7	1.4e-34
WP_003244491.1|313806_314733_-	cysteine synthase A	NA	A0A1X9I5K7	Streptococcus_phage	64.9	2.0e-109
WP_003243824.1|314808_315702_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_003226695.1|315748_316624_-	redox-regulated molecular chaperone HslO	NA	NA	NA	NA	NA
WP_010886388.1|316635_317412_-	type III pantothenate kinase	NA	NA	NA	NA	NA
WP_003243881.1|317606_319520_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	M4QMW8	Micromonas_pusilla_virus	42.0	1.1e-114
>prophage 25
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	331868	332405	4211343		Paenibacillus_phage(100.0%)	1	NA	NA
WP_003218365.1|331868_332405_-	stage V sporulation protein T	NA	A0A2I7SC16	Paenibacillus_phage	70.6	4.2e-11
>prophage 26
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	337805	340152	4211343		Tupanvirus(100.0%)	2	NA	NA
WP_003218353.1|337805_338759_-	ribose-phosphate diphosphokinase	NA	A0A2K9L8D8	Tupanvirus	35.9	5.1e-44
WP_003226732.1|338781_340152_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A2K9L140	Tupanvirus	34.4	1.1e-31
>prophage 27
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	346561	360026	4211343	tRNA	Streptococcus_phage(42.86%)	15	NA	NA
WP_003226754.1|346561_347875_-	DUF348 domain-containing protein	NA	U5PSR6	Bacillus_phage	66.7	8.9e-31
WP_003226756.1|348030_348798_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_003226758.1|348876_350871_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	39.2	4.0e-99
WP_003226760.1|351365_351656_+	transition state genes transcriptional regulator AbrB	NA	A0A2I7SC16	Paenibacillus_phage	54.3	8.0e-17
WP_003243457.1|351704_352583_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	48.3	2.7e-68
WP_003242983.1|352557_352857_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_003244526.1|352843_353587_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_003218308.1|353645_354005_-	DNA replication initiation control protein YabA	NA	NA	NA	NA	NA
WP_003243571.1|354019_354847_-	stage 0 sporulation protein YaaT	NA	NA	NA	NA	NA
WP_003244417.1|354849_355839_-	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	33.1	3.2e-33
WP_009966249.1|355850_356291_-	YaaR family protein	NA	NA	NA	NA	NA
WP_003242755.1|356303_356633_-	cyclic di-AMP receptor DarA	NA	NA	NA	NA	NA
WP_003243137.1|356706_357345_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	55.4	9.2e-58
WP_003243352.1|357341_358784_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_003226779.1|358865_360026_-	toxic anion resistance protein	NA	A0A291I9K4	Lactobacillus_phage	30.7	1.6e-36
>prophage 28
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	367998	369690	4211343		Bacteriophage(100.0%)	1	NA	NA
WP_003247135.1|367998_369690_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	34.9	3.9e-55
>prophage 29
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	372734	380589	4211343	tRNA	Enterococcus_phage(20.0%)	7	NA	NA
WP_003247138.1|372734_373358_+	deoxynucleoside kinase	NA	A0A1G5SAJ8	Enterococcus_phage	24.3	9.1e-10
WP_003226792.1|373354_374008_+	deoxynucleoside kinase	NA	C1KFI3	Lactobacillus_virus	33.5	3.7e-22
WP_003247131.1|374346_375624_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	53.9	1.7e-95
WP_003226797.1|375945_376536_-	pyridoxal 5'-phosphate synthase glutaminase subunit PdxT	NA	NA	NA	NA	NA
WP_003247145.1|376557_377442_-	pyridoxal 5'-phosphate synthase lyase subunit PdxS	NA	NA	NA	NA	NA
WP_009966224.1|377638_378970_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	28.6	2.5e-25
WP_003226803.1|379122_380589_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	41.9	1.9e-98
>prophage 30
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	387044	394565	4211343		Bacillus_virus(66.67%)	6	NA	NA
WP_003244540.1|387044_389510_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	36.9	7.1e-114
WP_003226808.1|389720_391637_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	48.8	9.9e-156
WP_003219266.1|391691_391937_-	extracellular matrix regulator RemB	NA	NA	NA	NA	NA
WP_003243515.1|391954_393067_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_003226810.1|393082_393298_-	ribosome maturation protein RlbA	NA	NA	NA	NA	NA
WP_003242509.1|393428_394565_-	DNA polymerase III subunit beta	NA	D0R7I4	Paenibacillus_phage	33.6	6.3e-17
>prophage 31
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	403361	407210	4211343	protease	Leptospira_phage(25.0%)	5	NA	NA
WP_003226829.1|403361_404213_+	nucleoid occlusion protein	NA	S5VTK0	Leptospira_phage	37.4	1.6e-17
WP_003244005.1|404263_404704_-	PH domain-containing protein	NA	NA	NA	NA	NA
WP_003219244.1|404951_405713_+	sporulation initiation inhibitor protein Soj	NA	Q8JL10	Natrialba_phage	31.1	6.5e-26
WP_003226832.1|405705_406554_+	stage 0 sporulation protein Spo0J	NA	I3NLC2	Bifidobacterium_phage	38.9	2.0e-20
WP_003243890.1|406592_407210_-|protease	spore protease YyaC	protease	G3M9W0	Bacillus_virus	32.7	2.0e-17
>prophage 32
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	412705	414330	4211343		Bacillus_phage(50.0%)	3	NA	NA
WP_003219228.1|412705_413224_+	single-stranded DNA-binding protein	NA	M5ABV5	Bacillus_phage	69.8	2.3e-51
WP_003219224.1|413267_413507_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_003243194.1|413571_414330_+	exodeoxyribonuclease III	NA	E3T4M6	Cafeteria_roenbergensis_virus	44.7	1.2e-59
>prophage 33
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	426428	426950	4211343		Streptococcus_phage(100.0%)	1	NA	NA
WP_003242546.1|426428_426950_+	streptothricin N-acetyltransferase SatA	NA	A0A1B0RXL7	Streptococcus_phage	47.8	1.1e-43
>prophage 34
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	435584	436241	4211343		Staphylococcus_phage(100.0%)	1	NA	NA
WP_003243153.1|435584_436241_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	34.5	8.1e-25
>prophage 35
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	453274	471851	4211343	protease	Bacillus_phage(33.33%)	16	NA	NA
WP_003226923.1|453274_454639_+	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	54.8	3.6e-128
WP_003243491.1|454759_455179_+	VOC family protein	NA	NA	NA	NA	NA
WP_003243325.1|455384_456677_+	adenylosuccinate synthase	NA	G5CQQ4	Megavirus	35.6	1.2e-67
WP_003244363.1|457707_458415_+	cell wall metabolism DNA-binding response regulator WalR	NA	W8CYM9	Bacillus_phage	41.2	3.4e-45
WP_009968432.1|458422_460258_+	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	33.5	4.4e-36
WP_003242498.1|460247_461615_+	WalRK two-component regulatory system regulator WalH	NA	NA	NA	NA	NA
WP_003244037.1|461601_462444_+	WalRK two-component regulatory system regulator WalI	NA	NA	NA	NA	NA
WP_003242676.1|462465_463260_+	MBL fold metallo-hydrolase	NA	A0A0C5AJ83	Bacteriophage	36.0	5.7e-41
WP_009969578.1|463341_464544_+|protease	serine protease HtrC	protease	W5SAB9	Pithovirus	40.4	5.9e-13
WP_003242634.1|464563_464692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003244510.1|464978_466364_-	arginine utilization regulatory protein RocR	NA	NA	NA	NA	NA
WP_003242970.1|466604_467810_+	ornithine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.5	2.6e-29
WP_003242721.1|468032_469436_+	amino acid permease	NA	NA	NA	NA	NA
WP_003226959.1|469509_470400_+	arginase	NA	A0A1V0SJM8	Klosneuvirus	29.1	2.0e-26
WP_003226961.1|470636_470753_-	Phr family secreted Rap phosphatase inhibitor	NA	NA	NA	NA	NA
WP_003243386.1|470753_471851_-	response regulator aspartate phosphatase RapG	NA	D6R410	Bacillus_phage	39.3	6.0e-73
>prophage 36
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	475086	476313	4211343		Tupanvirus(100.0%)	1	NA	NA
WP_003226972.1|475086_476313_+	formaldehyde dehydrogenase, glutathione-independent	NA	A0A2K9L7I1	Tupanvirus	28.9	1.5e-11
>prophage 37
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	486518	487148	4211343		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_003242913.1|486518_487148_+	ATP-binding cassette domain-containing protein	NA	A0A2H4UUX5	Bodo_saltans_virus	31.3	6.8e-05
>prophage 38
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	491054	495031	4211343		Klosneuvirus(50.0%)	3	NA	NA
WP_003243077.1|491054_492584_-	alkyl hydroperoxide reductase subunit F	NA	A0A1V0SIN1	Klosneuvirus	29.3	1.0e-33
WP_003243686.1|492597_493161_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_003243876.1|493624_495031_-	decarboxylating NADP(+)-dependent phosphogluconate dehydrogenase	NA	E3SJC4	Synechococcus_phage	30.6	2.3e-32
>prophage 39
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	498889	500038	4211343		Streptococcus_phage(100.0%)	1	NA	NA
WP_003242551.1|498889_500038_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	42.3	2.8e-49
>prophage 40
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	510941	513185	4211343		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_003244103.1|510941_513185_-	asparagine synthase (glutamine-hydrolyzing)	NA	F2Y2L7	Organic_Lake_phycodnavirus	29.4	7.1e-28
>prophage 41
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	520801	522682	4211343		Catovirus(100.0%)	1	NA	NA
WP_003243561.1|520801_522682_+	molecular chaperone HtpG	NA	A0A1V0SAD6	Catovirus	33.5	6.2e-94
>prophage 42
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	540944	541718	4211343		Planktothrix_phage(100.0%)	1	NA	NA
WP_003243557.1|540944_541718_+	ABC transporter ATP-binding protein YxdL	NA	G9BWD6	Planktothrix_phage	37.3	1.5e-30
>prophage 43
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	548581	549568	4211343		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_003243495.1|548581_549568_+	penicillin V amidase	NA	M1H9I8	Acanthocystis_turfacea_Chlorella_virus	31.1	1.6e-29
>prophage 44
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	553332	554082	4211343		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_003243284.1|553332_554082_+	amino acid ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.7	6.0e-16
>prophage 45
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	561800	563102	4211343		Geobacillus_virus(100.0%)	1	NA	NA
WP_003243952.1|561800_563102_+	pyrimidine-nucleoside phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	61.5	1.6e-133
>prophage 46
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	568533	570060	4211343		Catovirus(100.0%)	1	NA	NA
WP_003243255.1|568533_570060_-	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	39.5	3.3e-93
>prophage 47
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	594683	596123	4211343		Catovirus(100.0%)	1	NA	NA
WP_003243023.1|594683_596123_+	ATP-dependent RNA helicase DbpA	NA	A0A1V0SBR7	Catovirus	34.1	8.5e-59
>prophage 48
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	601906	603967	4211343		Tupanvirus(100.0%)	1	NA	NA
WP_003243331.1|601906_603967_+	catalase	NA	A0A2K9L0T1	Tupanvirus	52.7	5.8e-154
>prophage 49
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	611623	614146	4211343		uncultured_virus(100.0%)	2	NA	NA
WP_003244221.1|611623_612760_-	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	A0A218MNE0	uncultured_virus	46.1	2.4e-88
WP_003244296.1|613012_614146_-	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	A0A218MNE0	uncultured_virus	46.5	1.2e-89
>prophage 50
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	621142	627977	4211343		Tupanvirus(33.33%)	6	NA	NA
WP_003244356.1|621142_622162_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	51.4	8.5e-98
WP_119123080.1|622236_622779_-	DUF4352 domain-containing protein	NA	NA	NA	NA	NA
WP_003242615.1|623346_624183_+	YitT family protein	NA	M1Q1P6	Streptococcus_phage	33.6	1.0e-40
WP_003243062.1|624224_625682_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_003242549.1|625865_626759_+	PucR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003242648.1|626879_627977_+	maltodextrin ABC transporter ATP-binding protein MsmX	NA	G9BWD6	Planktothrix_phage	31.2	2.4e-21
>prophage 51
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	635318	638746	4211343		Bodo_saltans_virus(50.0%)	2	NA	NA
WP_003244017.1|635318_637022_+	thiol reductant ABC exporter subunit CydD	NA	A0A2H4UU96	Bodo_saltans_virus	21.6	2.2e-13
WP_003244401.1|637018_638746_+	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	24.0	2.4e-23
>prophage 52
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	642505	647113	4211343		Staphylococcus_phage(50.0%)	4	NA	NA
WP_003244494.1|642505_643393_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	32.5	2.0e-26
WP_003243335.1|643389_644166_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_003244027.1|644162_645365_-	MFS transporter	NA	NA	NA	NA	NA
WP_003243042.1|645469_647113_-	catalase	NA	A0A2K9L572	Tupanvirus	45.2	1.4e-97
>prophage 53
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	657139	659835	4211343		Pseudomonas_phage(50.0%)	2	NA	NA
WP_003227327.1|657139_658327_-	D-alanyl-lipoteichoic acid biosynthesis protein DltB	NA	A0A125RNP0	Pseudomonas_phage	27.9	5.2e-22
WP_003242511.1|658323_659835_-	D-alanine--poly(phosphoribitol) ligase subunit DltA	NA	A0A2K9KZV5	Tupanvirus	28.9	8.6e-46
>prophage 54
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	663710	778458	4211343	protease,coat,bacteriocin,tRNA,holin,lysis	Bacillus_phage(27.78%)	115	NA	NA
WP_010886638.1|663710_664952_-|tRNA	tyrosine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003243598.1|665200_665716_-	tyrZ transcriptional regulator YwaE	NA	NA	NA	NA	NA
WP_003242863.1|665866_666580_+	TIGR02206 family membrane protein	NA	NA	NA	NA	NA
WP_003242748.1|666689_667550_+	glycosyltransferase family 8 protein	NA	A0A2P0VP84	Tetraselmis_virus	27.2	2.9e-06
WP_003244589.1|667600_668443_-	transcription antiterminator	NA	NA	NA	NA	NA
WP_003243800.1|668496_669876_-	SacY negative regulator SacX	NA	NA	NA	NA	NA
WP_003243950.1|670303_672241_-|protease	minor protease Epr	protease	A0A1B0T6A2	Bacillus_phage	34.9	2.5e-45
WP_003242539.1|672468_673803_+	PTS cellobiose transporter subunit IIC	NA	NA	NA	NA	NA
WP_003242887.1|673879_674557_+	DUF2711 domain-containing protein	NA	NA	NA	NA	NA
WP_003243380.1|674594_674975_-	glyoxalase GlxA	NA	NA	NA	NA	NA
WP_003244593.1|675095_676286_+	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	42.1	1.3e-73
WP_003243869.1|676320_676518_-	YwbE family protein	NA	NA	NA	NA	NA
WP_003242781.1|676551_677751_-	MFS transporter	NA	NA	NA	NA	NA
WP_003227371.1|677854_678532_-|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_003227375.1|678513_678900_-|holin	CidA/LrgA family holin-like protein	holin	NA	NA	NA	NA
WP_003227377.1|679005_679911_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003244274.1|679918_680737_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_003244128.1|680733_681402_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_003243918.1|681558_683004_+	ferrous ion permease EfeU	NA	NA	NA	NA	NA
WP_003243208.1|683000_684158_+	iron uptake system lipoprotein EfeM	NA	NA	NA	NA	NA
WP_003243445.1|684176_685427_+	deferrochelatase/peroxidase EfeB	NA	NA	NA	NA	NA
WP_003242591.1|685709_686312_+	DsbA family protein	NA	NA	NA	NA	NA
WP_003227390.1|686342_687884_-	cation acetate symporter	NA	NA	NA	NA	NA
WP_003227392.1|687880_688189_-	DUF485 domain-containing protein	NA	NA	NA	NA	NA
WP_003243648.1|688631_688790_-	transcriptional regulator SlrA	NA	NA	NA	NA	NA
WP_003227398.1|689833_690217_+	GtrA family protein	NA	NA	NA	NA	NA
WP_003227400.1|690297_691470_+	galactokinase	NA	NA	NA	NA	NA
WP_003227402.1|691473_693015_+	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_009968363.1|693085_693331_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_010886637.1|693846_694812_+	cytochrome aa3 quinol oxidase subunit II	NA	NA	NA	NA	NA
WP_003227407.1|694839_696789_+	cytochrome aa3 quinol oxidase subunit I	NA	NA	NA	NA	NA
WP_003227409.1|696802_697417_+	Quinol oxidase subunit 3	NA	NA	NA	NA	NA
WP_003227410.1|697418_697793_+	cytochrome aa3 quinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_003227411.1|697835_698099_-	spore morphogenesis/germination protein YwcE	NA	NA	NA	NA	NA
WP_003227413.1|698594_699776_+	cell shape-determining peptidoglycan glycosyltransferase RodA	NA	NA	NA	NA	NA
WP_003244098.1|699881_700631_+	oxygen-insensitive NADPH nitroreductase	NA	NA	NA	NA	NA
WP_003244349.1|700804_701806_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003227419.1|701843_704264_-|protease	serine protease Vpr	protease	A0A217EQY2	Bacillus_phage	36.8	6.9e-21
WP_003222155.1|704793_705096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003243088.1|705135_705966_+	sac operon transcriptional antiterminator SacT	NA	NA	NA	NA	NA
WP_003243563.1|706004_706775_-	formate/nitrite transporter family protein	NA	NA	NA	NA	NA
WP_003227426.1|707076_708462_+	PTS system sucrose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_003227428.1|708458_709898_+	sucrose-6-phosphate hydrolase	NA	S6ATV4	Bacillus_phage	26.3	7.0e-21
WP_003243437.1|709991_710240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003242645.1|710329_711145_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_003227432.1|711288_711627_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003227434.1|711619_712255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009968358.1|712302_712836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003242519.1|712925_713732_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_003242965.1|713745_714423_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	46.1	8.3e-49
WP_003227441.1|714447_715818_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_003243806.1|715985_716303_+	YwdI family protein	NA	NA	NA	NA	NA
WP_010886635.1|716322_717645_+	purine permease	NA	NA	NA	NA	NA
WP_003227446.1|717706_718078_+	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_003227448.1|718121_718667_-|coat	spore coat protein GerQ	coat	NA	NA	NA	NA
WP_003244383.1|718986_719757_+|coat	spore coat dTDP-glycosyltransferase SpsA	coat	A0A0F7L2F7	uncultured_marine_virus	28.6	3.4e-06
WP_003243510.1|719761_721186_+	CDP-glycerol glycerophosphotransferase family protein	NA	NA	NA	NA	NA
WP_003243878.1|721206_722376_+	DegT/DnrJ/EryC1/StrS aminotransferase family protein	NA	A0A1D8KU11	Synechococcus_phage	26.6	5.5e-16
WP_003243179.1|722376_723246_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003243135.1|723245_724367_+|coat	spore coat biosynthesis protein SpsE	coat	NA	NA	NA	NA
WP_003243421.1|724359_725082_+|coat	spore coat polysaccharide biosynthesis protein SpsF	coat	NA	NA	NA	NA
WP_003244190.1|725084_726104_+|coat	spore coat polysaccharide biosynthesis protein SpsG	coat	NA	NA	NA	NA
WP_003243368.1|726128_726869_+	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	41.9	2.6e-48
WP_003244201.1|726868_727816_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	43.8	4.4e-72
WP_003242585.1|727829_728681_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	38.5	4.1e-37
WP_003242881.1|728673_729129_+|coat	spore coat polysaccharide biosynthesis protein SpsL	coat	NA	NA	NA	NA
WP_003242493.1|729452_729917_+	biofilm-surface layer protein BslB	NA	NA	NA	NA	NA
WP_003227482.1|730093_731368_+	glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_003243454.1|731594_733142_+	L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_003227487.1|733215_734916_+	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_003244348.1|734915_736328_+	amino acid permease	NA	NA	NA	NA	NA
WP_003242790.1|736537_737776_+	MFS transporter	NA	NA	NA	NA	NA
WP_009968341.1|737927_738542_+	prephenate decarboxylase	NA	NA	NA	NA	NA
WP_003244300.1|738531_739239_+	3-((4R)-4-hydroxycyclohexa-1, 5-dien-1-yl)-2-oxopropanoate isomerase	NA	NA	NA	NA	NA
WP_003243359.1|739241_740003_+	dihydroanticapsin 7-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.9	2.8e-21
WP_003242921.1|740021_741440_+	alanine--anticapsin ligase	NA	NA	NA	NA	NA
WP_003244502.1|741436_742621_+	bacilysin exporter BacE	NA	NA	NA	NA	NA
WP_003242568.1|742621_743821_+	transaminase BacF	NA	NA	NA	NA	NA
WP_003244095.1|743835_744615_-	NADPH-dependent reductase BacG	NA	NA	NA	NA	NA
WP_003242896.1|744747_745512_-	heme-dependent peroxidase	NA	NA	NA	NA	NA
WP_003243393.1|745781_746753_+	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_003243173.1|746899_747799_+	cysJI operon transcriptional regulator CysL	NA	A0A2H4J8I9	uncultured_Caudovirales_phage	42.5	3.6e-07
WP_003227511.1|747847_748693_+	octanoyl-[GcvH]:protein N-octanoyltransferase	NA	NA	NA	NA	NA
WP_003242581.1|748860_749751_+	DMT family transporter	NA	NA	NA	NA	NA
WP_003243464.1|749894_750671_-	prespore-specific transcription regulator RsfA	NA	A0A1D6X8E5	Bacillus_phage	50.0	7.6e-06
WP_003222050.1|750885_751110_+	DUF1450 domain-containing protein	NA	NA	NA	NA	NA
WP_003243873.1|751271_752573_+	HD domain-containing protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	28.9	4.2e-25
WP_003227524.1|752608_753109_+	YwgA family protein	NA	NA	NA	NA	NA
WP_003243988.1|753220_753691_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_003243441.1|753690_755091_+	MFS transporter	NA	NA	NA	NA	NA
WP_003243399.1|755935_757852_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	43.2	6.2e-142
WP_003242889.1|757971_758391_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003222038.1|758433_758622_-	2-hydroxymuconate tautomerase	NA	NA	NA	NA	NA
WP_003243167.1|758730_759390_+|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003244446.1|759403_759922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003227540.1|760214_762290_-	penicillin-binding protein	NA	NA	NA	NA	NA
WP_003227543.1|762491_763322_+	spermidine synthase	NA	NA	NA	NA	NA
WP_003227545.1|763382_764255_+	agmatinase	NA	NA	NA	NA	NA
WP_003227547.1|764286_764760_-	YbaK/EbsC family protein	NA	NA	NA	NA	NA
WP_009968329.1|764858_764978_-	phosphatase RapF inhibitor PhrF	NA	NA	NA	NA	NA
WP_003227549.1|764961_766107_-	response regulator aspartate phosphatase RapF	NA	A0A1P8CWN8	Bacillus_phage	43.5	1.7e-78
WP_009968328.1|766109_766340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003227552.1|766336_767692_+	YncE family protein	NA	NA	NA	NA	NA
WP_003244415.1|767730_769107_+	YncE family protein	NA	NA	NA	NA	NA
WP_003243391.1|769112_769814_-|bacteriocin	antilisterial bacteriocin subtilosin biosynthesis protein AlbG	bacteriocin	NA	NA	NA	NA
WP_003242974.1|769810_771091_-	insulinase family protein	NA	NA	NA	NA	NA
WP_010886633.1|771095_772256_-	insulinase family protein	NA	NA	NA	NA	NA
WP_003243158.1|772245_773556_-|bacteriocin	antilisterial bacteriocin subtilosin biosynthesis protein AlbD	bacteriocin	NA	NA	NA	NA
WP_003227564.1|773548_774268_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.2	7.3e-19
WP_003222006.1|774264_774426_-|bacteriocin	antilisterial bacteriocin subtilosin biosynthesis protein AlbB	bacteriocin	NA	NA	NA	NA
WP_003242599.1|774438_775785_-	subtilosin maturase AlbA	NA	NA	NA	NA	NA
WP_010886632.1|775809_775962_-|bacteriocin	bacteriocin-like protein SboX	bacteriocin	NA	NA	NA	NA
WP_003222002.1|775918_776050_-|bacteriocin	subtilosin A family bacteriocin	bacteriocin	NA	NA	NA	NA
WP_003243604.1|776362_776791_+	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
WP_003227570.1|776787_778458_+|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
>prophage 55
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	785838	787302	4211343		Escherichia_phage(100.0%)	1	NA	NA
WP_003244173.1|785838_787302_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	43.6	3.2e-21
>prophage 56
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	790626	794245	4211343		Bacillus_phage(100.0%)	4	NA	NA
WP_009968321.1|790626_792354_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	31.2	9.2e-60
WP_003227595.1|792363_792888_+	dihydrofolate reductase	NA	NA	NA	NA	NA
WP_003227597.1|792929_793202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003227599.1|793282_794245_-	UV DNA damage repair endonuclease UvsE	NA	A0A127AW32	Bacillus_phage	34.6	5.9e-40
>prophage 57
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	799807	804354	4211343		Only_Syngen_Nebraska_virus(33.33%)	5	NA	NA
WP_003227612.1|799807_801415_+	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	52.1	1.0e-153
WP_003242809.1|801496_802018_-	DUF2529 domain-containing protein	NA	NA	NA	NA	NA
WP_003227621.1|802183_802558_+	sporulation initiation phosphotransferase Spo0F	NA	W8CYM9	Bacillus_phage	36.5	2.9e-11
WP_003243339.1|802738_803596_+	fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_003227626.1|803715_804354_+	fructose-6-phosphate aldolase	NA	A0A0E3FQP8	Synechococcus_phage	45.0	7.3e-47
>prophage 58
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	809115	809703	4211343		Bacillus_virus(100.0%)	1	NA	NA
WP_003243018.1|809115_809703_+	thymidine kinase	NA	G3MBK1	Bacillus_virus	46.4	1.4e-36
>prophage 59
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	813952	815023	4211343		Pseudomonas_phage(100.0%)	1	NA	NA
WP_003227645.1|813952_815023_+	peptide chain release factor 1	NA	A0A0S4KWG0	Pseudomonas_phage	40.0	3.1e-05
>prophage 60
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	818098	822918	4211343		Pandoravirus(50.0%)	6	NA	NA
WP_003227659.1|818098_819139_+	threonylcarbamoyl-AMP synthase	NA	A0A291ATS8	Pandoravirus	42.6	2.2e-61
WP_003227661.1|819217_819775_+	manganese efflux pump	NA	NA	NA	NA	NA
WP_003227664.1|819850_820303_+	low molecular weight protein arginine phosphatase	NA	NA	NA	NA	NA
WP_003221910.1|820459_820909_+	ribose 5-phosphate isomerase B	NA	NA	NA	NA	NA
WP_003227667.1|820921_821464_+	TIGR01440 family protein	NA	NA	NA	NA	NA
WP_003227669.1|821670_822918_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	51.7	1.5e-99
>prophage 61
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	834354	835386	4211343		Pseudomonas_phage(100.0%)	1	NA	NA
WP_003243408.1|834354_835386_+	stage II sporulation protein D	NA	Q2XU88	Pseudomonas_phage	37.2	5.0e-37
>prophage 62
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	839974	841108	4211343		Bacillus_phage(100.0%)	1	NA	NA
WP_003227715.1|839974_841108_+	response regulator aspartate phosphatase RapB	NA	A0A1P8CWN8	Bacillus_phage	45.5	1.7e-86
>prophage 63
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	851556	852408	4211343		Clostridium_phage(100.0%)	1	NA	NA
WP_003227751.1|851556_852408_+	stage II sporulation protein spoIIQ	NA	I3PV24	Clostridium_phage	36.1	1.4e-05
>prophage 64
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	863407	863689	4211343		Clostridium_phage(100.0%)	1	NA	NA
WP_003221804.1|863407_863689_+	sporulation transcriptional regulator SpoIIID	NA	M9Q261	Clostridium_phage	50.7	9.4e-15
>prophage 65
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	871562	887690	4211343		Bacillus_phage(33.33%)	17	NA	NA
WP_003227798.1|871562_871904_+	single-stranded DNA-binding protein	NA	A8ASP5	Listeria_phage	66.0	2.6e-35
WP_003244075.1|872127_872904_+	transcriptional regulator GlcR	NA	NA	NA	NA	NA
WP_003242946.1|872909_873767_+	HAD family phosphatase	NA	NA	NA	NA	NA
WP_003227803.1|873892_876661_-	DEAD/DEAH box helicase	NA	V9XTV7	Choristoneura_murinana_nucleopolyhedrovirus	27.5	1.3e-39
WP_003227806.1|876647_878258_-	SWIM zinc finger family protein	NA	NA	NA	NA	NA
WP_003242876.1|878461_878605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003227811.1|878838_879585_+	protein-tyrosine kinase activator TkmA	NA	NA	NA	NA	NA
WP_003244182.1|879574_880288_+	tyrosine-protein kinase PtkA	NA	A0A1X9I5D6	Streptococcus_phage	38.3	5.5e-27
WP_003227815.1|880340_881105_+	tyrosine-protein phosphatase	NA	NA	NA	NA	NA
WP_003243223.1|881299_882622_+	UDP-glucose 6-dehydrogenase UglF	NA	A0A127AXI2	Bacillus_phage	39.3	6.7e-87
WP_003244223.1|882813_883599_+	DUF1963 domain-containing protein	NA	NA	NA	NA	NA
WP_119123079.1|883648_883774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003242741.1|883990_884413_+	DUF5082 domain-containing protein	NA	NA	NA	NA	NA
WP_003221757.1|884422_884683_+	YwqI/YxiC family protein	NA	NA	NA	NA	NA
WP_003243987.1|884701_886510_+	ribonuclease YeeF family protein	NA	A0A1P8CWI7	Bacillus_phage	36.0	2.1e-38
WP_003243602.1|886499_886964_+	toxin-antitoxin system YwqK family antitoxin	NA	NA	NA	NA	NA
WP_003243213.1|886973_887690_+	endonuclease V	NA	A0A1V0SJW5	Klosneuvirus	30.4	2.5e-19
>prophage 66
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	898164	900612	4211343		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_010886626.1|898164_899493_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	29.5	8.4e-45
WP_003227859.1|899703_900612_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	25.6	8.9e-14
>prophage 67
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	906946	908428	4211343		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_003244379.1|906946_908428_-	ribose ABC transporter ATP-binding protein RbsA	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.0	6.5e-14
>prophage 68
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	914611	919577	4211343		Bacillus_phage(50.0%)	4	NA	NA
WP_003242751.1|914611_915853_+	gamma-DL-glutamyl hydrolase	NA	S5MM68	Bacillus_phage	42.0	1.4e-17
WP_003244395.1|915886_916747_-	HAD family phosphatase	NA	NA	NA	NA	NA
WP_003243404.1|916902_917871_-	polyisoprenyl-teichoic acid--peptidoglycan teichoic acid transferase TagT	NA	NA	NA	NA	NA
WP_003243731.1|918203_919577_+	sugar porter family MFS transporter	NA	O13311	Aichi_virus	30.7	3.9e-37
>prophage 69
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	924641	931529	4211343		Staphylococcus_virus(33.33%)	5	NA	NA
WP_003243594.1|924641_927284_+	beta-N-acetylglucosaminidase LytD	NA	Q4ZC50	Staphylococcus_virus	44.9	3.0e-38
WP_003243411.1|927343_928672_-	major teichoic acid biosynthesis protein C	NA	A0A1J0MII7	Staphylococcus_phage	29.3	6.2e-24
WP_009968271.1|928791_929937_-	teichoic acid glycerol-phosphate primase	NA	NA	NA	NA	NA
WP_003227919.1|929969_930740_-	N-acetylglucosaminyldiphosphoundecaprenol N-acetyl-beta-D- mannosaminyltransferase	NA	NA	NA	NA	NA
WP_003227921.1|931139_931529_+	glycerol-3-phosphate cytidylyltransferase	NA	A0A1V0SGE7	Hokovirus	42.6	1.7e-17
>prophage 70
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	936962	939160	4211343		Staphylococcus_phage(50.0%)	2	NA	NA
WP_003227930.1|936962_938546_+	teichoic acids export ABC transporter ATP-binding subunit TagH	NA	A0A2H4PQG7	Staphylococcus_phage	29.0	3.6e-18
WP_100086173.1|938584_939160_-	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	47.3	3.5e-40
>prophage 71
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	945602	952991	4211343		Bacillus_phage(25.0%)	6	NA	NA
WP_003227944.1|945602_946481_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	54.7	3.3e-82
WP_003243178.1|946726_947869_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A0N9R0B2	Chrysochromulina_ericina_virus	33.0	2.6e-26
WP_003227949.1|947908_948829_-	transcription antiterminator LytR	NA	NA	NA	NA	NA
WP_003242772.1|949012_949321_+	membrane-bound protein LytA	NA	NA	NA	NA	NA
WP_003243620.1|949344_951462_+	SpoIID/LytB domain-containing protein	NA	Q2XU88	Pseudomonas_phage	27.6	6.7e-12
WP_003242758.1|951500_952991_+	N-acetylmuramoyl-L-alanine amidase LytC	NA	A0A0N9SGH1	Paenibacillus_phage	39.4	3.3e-21
>prophage 72
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	956611	961039	4211343		Bacillus_phage(50.0%)	4	NA	NA
WP_003242596.1|956611_957997_+	UDP-glucose 6-dehydrogenase TuaD	NA	A0A127AXI2	Bacillus_phage	42.3	4.4e-89
WP_010886625.1|958081_959548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003243110.1|959576_960257_+	teichuronic acid biosynthesis protein TuaF	NA	NA	NA	NA	NA
WP_003242619.1|960280_961039_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	35.4	9.4e-17
>prophage 73
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	964729	969969	4211343		Streptococcus_phage(66.67%)	5	NA	NA
WP_003227979.1|964729_965383_-	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	43.1	5.8e-39
WP_003227983.1|965599_966757_+	two-component sensor histidine kinase DegS	NA	NA	NA	NA	NA
WP_003219701.1|966839_967529_+	two-component system response regulator DegU	NA	NA	NA	NA	NA
WP_003244125.1|967626_968472_+	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	34.6	7.5e-15
WP_003243962.1|968577_969969_+	ATP-dependent helicase ComFA	NA	A0A1X9I5S6	Streptococcus_phage	37.6	1.1e-66
>prophage 74
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	975865	976090	4211343		Vibrio_phage(100.0%)	1	NA	NA
WP_003219727.1|975865_976090_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	50.0	2.6e-07
>prophage 75
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	986628	989780	4211343	protease	Planktothrix_phage(50.0%)	3	NA	NA
WP_003228039.1|986628_987315_+	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	34.0	1.7e-25
WP_009968247.1|987307_988198_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003228041.1|988337_989780_+|protease	carboxy-terminal processing protease CtpB	protease	A0A0R6PIZ1	Moraxella_phage	27.8	6.3e-22
>prophage 76
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	999197	1002071	4211343		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_003228057.1|999197_1002071_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	57.5	0.0e+00
>prophage 77
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	1007567	1008314	4211343	tRNA	Powai_lake_megavirus(100.0%)	1	NA	NA
WP_003242712.1|1007567_1008314_+|tRNA	tRNA-dependent cyclodipeptide synthase	tRNA	A0A167R1P4	Powai_lake_megavirus	20.8	1.3e-05
>prophage 78
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	1032620	1042562	4211343		Bacillus_phage(33.33%)	8	NA	NA
WP_003243345.1|1032620_1034390_+	multidrug resistance ABC transporter ATP-binding protein/permease BmrA	NA	W8CYL7	Bacillus_phage	59.1	1.8e-164
WP_003242799.1|1034515_1035970_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_009968231.1|1036350_1037772_+	peptidoglycan DL-endopeptidase CwlO	NA	A0A0A0RVE6	Bacillus_phage	50.9	1.3e-24
WP_003243021.1|1037977_1038928_+	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	54.5	1.2e-88
WP_010886622.1|1039245_1039722_+	8-oxo-dGTP diphosphatase	NA	NA	NA	NA	NA
WP_003243903.1|1039746_1040634_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.0	8.7e-06
WP_003244450.1|1040635_1041589_+	gluconeogenesis morphogenetic factor	NA	A1IMD5	Streptococcus_phage	41.1	4.0e-65
WP_003243775.1|1041611_1042562_+	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	38.4	5.6e-51
>prophage 79
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	1045859	1046639	4211343		Planktothrix_phage(100.0%)	1	NA	NA
WP_003228167.1|1045859_1046639_+	lantibiotic ABC transporter ATP-binding protein PsdA	NA	G9BWD6	Planktothrix_phage	34.4	3.2e-28
>prophage 80
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	1050563	1053195	4211343		uncultured_Caudovirales_phage(33.33%)	3	NA	NA
WP_003244488.1|1050563_1052156_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	28.2	1.5e-45
WP_003242570.1|1052182_1052503_-	hypothetical protein	NA	G3MBI9	Bacillus_virus	42.3	2.3e-17
WP_003228180.1|1052619_1053195_+	LOG family protein YvdD	NA	A0A1V0S9E9	Catovirus	27.1	3.8e-10
>prophage 81
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	1064581	1065901	4211343		Paramecium_bursaria_Chlorella_virus(50.0%)	2	NA	NA
WP_003228210.1|1064581_1065262_+	beta-phosphoglucomutase	NA	A7ITQ4	Paramecium_bursaria_Chlorella_virus	26.2	7.1e-08
WP_003228214.1|1065307_1065901_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.8	2.6e-54
>prophage 82
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	1073077	1087718	4211343		Bacillus_phage(20.0%)	14	NA	NA
WP_003243729.1|1073077_1074628_-	2,6-beta-fructan 6-levanbiohydrolase	NA	F8WPR5	Bacillus_phage	42.9	7.6e-98
WP_001022105.1|1074701_1076123_-	levansucrase	NA	NA	NA	NA	NA
WP_003243737.1|1076661_1078017_+	serine hydrolase	NA	A0A1D8EXR7	Mycobacterium_phage	24.4	2.7e-14
WP_003244427.1|1078032_1078716_+	broad specificity amino-acid racemase RacX	NA	NA	NA	NA	NA
WP_075058867.1|1078948_1079302_+	DUF3237 domain-containing protein	NA	NA	NA	NA	NA
WP_003243190.1|1079324_1079810_+	phenolic acid decarboxylase	NA	NA	NA	NA	NA
WP_003228241.1|1079836_1080028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065826285.1|1080030_1081500_-	para-nitrobenzyl esterase	NA	A0A0M4JT58	Mollivirus	33.1	3.5e-36
WP_003242589.1|1081575_1082034_-	transcriptional regulator SlrR	NA	NA	NA	NA	NA
WP_003228247.1|1082279_1082984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003228249.1|1082989_1083673_+	protein tyrosine kinase EpsB	NA	NA	NA	NA	NA
WP_003244548.1|1083931_1085728_+	polysaccharide biosynthesis protein	NA	K7Y9E1	Megavirus	30.6	2.6e-25
WP_003242735.1|1085739_1086885_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_003244557.1|1086881_1087718_+	glycosyltransferase EpsE	NA	A0A1V0SAH6	Catovirus	39.6	1.7e-14
>prophage 83
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	1095906	1097073	4211343		Tupanvirus(100.0%)	1	NA	NA
WP_009968194.1|1095906_1097073_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	A0A2K9L0G1	Tupanvirus	32.4	5.7e-29
>prophage 84
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	1102484	1103477	4211343		Enterobacteria_phage(100.0%)	1	NA	NA
WP_003244199.1|1102484_1103477_+	galactan degradation operon transcriptional regulator GanR	NA	C6ZCU4	Enterobacteria_phage	22.3	8.0e-08
>prophage 85
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	1112878	1113784	4211343		Staphylococcus_phage(100.0%)	1	NA	NA
WP_003228295.1|1112878_1113784_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	32.2	6.8e-22
>prophage 86
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	1119446	1120481	4211343		Microbacterium_phage(100.0%)	1	NA	NA
WP_003228311.1|1119446_1120481_+	glycosylase	NA	A0A2P1CFB9	Microbacterium_phage	24.9	9.8e-09
>prophage 87
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	1134288	1135581	4211343		Streptococcus_phage(100.0%)	1	NA	NA
WP_003228333.1|1134288_1135581_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	71.5	6.4e-175
>prophage 88
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	1141133	1160888	4211343	holin	Thermus_phage(28.57%)	24	NA	NA
WP_003243370.1|1141133_1142276_+|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	W6JKT0	Anomala_cuprea_entomopoxvirus	29.3	6.2e-12
WP_003228349.1|1142298_1142952_+|holin	glycine betaine/carnitine/choline/choline sulfate ABC transporter permease OpuCB	holin	NA	NA	NA	NA
WP_003228350.1|1142971_1143883_+	osmoprotectant ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003244403.1|1143900_1144590_+|holin	glycine betaine/carnitine/choline/choline sulfate ABC transporter permease OpuCD	holin	NA	NA	NA	NA
WP_003243541.1|1144809_1145082_+	sporulation delaying system autorepressor SdpR	NA	NA	NA	NA	NA
WP_003228357.1|1145078_1145702_+	immunity protein SdpI	NA	NA	NA	NA	NA
WP_003243360.1|1145748_1146360_-	sporulation delaying protein SdpC	NA	NA	NA	NA	NA
WP_003228363.1|1146402_1147374_-	sporulation-delaying protein SdpB	NA	NA	NA	NA	NA
WP_009968174.1|1147370_1147847_-	sporulation-delaying system protein SdpA	NA	NA	NA	NA	NA
WP_003243347.1|1148068_1148602_-	GbsR/MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003242811.1|1148885_1150031_+|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	F2Y2R6	Organic_Lake_phycodnavirus	32.7	6.0e-15
WP_003228370.1|1150047_1150701_+|holin	choline ABC transporter permease OpuBB	holin	NA	NA	NA	NA
WP_003228372.1|1150712_1151633_+	osmoprotectant ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003228374.1|1151649_1152330_+|holin	choline ABC transporter permease OpuBD	holin	NA	NA	NA	NA
WP_003228375.1|1152369_1154070_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.1	2.7e-24
WP_003242888.1|1154194_1154521_-	catDE operon transcriptional regulator CatR	NA	NA	NA	NA	NA
WP_003228377.1|1154612_1155032_-	helix-turn-helix transcriptional regulator	NA	S6C481	Thermus_phage	62.7	5.4e-14
WP_003220034.1|1155061_1155469_-	transcriptional repressor RghR	NA	S6C481	Thermus_phage	64.8	1.9e-16
WP_009968172.1|1155620_1155854_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003228381.1|1155893_1156664_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003220028.1|1156812_1157043_+	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_003242610.1|1157174_1157915_+	carboxylesterase	NA	NA	NA	NA	NA
WP_003228386.1|1157933_1160273_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	42.9	2.4e-87
WP_003220025.1|1160417_1160888_+	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	63.4	3.2e-47
>prophage 89
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	1168606	1173283	4211343		uncultured_virus(50.0%)	2	NA	NA
WP_003242925.1|1168606_1171015_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	37.8	6.5e-120
WP_014906546.1|1171174_1173283_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	36.1	5.0e-116
>prophage 90
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	1184556	1190364	4211343		Staphylococcus_phage(33.33%)	6	NA	NA
WP_003243374.1|1184556_1185387_+	glyoxal/methylglyoxal reductase	NA	A0A2H4PQR8	Staphylococcus_phage	56.8	2.0e-81
WP_014906541.1|1185417_1186110_-	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_003243706.1|1186081_1186864_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003243439.1|1186974_1187901_+	excisionase family DNA-binding protein	NA	NA	NA	NA	NA
WP_003243932.1|1187928_1189782_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	35.6	1.7e-88
WP_003228444.1|1189881_1190364_-	metal-dependent hydrolase	NA	A0A127AVX7	Bacillus_phage	31.4	1.3e-08
>prophage 91
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	1195939	1198786	4211343		Only_Syngen_Nebraska_virus(50.0%)	3	NA	NA
WP_003243882.1|1195939_1196749_+	ABC transporter ATP-binding protein	NA	A0A1J0FA64	Only_Syngen_Nebraska_virus	26.9	1.1e-10
WP_003243035.1|1196919_1198113_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_003242701.1|1198096_1198786_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.3	1.6e-39
>prophage 92
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	1203069	1205522	4211343		Bacillus_phage(100.0%)	2	NA	NA
WP_003243545.1|1203069_1203783_+	two-component system response regulator YvrH	NA	W8CYM9	Bacillus_phage	36.5	7.9e-34
WP_003243980.1|1203779_1205522_+	two-component system sensor histidine kinase YvrG	NA	W8CYF6	Bacillus_phage	24.2	9.7e-17
>prophage 93
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	1208605	1210995	4211343		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_009968147.1|1208605_1209667_+	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	28.5	1.2e-17
WP_010886611.1|1209666_1210995_+	ATP-binding cassette domain-containing protein	NA	A0A2H4UU96	Bodo_saltans_virus	25.6	6.9e-07
>prophage 94
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	1225734	1228571	4211343	protease	Bacillus_phage(33.33%)	3	NA	NA
WP_003228529.1|1225734_1226412_-	secretion stress-responsive two-component system response regulator CssR	NA	W8CYM9	Bacillus_phage	34.1	2.4e-27
WP_003228534.1|1226689_1228066_+|protease	serine protease Do-like protein HtrB	protease	A0A1B1IT49	uncultured_Mediterranean_phage	30.4	2.3e-21
WP_003228537.1|1228109_1228571_-	metalloregulation DNA-binding stress protein MgrA	NA	A0A0A7RTZ1	Clostridium_phage	49.6	9.1e-31
>prophage 95
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	1232196	1233024	4211343		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_010886609.1|1232196_1233024_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.7	5.4e-10
>prophage 96
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	1238487	1239396	4211343		Staphylococcus_phage(100.0%)	1	NA	NA
WP_003228569.1|1238487_1239396_+	Proline dehydrogenase 1	NA	A0A2H4PQT6	Staphylococcus_phage	42.2	2.3e-62
>prophage 97
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	1245206	1255125	4211343		Streptococcus_phage(20.0%)	15	NA	NA
WP_003222779.1|1245206_1245563_+	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	54.6	1.8e-23
WP_003222781.1|1245629_1246013_+	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_003228581.1|1246068_1246305_+	YusG family protein	NA	NA	NA	NA	NA
WP_009968134.1|1246304_1246745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003228585.1|1246746_1247067_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_003228587.1|1247173_1247518_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003242531.1|1247844_1248870_+	methionine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.5	1.4e-31
WP_003228593.1|1248862_1249531_+	methionine ABC transporter permease MetP	NA	NA	NA	NA	NA
WP_003228595.1|1249544_1250369_+	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_003228596.1|1250453_1250831_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_003228600.1|1251024_1251162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003151872.1|1251355_1252141_+	Fe-S cluster assembly ATPase SufC	NA	W5SAS9	Pithovirus	22.7	3.5e-06
WP_003228602.1|1252158_1253472_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_003228604.1|1253471_1254692_+	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	47.8	3.4e-117
WP_003222809.1|1254681_1255125_+	iron-sulfur cluster assembly scaffold protein SufU	NA	A0A2P1CJL8	Mycobacterium_phage	38.7	1.9e-14
>prophage 98
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	1260039	1261026	4211343		Acanthamoeba_polyphaga_mimivirus(100.0%)	1	NA	NA
WP_003243688.1|1260039_1261026_+	SIS domain-containing protein	NA	A0A2L2DN46	Acanthamoeba_polyphaga_mimivirus	23.6	1.9e-09
>prophage 99
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	1266019	1267123	4211343		Mycoplasma_phage(100.0%)	1	NA	NA
WP_003228630.1|1266019_1267123_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	Q6GZ03	Mycoplasma_phage	28.6	3.8e-19
>prophage 100
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	1278986	1281634	4211343		Enterobacteria_phage(100.0%)	2	NA	NA
WP_003244570.1|1278986_1280279_-	uric acid permease PucK	NA	Q9KX94	Enterobacteria_phage	29.5	6.5e-26
WP_003243942.1|1280284_1281634_-	uric acid permease PucJ	NA	Q9KX94	Enterobacteria_phage	28.3	1.8e-26
>prophage 101
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	1289700	1290681	4211343		Microcystis_phage(100.0%)	1	NA	NA
WP_003243462.1|1289700_1290681_-	L-Ala--D-Glu endopeptidase	NA	A0A075BS18	Microcystis_phage	37.3	3.0e-07
>prophage 102
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	1294133	1294634	4211343		Bacillus_virus(100.0%)	1	NA	NA
WP_003243814.1|1294133_1294634_-	phosphatidylglycerophosphatase A	NA	G3MBC5	Bacillus_virus	56.0	1.2e-41
>prophage 103
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	1301414	1315719	4211343	protease	Prochlorococcus_phage(14.29%)	18	NA	NA
WP_003151955.1|1301414_1301651_-	NifU family protein	NA	Q58MC7	Prochlorococcus_phage	44.3	2.9e-09
WP_003242597.1|1301849_1302176_+	YuzD family protein	NA	NA	NA	NA	NA
WP_003242518.1|1302201_1303269_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003222913.1|1303531_1303768_+	YuzB family protein	NA	NA	NA	NA	NA
WP_003243750.1|1303904_1305119_+	NupC/NupG family nucleoside CNT transporter	NA	B2YG43	Musca_hytrovirus	22.3	2.7e-13
WP_003243745.1|1305241_1306096_+	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_003244166.1|1306174_1306537_+	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7M3	Lake_Baikal_phage	45.3	1.4e-18
WP_003244000.1|1306874_1307393_+	spermidine/spermine N(1)-acetyltransferase	NA	NA	NA	NA	NA
WP_003244329.1|1307416_1308040_+|protease	protease synthase/sporulation negative transcriptional regulator PaiB	protease	NA	NA	NA	NA
WP_003244278.1|1308113_1309094_-	GMP reductase	NA	G3MBI2	Bacillus_virus	85.5	4.3e-163
WP_003228723.1|1309372_1309513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003220618.1|1309551_1310550_-	NAD(P)/FAD-dependent oxidoreductase	NA	Q9JRK7	Streptococcus_phage	52.4	4.7e-32
WP_010886605.1|1310881_1312102_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003243733.1|1312274_1312418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003243877.1|1312471_1312792_+	membrane protein	NA	NA	NA	NA	NA
WP_009969090.1|1312895_1313552_+	stationary phase survival protein SpsC	NA	A0A217ER34	Bacillus_phage	31.8	7.4e-10
WP_003244337.1|1313582_1314059_-	divergent PAP2 family protein	NA	NA	NA	NA	NA
WP_003228733.1|1314216_1315719_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	35.3	1.3e-57
>prophage 104
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	1324480	1331617	4211343		Tupanvirus(100.0%)	1	NA	NA
WP_009968094.1|1324480_1331617_+	nonribosomal peptide synthetase DhbF	NA	A0A2K9KZV5	Tupanvirus	26.8	1.9e-98
>prophage 105
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	1337734	1342222	4211343		Mycobacterium_phage(100.0%)	1	NA	NA
WP_003243866.1|1337734_1342222_+	type VII secretion protein EssC	NA	V5UPA0	Mycobacterium_phage	21.7	2.8e-36
>prophage 106
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	1351260	1352733	4211343		Bacillus_virus(100.0%)	1	NA	NA
WP_003228788.1|1351260_1352733_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	45.8	6.5e-107
>prophage 107
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	1366019	1371051	4211343		Dickeya_phage(50.0%)	4	NA	NA
WP_003244241.1|1366019_1367366_-	sodium/malate symporter MaeN	NA	A0A140XAH4	Dickeya_phage	48.4	8.8e-18
WP_003228827.1|1367519_1368479_-	guanosine ABC transporter permease NupQ	NA	NA	NA	NA	NA
WP_003243735.1|1368479_1369526_-	guanosine ABC transporter permease NupP	NA	NA	NA	NA	NA
WP_003228830.1|1369518_1371051_-	guanosine ABC transporter ATP-binding protein NupO	NA	A0A2R8FG22	Brazilian_cedratvirus	26.3	3.6e-07
>prophage 108
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	1383733	1384555	4211343		Mycobacterium_phage(100.0%)	1	NA	NA
WP_003228858.1|1383733_1384555_-	alpha/beta hydrolase	NA	A0A0B5A484	Mycobacterium_phage	27.5	3.3e-07
>prophage 109
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	1392295	1393282	4211343		Lactobacillus_phage(100.0%)	1	NA	NA
WP_003242502.1|1392295_1393282_-	potassium channel protein KbfO	NA	A0A1B0Y2S3	Lactobacillus_phage	34.8	4.8e-05
>prophage 110
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	1399702	1408069	4211343		uncultured_Caudovirales_phage(100.0%)	4	NA	NA
WP_003243461.1|1399702_1401691_+	methyl-accepting chemotaxis protein McpB	NA	A0A2H4J162	uncultured_Caudovirales_phage	53.4	4.4e-13
WP_003243846.1|1401867_1403856_+	methyl-accepting chemotaxis protein TlpA	NA	A0A2H4J162	uncultured_Caudovirales_phage	60.7	2.5e-16
WP_003244077.1|1403981_1405967_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	32.2	3.4e-26
WP_003243983.1|1406080_1408069_+	methyl-accepting chemotaxis protein TlpB	NA	A0A2H4J162	uncultured_Caudovirales_phage	52.0	1.2e-15
>prophage 111
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	1420453	1421302	4211343		Brevibacillus_phage(100.0%)	1	NA	NA
WP_003228938.1|1420453_1421302_+	exo-glucosaminidase LytG	NA	A0A0K2CP65	Brevibacillus_phage	41.1	1.0e-24
>prophage 112
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	1430141	1431671	4211343		Orpheovirus(100.0%)	1	NA	NA
WP_003228960.1|1430141_1431671_+	flotillin lipid rafts scaffold protein FloT	NA	A0A2I2L4B2	Orpheovirus	27.9	2.7e-07
>prophage 113
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	1446004	1448401	4211343		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_004399110.1|1446004_1448401_+	glycogen/starch/alpha-glucan phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	40.2	1.5e-12
>prophage 114
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	1454177	1457401	4211343		Bacillus_phage(66.67%)	3	NA	NA
WP_003229036.1|1454177_1455128_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A1V0SKV4	Klosneuvirus	32.9	4.9e-31
WP_004398478.1|1455124_1456411_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	34.8	3.0e-71
WP_003229044.1|1456582_1457401_+	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.2	8.2e-51
>prophage 115
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	1463325	1467869	4211343		Staphylococcus_phage(50.0%)	4	NA	NA
WP_003229056.1|1463325_1464786_+	o-succinylbenzoate--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	32.9	5.0e-75
WP_004398737.1|1464782_1465898_+	o-succinylbenzoate synthase	NA	NA	NA	NA	NA
WP_003229060.1|1466177_1467098_+	manganese ABC transporter substrate-binding protein/adhesin MntA	NA	NA	NA	NA	NA
WP_004398644.1|1467116_1467869_+	manganese ABC transporter ATP-binding protein MntB	NA	A0A1V0SE00	Indivirus	27.1	6.0e-16
>prophage 116
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	1473811	1496857	4211343	holin	Staphylococcus_phage(58.33%)	28	NA	NA
WP_003229076.1|1473811_1474039_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	70.3	2.8e-25
WP_003219361.1|1474167_1474641_+	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_004398648.1|1474760_1475198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010886599.1|1475191_1475368_-	YtzI protein	NA	NA	NA	NA	NA
WP_003229083.1|1475460_1475898_+	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	61.4	1.3e-47
WP_003229085.1|1476063_1476468_+|holin	holin family protein	holin	NA	NA	NA	NA
WP_003229087.1|1476676_1477153_+	nucleoside triphosphatase YtkD	NA	NA	NA	NA	NA
WP_003229090.1|1477179_1477992_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003229092.1|1477966_1478749_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.4	7.4e-33
WP_003245977.1|1478761_1479766_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003246204.1|1479916_1480690_+	S9 family peptidase	NA	A0A2H4PQM6	Staphylococcus_phage	41.9	5.8e-38
WP_004398611.1|1480741_1480984_+	DUF2584 domain-containing protein	NA	NA	NA	NA	NA
WP_003229100.1|1481022_1482606_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	64.2	6.2e-196
WP_003229102.1|1483108_1484311_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	74.6	4.3e-165
WP_004398625.1|1484460_1486359_+	asparagine synthase (glutamine-hydrolyzing)	NA	R4TIC1	Phaeocystis_globosa_virus	29.4	4.3e-34
WP_003229105.1|1486494_1487886_+	amino acid permease	NA	NA	NA	NA	NA
WP_004399093.1|1488130_1488646_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_004398545.1|1488694_1489474_+	phospholipase YtpA	NA	A0A220T682	Eptesipox_virus	25.7	3.6e-11
WP_004399076.1|1489494_1490598_+	tetraprenyl-beta-curcumene synthase	NA	NA	NA	NA	NA
WP_004398483.1|1490587_1491172_-	16S rRNA (cytosine(1402)-N(4))-methyltransferase	NA	A0A2H4PQV0	Staphylococcus_phage	52.1	1.3e-45
WP_009968016.1|1491168_1492137_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	75.2	4.2e-54
WP_003229117.1|1492298_1492571_+	YtzC family protein	NA	NA	NA	NA	NA
WP_003229119.1|1492725_1492863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003229121.1|1492896_1493289_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004398506.1|1493281_1494160_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.7	5.2e-19
WP_003246175.1|1494153_1495140_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_004398887.1|1495169_1496147_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003229129.1|1496161_1496857_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.8	1.0e-38
>prophage 117
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	1500047	1509507	4211343	tRNA	Staphylococcus_phage(66.67%)	7	NA	NA
WP_003229137.1|1500047_1500809_+	bacitracin ABC transporter ATP-binding protein BceA	NA	G9BWD6	Planktothrix_phage	35.8	6.1e-32
WP_003229139.1|1500798_1502739_+	bacitracin ABC transporter permease BceB	NA	NA	NA	NA	NA
WP_003229141.1|1502775_1503522_-	membrane protein	NA	NA	NA	NA	NA
WP_004398741.1|1503710_1504904_+	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	51.8	2.2e-105
WP_004399022.1|1505140_1505926_-	blue-light photoreceptor	NA	NA	NA	NA	NA
WP_003246114.1|1506330_1506666_+	DUF4257 domain-containing protein	NA	NA	NA	NA	NA
WP_003246072.1|1507092_1509507_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	73.4	0.0e+00
>prophage 118
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	1517446	1519952	4211343		Klosneuvirus(50.0%)	2	NA	NA
WP_004398913.1|1517446_1518793_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.7	1.1e-12
WP_009968008.1|1518782_1519952_+	8-amino-7-oxononanoate synthase	NA	G9E4Q1	Emiliania_huxleyi_virus	29.5	3.0e-38
>prophage 119
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	1533779	1536769	4211343		Vibrio_phage(50.0%)	2	NA	NA
WP_003229220.1|1533779_1535318_-	glycine betaine transporter OpuD	NA	A0A2I7QNT1	Vibrio_phage	26.7	1.2e-21
WP_003229222.1|1535506_1536769_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4PQX1	Staphylococcus_phage	57.9	8.8e-28
>prophage 120
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	1540025	1545685	4211343		Staphylococcus_phage(33.33%)	5	NA	NA
WP_003229230.1|1540025_1540736_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.5	8.5e-20
WP_003229232.1|1540732_1541890_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003229234.1|1541929_1543228_-	hypoxanthine/guanine permease PbuO	NA	A0A0R6PHV4	Moraxella_phage	32.8	4.6e-48
WP_004399126.1|1543324_1544716_+	dipeptidase PepV	NA	NA	NA	NA	NA
WP_003229237.1|1544749_1545685_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	52.9	5.5e-83
>prophage 121
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	1557962	1562411	4211343		Staphylococcus_phage(50.0%)	3	NA	NA
WP_009967991.1|1557962_1558772_+	DUF1444 domain-containing protein	NA	A0A2H4PQY3	Staphylococcus_phage	54.5	9.6e-36
WP_003229269.1|1558787_1559393_+	DUF4479 domain-containing protein	NA	NA	NA	NA	NA
WP_003229272.1|1559552_1562411_+	DNA translocase SftA	NA	S5VNE3	Mycobacterium_phage	49.6	7.0e-89
>prophage 122
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	1565614	1566691	4211343		Cafeteria_roenbergensis_virus(100.0%)	1	NA	NA
WP_003223454.1|1565614_1566691_+	3-deoxy-7-phosphoheptulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	28.5	1.6e-14
>prophage 123
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	1572204	1578440	4211343	tRNA	Staphylococcus_phage(33.33%)	5	NA	NA
WP_004399030.1|1572204_1573923_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	73.2	1.1e-209
WP_003229300.1|1574264_1575533_+|tRNA	Tyrosine--tRNA ligase 1	tRNA	K4F5T3	Cronobacter_phage	43.7	7.7e-80
WP_003229304.1|1575803_1576406_-	30S ribosomal protein S4	NA	NA	NA	NA	NA
WP_003229307.1|1576435_1576618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003229309.1|1576700_1578440_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	33.8	3.8e-21
>prophage 124
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	1586481	1592096	4211343		Bacillus_phage(33.33%)	5	NA	NA
WP_003223491.1|1586481_1586691_+	alpha/beta-type small acid-soluble spore protein	NA	Q77YX0	Bacillus_phage	76.9	4.7e-19
WP_003229331.1|1586869_1588459_+	acyl--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	36.0	1.9e-72
WP_003229333.1|1588478_1590068_+	amidohydrolase	NA	NA	NA	NA	NA
WP_004399091.1|1590099_1590903_-	NAD kinase	NA	NA	NA	NA	NA
WP_003229337.1|1591088_1592096_+	signal peptide peptidase SppA	NA	Q6UYI0	Burkholderia_phage	32.1	1.9e-17
>prophage 125
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	1607010	1611151	4211343		Planktothrix_phage(50.0%)	5	NA	NA
WP_004398701.1|1607010_1607790_+	sulfur-containing amino-acid ABC transporter ATP-binding protein TcyN	NA	G9BWD6	Planktothrix_phage	38.6	6.9e-31
WP_004398798.1|1607786_1608791_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004399148.1|1608805_1609087_+	glutaredoxin family protein	NA	NA	NA	NA	NA
WP_004398733.1|1609083_1610412_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003229393.1|1610458_1611151_+	RNA-binding riboflavin kinase RibR	NA	A0A1V0SD03	Indivirus	30.9	1.5e-05
>prophage 126
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	1617519	1620867	4211343		Streptomyces_phage(100.0%)	1	NA	NA
WP_003229412.1|1617519_1620867_+	DNA polymerase III subunit alpha	NA	A0A291AWR1	Streptomyces_phage	36.1	2.5e-178
>prophage 127
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	1625590	1627348	4211343		Staphylococcus_phage(100.0%)	1	NA	NA
WP_004398560.1|1625590_1627348_+	pyruvate kinase	NA	A0A2H4PQU5	Staphylococcus_phage	50.6	1.0e-13
>prophage 128
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	1631149	1642099	4211343		Bacillus_phage(50.0%)	9	NA	NA
WP_003229433.1|1631149_1632421_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	63.0	1.1e-12
WP_003229437.1|1632464_1633403_+	malate dehydrogenase	NA	NA	NA	NA	NA
WP_003229442.1|1633614_1634337_+	two-component system response regulator PhoP	NA	W8CYM9	Bacillus_phage	43.6	3.5e-45
WP_004398493.1|1634329_1636069_+	sensory box histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	40.6	1.4e-44
WP_004398870.1|1636312_1638955_+	DNA polymerase I	NA	A0A0C5K9B9	Enterococcus_phage	26.7	2.9e-41
WP_003246122.1|1638977_1639808_+	DNA-formamidopyrimidine glycosylase	NA	A0A127AWE5	Bacillus_phage	31.6	5.1e-24
WP_003229449.1|1639973_1640606_+	sporulation membrane protein YtaF	NA	NA	NA	NA	NA
WP_004398928.1|1640621_1641215_+	dephospho-CoA kinase	NA	NA	NA	NA	NA
WP_003229455.1|1641256_1642099_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	54.8	4.2e-82
>prophage 129
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	1645343	1655651	4211343	tRNA	Synechococcus_phage(25.0%)	9	NA	NA
WP_003223584.1|1645343_1645724_+	S-adenosylmethionine decarboxylase proenzyme	NA	Q5GQE8	Synechococcus_phage	41.8	1.6e-17
WP_003223586.1|1645997_1646456_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_003229464.1|1646570_1647989_+	replication initiation membrane attachment protein DnaB	NA	NA	NA	NA	NA
WP_003229466.1|1648016_1648952_+	primosomal protein DnaI	NA	S5MU12	Brevibacillus_phage	34.1	3.7e-39
WP_003229468.1|1648985_1649627_+	TVP38/TMEM64 family membrane protein YtxB	NA	NA	NA	NA	NA
WP_003229471.1|1649705_1650551_+	putative sporulation protein YtxC	NA	NA	NA	NA	NA
WP_003229473.1|1650948_1652880_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	34.3	8.3e-110
WP_004398978.1|1652920_1653703_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_003229477.1|1653869_1655651_+	two-component system sensor histidine kinase LytS	NA	Q9EYF3	Enterobacteria_phage	31.0	7.0e-71
>prophage 130
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	1658787	1659309	4211343		Agrobacterium_phage(100.0%)	1	NA	NA
WP_010886591.1|1658787_1659309_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	36.5	7.1e-16
>prophage 131
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	1681664	1682699	4211343	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_004398818.1|1681664_1682699_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	34.0	7.7e-30
>prophage 132
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	1687110	1693491	4211343		Cafeteria_roenbergensis_virus(33.33%)	4	NA	NA
WP_003229538.1|1687110_1688823_+	DNA polymerase/3'-5' exonuclease PolX	NA	E3T5M9	Cafeteria_roenbergensis_virus	24.8	1.4e-12
WP_003229541.1|1688843_1691201_+	endonuclease MutS2	NA	Q94M10	Lactobacillus_phage	43.4	2.2e-16
WP_003237674.1|1691215_1691620_+	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_004399166.1|1691808_1693491_+	long-chain-fatty-acid--CoA ligase LcfA	NA	A0A2H4PQM9	Staphylococcus_phage	26.8	2.7e-32
>prophage 133
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	1698798	1699113	4211343		Indivirus(100.0%)	1	NA	NA
WP_003222500.1|1698798_1699113_+	thioredoxin	NA	A0A1V0SD63	Indivirus	43.0	3.5e-10
>prophage 134
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	1707185	1707410	4211343		Caldibacillus_phage(100.0%)	1	NA	NA
WP_003184172.1|1707185_1707410_+	spore germination protein GerE	NA	A0A290GJH9	Caldibacillus_phage	78.7	1.2e-15
>prophage 135
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	1710995	1756960	4211343	protease,coat,tRNA	Bodo_saltans_virus(14.29%)	43	NA	NA
WP_010886588.1|1710995_1711592_+	XTP/dITP diphosphatase	NA	A0A2H4UUV7	Bodo_saltans_virus	33.5	5.5e-12
WP_003229585.1|1711607_1712117_+	metallophosphoesterase	NA	NA	NA	NA	NA
WP_003229586.1|1712384_1713206_-	YsnF/AvaK domain-containing protein	NA	NA	NA	NA	NA
WP_004399128.1|1713389_1713845_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004398743.1|1714013_1714349_-|coat	inner spore coat protein CotQ	coat	NA	NA	NA	NA
WP_004398643.1|1715164_1716889_+	acetolactate synthase large subunit	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	30.4	8.3e-61
WP_004399096.1|1716885_1717404_+	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_003222549.1|1717427_1718456_+	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_009967929.1|1718442_1719999_+	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	39.4	6.0e-10
WP_004399139.1|1720019_1721117_+	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_003229604.1|1721166_1722585_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_003229606.1|1722597_1723197_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_003229609.1|1723315_1724320_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_003229611.1|1724547_1725822_+	trigger factor	NA	NA	NA	NA	NA
WP_003229613.1|1726093_1727356_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	64.9	1.3e-148
WP_004398923.1|1727507_1729166_+|protease	Lon protease 2	protease	A0A1V0SHJ7	Hokovirus	33.7	8.1e-05
WP_003229618.1|1729346_1731671_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	43.7	3.4e-182
WP_003229621.1|1731667_1732255_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_003229624.1|1732276_1732774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065826286.1|1733003_1734371_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_003222575.1|1734378_1735209_+	protein HemX	NA	NA	NA	NA	NA
WP_010886587.1|1735241_1736186_+	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_003229629.1|1736175_1736964_+	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_003229631.1|1736960_1737935_+	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_004398699.1|1737964_1739257_+	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_003246083.1|1739387_1741115_+|coat	spore coat morphogenetic protein SpoVID	coat	NA	NA	NA	NA
WP_004399056.1|1741147_1742173_+|coat	spore coat protein CotN	coat	NA	NA	NA	NA
WP_003222590.1|1742191_1742383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004398606.1|1742830_1745473_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	42.6	3.7e-161
WP_003229640.1|1745532_1746825_+	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_010886586.1|1746964_1747711_+	prepilin peptidase	NA	NA	NA	NA	NA
WP_004398782.1|1747844_1748843_+	stage II sporulation protein SpoIIB	NA	NA	NA	NA	NA
WP_004398496.1|1748995_1749565_+	septum formation protein Maf	NA	NA	NA	NA	NA
WP_003246034.1|1749601_1750297_+	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_003229650.1|1750388_1751402_+	rod shape-determining protein MreB	NA	NA	NA	NA	NA
WP_009967915.1|1751432_1752305_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_004398811.1|1752301_1752820_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_004398901.1|1752872_1753553_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_004398624.1|1753554_1754361_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_004398684.1|1754510_1755305_+	stage IV sporulation protein SpoIVFA	NA	NA	NA	NA	NA
WP_004398649.1|1755297_1756164_+	stage IV sporulation protein SpoIVFB	NA	NA	NA	NA	NA
WP_003229668.1|1756310_1756619_+	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_003229669.1|1756621_1756960_+|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
>prophage 136
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	1761380	1762568	4211343		Faustovirus(100.0%)	1	NA	NA
WP_004398844.1|1761380_1762568_-	cysteine desulfurase NifS	NA	A0A141ZJV0	Faustovirus	27.1	8.6e-33
>prophage 137
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	1771379	1772027	4211343		Marseillevirus(100.0%)	1	NA	NA
WP_003246159.1|1771379_1772027_-	serine/threonine protein kinase	NA	A0A2R3ZQF2	Marseillevirus	26.3	5.4e-05
>prophage 138
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	1775982	1779713	4211343	tRNA	uncultured_Mediterranean_phage(66.67%)	5	NA	NA
WP_003229718.1|1775982_1776987_+	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	30.8	1.1e-07
WP_003222669.1|1776979_1777180_+	DUF2905 domain-containing protein	NA	NA	NA	NA	NA
WP_003229723.1|1777209_1778238_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_003229725.1|1778264_1779410_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	44.0	3.4e-87
WP_004398708.1|1779446_1779713_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	40.3	1.5e-06
>prophage 139
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	1783023	1799801	4211343	tRNA	uncultured_Mediterranean_phage(25.0%)	13	NA	NA
WP_003245970.1|1783023_1785237_+	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	33.7	1.1e-30
WP_003229739.1|1785394_1785892_+	cation:proton antiporter regulatory subunit	NA	NA	NA	NA	NA
WP_003229740.1|1785967_1786291_+	DUF1049 domain-containing protein	NA	NA	NA	NA	NA
WP_003246110.1|1786357_1788718_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	33.8	1.6e-91
WP_003229745.1|1788723_1789236_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.9	1.5e-29
WP_003229747.1|1789403_1791608_+	GTP diphosphokinase	NA	A0A1B1IUF0	uncultured_Mediterranean_phage	34.4	1.9e-09
WP_003229749.1|1791661_1792060_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_004399040.1|1792086_1793643_-	SH3 domain-containing protein	NA	E5DV68	Deep-sea_thermophilic_phage	28.7	9.3e-11
WP_004399157.1|1793775_1793946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003229755.1|1794327_1795602_+|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003229758.1|1795615_1797394_+|tRNA	aspartate--tRNA ligase	tRNA	K7Y9W2	Megavirus	33.6	5.4e-07
WP_009967893.1|1797729_1798494_+|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	A0A291ATS8	Pandoravirus	32.2	3.1e-20
WP_004398500.1|1798535_1799801_-	replication-associated recombination protein A	NA	A0A127AWE7	Bacillus_phage	53.5	1.1e-113
>prophage 140
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	1803454	1805851	4211343		Brevibacillus_phage(100.0%)	1	NA	NA
WP_004398511.1|1803454_1805851_+	ATP-dependent RecD-like DNA helicase	NA	A0A0K2FLP8	Brevibacillus_phage	29.2	2.5e-79
>prophage 141
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	1809050	1819919	4211343	tRNA	Planktothrix_phage(20.0%)	11	NA	NA
WP_003246180.1|1809050_1809779_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.9	2.5e-35
WP_009967889.1|1809934_1810996_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_003246158.1|1811326_1813963_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L3D8	Tupanvirus	34.5	1.1e-67
WP_003225903.1|1814047_1814314_+	IreB family regulatory phosphoprotein	NA	NA	NA	NA	NA
WP_003229795.1|1814321_1814738_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_003246199.1|1814755_1815037_+	DUF1292 domain-containing protein	NA	NA	NA	NA	NA
WP_003229799.1|1815167_1816250_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_003229800.1|1816401_1817055_+	O-methyltransferase	NA	W8CYT3	Bacillus_phage	32.5	1.4e-05
WP_004399094.1|1817060_1817990_+	U32 family peptidase	NA	NA	NA	NA	NA
WP_003229802.1|1818008_1819277_+	U32 family peptidase	NA	Q6DW11	Phage_TP	31.8	9.5e-38
WP_003225916.1|1819283_1819919_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	38.7	3.2e-34
>prophage 142
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	1825071	1827136	4211343		Lactococcus_phage(50.0%)	2	NA	NA
WP_003229809.1|1825071_1825995_+	O-acetylserine dependent cystathionine beta-synthase	NA	A0A1W6JHY1	Lactococcus_phage	42.8	4.9e-60
WP_003229810.1|1825996_1827136_+	bifunctional cystathionine gamma-lyase/homocysteine desulfhydrase	NA	A0A0B5JD48	Pandoravirus	31.0	7.7e-23
>prophage 143
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	1835082	1840819	4211343		Mycobacterium_phage(50.0%)	3	NA	NA
WP_003246174.1|1835082_1838247_+	cytochrome P450	NA	V5UQK0	Mycobacterium_phage	37.6	7.3e-79
WP_004398584.1|1838490_1838781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004398729.1|1838914_1840819_-	peptidoglycan O-acetyltransferase OatA	NA	B5WZU0	Pseudomonas_phage	34.8	1.7e-43
>prophage 144
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	1852060	1858685	4211343	protease,coat	Bacillus_phage(33.33%)	8	NA	NA
WP_004398804.1|1852060_1854094_+	levanase	NA	S6ATV4	Bacillus_phage	38.0	1.7e-84
WP_003229836.1|1854135_1854645_-|protease	cysteine protease YraA	protease	NA	NA	NA	NA
WP_003229837.1|1854775_1855825_-	formaldehyde dehydrogenase AdhA	NA	A0A2K9L339	Tupanvirus	41.5	9.5e-68
WP_003229839.1|1855955_1856150_-	carboxymuconolactone decarboxylase	NA	NA	NA	NA	NA
WP_004398725.1|1856332_1856755_+	aldehyde stress transcriptional regulator AdhR	NA	NA	NA	NA	NA
WP_003246006.1|1857017_1857317_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_003229842.1|1857332_1857530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003229843.1|1857548_1858685_-	glutathione-dependent formaldehyde dehydrogenase	NA	E3SJ82	Synechococcus_phage	25.1	2.2e-14
>prophage 145
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	1863319	1864153	4211343		Streptomyces_phage(100.0%)	1	NA	NA
WP_003229851.1|1863319_1864153_+	chitosanase	NA	A0A223LHY0	Streptomyces_phage	33.2	3.8e-19
>prophage 146
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	1875600	1876455	4211343		Streptococcus_phage(100.0%)	1	NA	NA
WP_003229862.1|1875600_1876455_+	aminoglycoside 6-adenylyltransferase AadK	NA	E4ZFP8	Streptococcus_phage	58.2	9.7e-95
>prophage 147
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	1888332	1889370	4211343		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_003229874.1|1888332_1889370_+	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4J2Q2	uncultured_Caudovirales_phage	25.9	1.9e-15
>prophage 148
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	1896643	1897204	4211343		Bacillus_phage(100.0%)	1	NA	NA
WP_004398494.1|1896643_1897204_+	cupin domain-containing protein	NA	Q2I8C5	Bacillus_phage	69.9	4.4e-56
>prophage 149
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	1907007	1907703	4211343		Bacillus_phage(100.0%)	1	NA	NA
WP_003229895.1|1907007_1907703_+	two-component response regulator YrkP	NA	W8CYM9	Bacillus_phage	36.2	6.8e-30
>prophage 150
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	1912894	1952925	4211343	plate,tail,terminase,holin,portal	uncultured_Caudovirales_phage(29.41%)	58	NA	NA
WP_004398704.1|1912894_1913245_-	transcriptional regulator SknR	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	30.6	2.0e-06
WP_004398958.1|1913421_1913652_+	helix-turn-helix transcriptional regulator	NA	A8ATK0	Listeria_phage	53.4	1.1e-08
WP_003229902.1|1913681_1913822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004398626.1|1913895_1914465_+	helix-turn-helix transcriptional regulator	NA	A0A2H4J884	uncultured_Caudovirales_phage	61.0	1.5e-64
WP_003245994.1|1914461_1914719_+	hypothetical protein	NA	A0A2H4J4M9	uncultured_Caudovirales_phage	42.2	6.4e-10
WP_119123069.1|1914715_1914889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003229905.1|1914848_1915043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004398673.1|1915148_1916108_+	YqaJ viral recombinase family protein	NA	A0A2H4JA52	uncultured_Caudovirales_phage	72.9	2.2e-135
WP_003229907.1|1916110_1916965_+	recombinase RecT	NA	A0A2H4JCY8	uncultured_Caudovirales_phage	79.0	7.1e-122
WP_010886575.1|1917040_1917718_+	DNA-binding protein	NA	A0A2H4J6G9	uncultured_Caudovirales_phage	31.8	1.1e-05
WP_075058863.1|1917599_1918541_+	ATP-binding protein	NA	A6XMI1	Bacillus_virus	52.2	8.0e-58
WP_003229910.1|1918531_1918681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009967809.1|1918776_1919205_+	RusA family crossover junction endodeoxyribonuclease	NA	S6B1L9	Thermus_phage	65.7	5.6e-43
WP_003229912.1|1919286_1919493_+	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	71.6	5.5e-20
WP_003229913.1|1919566_1920496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004398775.1|1920693_1921149_+	hypothetical protein	NA	A0A2H4J4R7	uncultured_Caudovirales_phage	74.8	2.4e-60
WP_004398685.1|1921292_1921757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003229916.1|1921824_1922544_+	hypothetical protein	NA	A0A2P1JTW4	Anoxybacillus_phage	55.9	1.7e-55
WP_003229917.1|1922536_1923832_+|terminase	PBSX family phage terminase large subunit	terminase	A0A2P1JTW5	Anoxybacillus_phage	63.4	1.1e-155
WP_004398894.1|1923835_1925368_+|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	51.9	4.7e-148
WP_004398748.1|1925364_1926282_+	hypothetical protein	NA	A0A1B1P7D7	Bacillus_phage	39.1	2.4e-51
WP_003229920.1|1926322_1926976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003229921.1|1927008_1927977_+|portal	phage portal protein	portal	A0A1B1P7E4	Bacillus_phage	57.3	7.4e-59
WP_003229922.1|1927995_1928931_+|portal	phage portal protein	portal	A0A1B1P7E3	Bacillus_phage	65.0	8.6e-105
WP_003229923.1|1928941_1929253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004398566.1|1929256_1929652_+	DUF3199 family protein	NA	NA	NA	NA	NA
WP_003229925.1|1929648_1930011_+	DUF3599 family protein	NA	A0A249XXE9	Clostridium_phage	39.3	6.9e-10
WP_003246050.1|1930007_1930511_+	HK97 gp10 family phage protein	NA	A0A249XXA4	Clostridium_phage	46.9	8.3e-38
WP_003229927.1|1930523_1930961_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010886574.1|1930957_1931149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003229929.1|1931149_1932550_+|portal	phage portal protein	portal	S5MNC1	Brevibacillus_phage	39.1	4.1e-74
WP_003229930.1|1932552_1932996_+|tail	phage tail tube protein	tail	A0A0K2CNG3	Brevibacillus_phage	45.4	3.2e-25
WP_075058862.1|1933249_1933339_-	type I toxin-antitoxin system toxin BsrH	NA	NA	NA	NA	NA
WP_004398662.1|1933718_1933898_-	type I toxin-antitoxin system toxin TxpA	NA	NA	NA	NA	NA
WP_003229933.1|1934043_1934493_+|portal	phage portal protein	portal	A0A0A7RTY8	Clostridium_phage	41.1	2.7e-11
WP_003229934.1|1934534_1934672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003246092.1|1934674_1939432_+	transglycosylase SLT domain-containing protein	NA	A0A1L2JY60	Aeribacillus_phage	47.2	1.3e-44
WP_004398548.1|1939424_1940084_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A090DBR9	Clostridium_phage	34.7	4.8e-25
WP_004398524.1|1940096_1941077_+	hypothetical protein	NA	H7BV96	unidentified_phage	32.0	2.1e-40
WP_003229938.1|1941073_1941337_+	DUF2577 domain-containing protein	NA	NA	NA	NA	NA
WP_004398572.1|1941349_1941775_+	DUF2634 domain-containing protein	NA	A0A0A8WJV8	Clostridium_phage	36.4	1.5e-11
WP_003229940.1|1941767_1942814_+|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	43.5	8.3e-72
WP_003229941.1|1942797_1943376_+	YmfQ family protein	NA	A0A2H4J717	uncultured_Caudovirales_phage	33.8	1.5e-14
WP_003229942.1|1943372_1943645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003229943.1|1943647_1944748_+	hypothetical protein	NA	M4ZRP1	Bacillus_phage	56.1	1.7e-19
WP_009967793.1|1944757_1945093_+|portal	phage portal protein	portal	NA	NA	NA	NA
WP_003229944.1|1945089_1945254_+	XkdX family protein	NA	A0A2H4JAA1	uncultured_Caudovirales_phage	67.9	2.7e-14
WP_003246010.1|1945341_1946235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003246208.1|1946279_1946702_+|holin	holin family protein	holin	D6R405	Bacillus_phage	73.7	3.3e-48
WP_003229946.1|1946746_1947565_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A218KC88	Bacillus_phage	74.4	1.0e-64
WP_004399085.1|1947729_1948209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003229947.1|1948224_1948587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009967791.1|1948583_1948730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009967790.1|1948847_1949426_-	type II toxin-antitoxin system antitoxin YqcF	NA	NA	NA	NA	NA
WP_004399034.1|1949440_1951036_-	type II toxin-antitoxin system toxin ribonuclease YqcG	NA	A0A1P8CWI7	Bacillus_phage	61.3	6.9e-78
WP_003245945.1|1951405_1951564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004398770.1|1951673_1951808_-	phosphatase RapE inhibitor PhrE	NA	NA	NA	NA	NA
WP_004398842.1|1951797_1952925_-	response regulator aspartate phosphatase RapE	NA	A0A1P8CWN8	Bacillus_phage	39.1	1.5e-71
>prophage 151
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	1956396	1963235	4211343		Bacillus_phage(40.0%)	7	NA	NA
WP_004398596.1|1956396_1956816_+	thioredoxin-dependent arsenate reductase	NA	A0A2H4PQT9	Staphylococcus_phage	64.9	1.2e-45
WP_010886573.1|1957264_1958767_+	recombinase family protein	NA	A0A2H4J3Q1	uncultured_Caudovirales_phage	28.1	1.8e-19
WP_009967785.1|1959340_1959751_+	sporulation-specific Dnase NucB	NA	F8WPS9	Bacillus_phage	60.6	7.8e-42
WP_010886572.1|1959783_1960506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003229961.1|1960757_1961651_+	decarboxylating 6-phosphogluconate dehydrogenase	NA	M4SJX8	Cyanophage	36.0	3.4e-58
WP_003229962.1|1961669_1962296_-	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_003229963.1|1962482_1963235_+	N-acetylmuramoyl-L-alanine amidase	NA	Q9ZXD7	Bacillus_phage	65.3	1.6e-69
>prophage 152
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	1967803	1968373	4211343		Bacillus_virus(100.0%)	1	NA	NA
WP_004398676.1|1967803_1968373_+	nicotinate-nucleotide adenylyltransferase	NA	G3MA22	Bacillus_virus	31.5	1.1e-22
>prophage 153
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	1971691	1974595	4211343		Bacillus_phage(50.0%)	2	NA	NA
WP_003229978.1|1971691_1972261_+	ComE operon protein 2	NA	A0A127AWN5	Bacillus_phage	52.5	2.8e-34
WP_009967776.1|1972264_1974595_+	ComE operon protein 3	NA	Q332B9	Clostridium_botulinum_C_phage	35.1	4.3e-36
>prophage 154
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	1979389	1987353	4211343		Streptococcus_phage(33.33%)	6	NA	NA
WP_003229999.1|1979389_1981228_+	elongation factor 4	NA	A0A1B0RXH7	Streptococcus_phage	24.6	2.6e-20
WP_004398764.1|1981280_1982420_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_003246126.1|1982500_1983532_+	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
WP_003230005.1|1983603_1984167_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_004398786.1|1984190_1986026_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	49.5	6.2e-139
WP_003230010.1|1986225_1987353_+	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	28.8	4.5e-23
>prophage 155
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	1991781	1992228	4211343		Xanthomonas_phage(100.0%)	1	NA	NA
WP_003230022.1|1991781_1992228_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	36.1	3.1e-12
>prophage 156
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	1996682	1997642	4211343		Rhizobium_phage(100.0%)	1	NA	NA
WP_003230035.1|1996682_1997642_+	PhoH-like protein	NA	L7TP00	Rhizobium_phage	54.0	1.8e-52
>prophage 157
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	2008798	2018857	4211343	tRNA	Caulobacter_phage(20.0%)	9	NA	NA
WP_003230066.1|2008798_2010610_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.0	5.1e-53
WP_003226225.1|2010808_2011924_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	35.1	5.8e-39
WP_003230068.1|2012252_2012615_+	cytochrome c-550	NA	NA	NA	NA	NA
WP_072692743.1|2012832_2013522_+|tRNA	tRNA (adenine-N(1))-methyltransferase	tRNA	NA	NA	NA	NA
WP_004399125.1|2013514_2014636_+	Nif3-like dinuclear metal center hexameric protein	NA	A0A1S5V250	Saudi_moumouvirus	48.0	7.1e-21
WP_003246170.1|2014658_2015603_-	4-hydroxy-3-methylbut-2-enyl diphosphate reductase	NA	NA	NA	NA	NA
WP_003246095.1|2015725_2016469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004399101.1|2016637_2017954_+	DEAD-box ATP-dependent RNA helicase CshB	NA	A0A1V0SIR5	Klosneuvirus	34.5	5.0e-50
WP_009967756.1|2017963_2018857_+	deoxyribonuclease IV	NA	A0A2H4UU70	Bodo_saltans_virus	33.0	1.3e-25
>prophage 158
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	2023713	2026704	4211343		Bacillus_phage(50.0%)	4	NA	NA
WP_009967754.1|2023713_2024142_+	cell wall-binding protein YqgA	NA	M4ZR14	Bacillus_phage	41.0	3.2e-06
WP_003230089.1|2024557_2025325_-	DUF1189 domain-containing protein	NA	NA	NA	NA	NA
WP_004398518.1|2025434_2025917_+	DUF456 domain-containing protein	NA	NA	NA	NA	NA
WP_004398583.1|2026095_2026704_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	61.1	3.2e-68
>prophage 159
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	2033326	2034929	4211343		Bacillus_virus(50.0%)	2	NA	NA
WP_009967747.1|2033326_2034136_+	phosphate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.5	1.2e-14
WP_004399074.1|2034146_2034929_+	phosphate ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	31.0	5.7e-17
>prophage 160
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	2041649	2043566	4211343		Streptococcus_phage(100.0%)	1	NA	NA
WP_004399146.1|2041649_2043566_+	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	37.9	2.0e-100
>prophage 161
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	2060766	2069776	4211343		Prochlorococcus_phage(50.0%)	8	NA	NA
WP_004398544.1|2060766_2062440_-	DEAD/DEAH box helicase	NA	A0A2H4J643	uncultured_Caudovirales_phage	31.0	2.2e-58
WP_004398598.1|2062881_2063970_+	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_003230207.1|2063999_2065346_+	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	E3SN07	Prochlorococcus_phage	38.4	1.5e-62
WP_003230209.1|2065338_2066805_+	glycine dehydrogenase subunit 2	NA	E3ST28	Prochlorococcus_phage	42.0	3.1e-85
WP_004398485.1|2066839_2067220_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_004398586.1|2067410_2068247_+	octanoyltransferase LipM	NA	NA	NA	NA	NA
WP_003236923.1|2068346_2068775_+	transcriptional regulator MntR	NA	NA	NA	NA	NA
WP_003230220.1|2068900_2069776_+	patatin-like phospholipase family protein	NA	A0A1V0SFX9	Hokovirus	28.7	7.5e-18
>prophage 162
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	2082959	2085295	4211343		Enterococcus_phage(50.0%)	2	NA	NA
WP_003230259.1|2082959_2083811_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	43.0	5.9e-44
WP_003246103.1|2083948_2085295_+	exodeoxyribonuclease VII large subunit	NA	A0A1B3AYB4	Gordonia_phage	32.9	1.5e-28
>prophage 163
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	2093388	2098046	4211343		Bacillus_phage(33.33%)	6	NA	NA
WP_003226427.1|2093388_2094192_+	sporulation transcription factor Spo0A	NA	W8CYM9	Bacillus_phage	35.0	7.1e-07
WP_004398691.1|2094656_2095775_-	NADH-dependent flavin oxidoreductase	NA	NA	NA	NA	NA
WP_003230276.1|2095847_2096000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003230284.1|2096307_2096601_+	lipoprotein	NA	NA	NA	NA	NA
WP_010886565.1|2096615_2097236_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A0N9SGH1	Paenibacillus_phage	42.5	2.9e-24
WP_003230288.1|2097314_2098046_+	glycerophosphodiester phosphodiesterase	NA	I6XE30	Staphylococcus_phage	28.8	4.1e-17
>prophage 164
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	2120918	2121641	4211343		Planktothrix_phage(100.0%)	1	NA	NA
WP_004398740.1|2120918_2121641_+	arginine ABC transporter ATP-binding protein ArtR	NA	G9BWD6	Planktothrix_phage	41.4	6.8e-33
>prophage 165
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	2130055	2133057	4211343		Synechococcus_phage(50.0%)	2	NA	NA
WP_003230365.1|2130055_2131465_+	NADP-dependent phosphogluconate dehydrogenase	NA	V5UT40	Synechococcus_phage	33.7	1.5e-36
WP_003246151.1|2131587_2133057_-	glucose-6-phosphate dehydrogenase	NA	M4SIY3	Cyanophage	37.2	3.6e-81
>prophage 166
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	2138225	2150020	4211343		Streptococcus_phage(14.29%)	13	NA	NA
WP_004398788.1|2138225_2139062_-	Pyrroline-5-carboxylate reductase 2	NA	A0A1X9I6T5	Streptococcus_phage	33.5	2.6e-28
WP_004398688.1|2139466_2140426_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_004398795.1|2140431_2141211_+	SDR family oxidoreductase	NA	A0A0K0KVL6	Prochlorococcus_phage	27.6	5.7e-09
WP_004399082.1|2141286_2142633_+	D-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_003245966.1|2142704_2143664_+	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	34.3	5.5e-30
WP_004398989.1|2143667_2144054_+	hypothetical protein	NA	V5UQY3	Oenococcus_phage	56.5	1.1e-34
WP_004398495.1|2144259_2145492_-	MFS transporter	NA	NA	NA	NA	NA
WP_004398642.1|2146040_2146247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010886562.1|2146412_2147651_+	DNA polymerase IV 2	NA	O64031	Bacillus_phage	42.8	2.3e-76
WP_004398477.1|2147647_2147986_+	YolD-like family protein	NA	A0A2H4JAP8	uncultured_Caudovirales_phage	27.9	2.8e-05
WP_004398668.1|2148171_2148642_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003245961.1|2148651_2148996_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_004398771.1|2148988_2150020_+	GNAT family N-acetyltransferase	NA	A0A2K5B2B6	Erysipelothrix_phage	41.2	6.3e-32
>prophage 167
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	2162731	2168784	4211343		Brevibacillus_phage(25.0%)	7	NA	NA
WP_004398985.1|2162731_2163622_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	34.0	1.7e-41
WP_003230444.1|2163782_2164967_+	phosphopentomutase	NA	NA	NA	NA	NA
WP_003230447.1|2164979_2165795_+	purine nucleoside phosphorylase I, inosine and guanosine-specific	NA	Q5YBA4	Grouper_iridovirus	48.2	1.3e-69
WP_004398637.1|2165949_2167119_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	30.0	1.1e-35
WP_004398633.1|2167214_2167568_+	anti-sigma F factor antagonist	NA	NA	NA	NA	NA
WP_003230452.1|2167564_2168005_+	anti-sigma F factor	NA	NA	NA	NA	NA
WP_003230458.1|2168016_2168784_+	RNA polymerase sporulation sigma factor SigF	NA	A0A0Y0AU18	Bacillus_phage	60.7	1.0e-71
>prophage 168
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	2176421	2176853	4211343		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_003223931.1|2176421_2176853_+	peptidylprolyl isomerase	NA	A0A2H4UTF4	Bodo_saltans_virus	42.9	1.2e-16
>prophage 169
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	2180869	2188830	4211343		Staphylococcus_phage(57.14%)	10	NA	NA
WP_004398763.1|2180869_2181955_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	36.1	5.1e-56
WP_004398505.1|2181965_2182613_+	riboflavin synthase subunit alpha	NA	A0A2H4PQS5	Staphylococcus_phage	45.9	5.0e-43
WP_004398484.1|2182627_2183824_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	54.9	6.9e-115
WP_003223915.1|2183856_2184321_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	60.0	5.5e-44
WP_003223910.1|2184433_2184808_+	GNAT family N-acetyltransferase RibT	NA	NA	NA	NA	NA
WP_003230498.1|2184821_2185346_-	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_003246108.1|2185626_2186382_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	29.2	5.5e-09
WP_003223904.1|2186371_2186965_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	35.4	2.0e-14
WP_004399065.1|2187019_2187559_+	DUF3907 family protein	NA	NA	NA	NA	NA
WP_003230505.1|2187681_2188830_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	29.5	3.5e-23
>prophage 170
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	2194309	2205291	4211343		Bacillus_phage(60.0%)	10	NA	NA
WP_003246107.1|2194309_2195032_+	DNA-binding response regulator ResD	NA	W8CYM9	Bacillus_phage	42.2	2.7e-45
WP_003230520.1|2195028_2196798_+	sensor histidine kinase ResE	NA	W8CYF6	Bacillus_phage	38.9	2.0e-38
WP_003230521.1|2197001_2197586_+	RNA polymerase sigma factor SigX	NA	NA	NA	NA	NA
WP_009967642.1|2197521_2198628_+	anti-sigma-X factor RsiX	NA	NA	NA	NA	NA
WP_003230523.1|2198739_2199507_+	type I 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_004398713.1|2199549_2201127_-	D-3-phosphoglycerate dehydrogenase	NA	M1NSB9	Streptococcus_phage	35.1	1.3e-36
WP_004399159.1|2201623_2202196_+	riboflavin transporter FmnP	NA	NA	NA	NA	NA
WP_003225461.1|2202235_2202484_-	ferredoxin	NA	A0A127AYY7	Bacillus_phage	56.8	1.6e-18
WP_004398594.1|2202749_2203808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003230528.1|2203800_2205291_+	ATP-dependent DNA helicase RecQ	NA	F2NZ48	Diadromus_pulchellus_ascovirus	39.0	9.4e-61
>prophage 171
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	2212134	2213052	4211343		Bacillus_phage(100.0%)	1	NA	NA
WP_004398523.1|2212134_2213052_+	spore cortex-lytic enzyme	NA	A0A0E3XAL9	Bacillus_phage	40.3	1.6e-18
>prophage 172
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	2226382	2233104	4211343		Bacillus_phage(25.0%)	9	NA	NA
WP_003153447.1|2226382_2226661_+	non-specific DNA-binding protein Hbs	NA	A7KV42	Bacillus_phage	75.3	1.1e-28
WP_003225516.1|2226848_2227421_+	GTP cyclohydrolase I FolE	NA	E7DN69	Pneumococcus_phage	55.7	4.9e-50
WP_003230576.1|2227442_2227670_+	trp RNA-binding attenuation protein MtrB	NA	NA	NA	NA	NA
WP_004398550.1|2227833_2228589_+	Heptaprenyl diphosphate synthase component 1	NA	NA	NA	NA	NA
WP_003230580.1|2228595_2229297_+	demethylmenaquinone methyltransferase	NA	NA	NA	NA	NA
WP_010886555.1|2229238_2230285_+	Heptaprenyl diphosphate synthase component 2	NA	NA	NA	NA	NA
WP_010886554.1|2230400_2230850_+	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	44.3	2.4e-28
WP_003230589.1|2231086_2231857_+	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_004398727.1|2231931_2233104_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	34.9	4.2e-40
>prophage 173
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	2236306	2241792	4211343		Acinetobacter_phage(66.67%)	6	NA	NA
WP_003245959.1|2236306_2237323_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	43.0	1.7e-61
WP_003230601.1|2237315_2238068_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	43.6	8.9e-44
WP_004398742.1|2238072_2238720_+	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_003230605.1|2238700_2239903_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_003230608.1|2239895_2240699_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_004399129.1|2240709_2241792_+	histidinol-phosphate transaminase	NA	A0A1X6WGT4	Pacmanvirus	28.5	6.0e-25
>prophage 174
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	2245931	2246471	4211343		Bacillus_virus(100.0%)	1	NA	NA
WP_004399171.1|2245931_2246471_+	YpiB family protein	NA	G3MAV7	Bacillus_virus	48.6	2.1e-42
>prophage 175
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	2250704	2251577	4211343		Streptococcus_phage(100.0%)	1	NA	NA
WP_003230635.1|2250704_2251577_-	YitT family protein	NA	M1Q1P6	Streptococcus_phage	45.8	9.6e-74
>prophage 176
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	2255133	2266774	4211343	tRNA	Bacillus_phage(40.0%)	11	NA	NA
WP_003230647.1|2255133_2256327_+|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	44.8	2.6e-37
WP_003230650.1|2256311_2257289_+	bifunctional biotin--[acetyl-CoA-carboxylase] synthetase/biotin operon repressor	NA	NA	NA	NA	NA
WP_003230652.1|2257534_2258368_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	39.1	3.2e-50
WP_003230656.1|2258369_2259230_+	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_003225586.1|2259231_2259615_+	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_004398920.1|2259740_2262536_+	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.6	4.9e-55
WP_003225588.1|2262678_2262849_+	YpmA family protein	NA	NA	NA	NA	NA
WP_003230665.1|2262857_2263343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004398489.1|2263365_2264547_+	aspartate transaminase AspB	NA	NA	NA	NA	NA
WP_004398777.1|2264690_2265983_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	30.1	1.7e-58
WP_004398499.1|2266075_2266774_+	DNA replication protein DnaD	NA	A0A0N7AE27	Bacillus_phage	42.7	4.3e-24
>prophage 177
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	2270784	2271405	4211343		Bacillus_phage(100.0%)	1	NA	NA
WP_004399067.1|2270784_2271405_-	Holliday junction resolvase RecU	NA	A0A1C8E9C3	Bacillus_phage	36.6	5.5e-23
>prophage 178
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	2275376	2277626	4211343		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_003246149.1|2275376_2277626_+	DEAD/DEAH box helicase	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	29.3	3.0e-10
>prophage 179
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	2282793	2284719	4211343		Streptomyces_phage(100.0%)	1	NA	NA
WP_003230718.1|2282793_2284719_+	ATP-dependent DNA helicase	NA	A0A2P1N0K5	Streptomyces_phage	21.4	3.0e-11
>prophage 180
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	2300321	2304302	4211343		Bacillus_phage(50.0%)	9	NA	NA
WP_003230763.1|2300321_2301212_+	5'-3' exonuclease	NA	F8WQ40	Bacillus_phage	28.7	3.2e-24
WP_003218255.1|2301219_2301348_-	small, acid-soluble spore protein L	NA	NA	NA	NA	NA
WP_003230765.1|2301389_2301788_-	reverse transcriptase-like protein	NA	NA	NA	NA	NA
WP_003230767.1|2301787_2302477_-	queuosine precursor transporter	NA	NA	NA	NA	NA
WP_003230769.1|2302559_2303240_+	reverse transcriptase-like protein	NA	NA	NA	NA	NA
WP_004399003.1|2303232_2303415_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_004398863.1|2303442_2303712_-	DUF2564 family protein	NA	NA	NA	NA	NA
WP_003230774.1|2303867_2304050_+	transcriptional regulator DegR	NA	NA	NA	NA	NA
WP_003230776.1|2304101_2304302_-	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	61.9	4.2e-17
>prophage 181
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	2307669	2308287	4211343		Golden_Marseillevirus(100.0%)	1	NA	NA
WP_003230787.1|2307669_2308287_+	Mn(2+)-dependent (deoxy)ribonucleoside pyrophosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.7	3.8e-08
>prophage 182
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	2313689	2315604	4211343		Bacillus_virus(33.33%)	3	NA	NA
WP_003230797.1|2313689_2314223_+	phosphatidylglycerophosphatase A	NA	G3MBC5	Bacillus_virus	58.5	1.2e-50
WP_004398587.1|2314306_2315101_+	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	65.5	1.6e-104
WP_003230799.1|2315097_2315604_+	dihydrofolate reductase	NA	A0A076GDN3	Bacillus_phage	47.8	9.3e-37
>prophage 183
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	2325153	2460581	4211343	integrase,bacteriocin	Bacillus_phage(97.8%)	198	2389898:2389923	2454960:2454985
WP_004399080.1|2325153_2325744_-	polysaccharide biosynthesis protein	NA	A0A2P1ELS8	Moumouvirus	28.6	4.9e-13
WP_004399105.1|2325798_2327436_-|integrase	serine-type integrase SprA	integrase	O64015	Bacillus_phage	100.0	2.8e-308
WP_004398623.1|2327638_2328349_+	lipoprotein	NA	O64016	Bacillus_phage	100.0	3.7e-108
WP_004398503.1|2328555_2329071_+	hypothetical protein	NA	O64017	Bacillus_phage	100.0	2.0e-95
WP_003246211.1|2329250_2329406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004398929.1|2329567_2329702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004399070.1|2329721_2330540_-	AAC(3) family N-acetyltransferase	NA	O64018	Bacillus_phage	100.0	1.9e-156
WP_004398883.1|2330843_2331326_-	hypothetical protein	NA	O64019	Bacillus_phage	100.0	2.5e-84
WP_004399048.1|2331339_2332230_-	endonuclease YokF	NA	O64020	Bacillus_phage	100.0	3.3e-114
WP_004399120.1|2332531_2333605_+	SPBc2 prophage-derived pesticidal crystal protein-like YokG	NA	O64021	Bacillus_phage	100.0	9.3e-204
WP_078079219.1|2333859_2334099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003246042.1|2334128_2334686_+	SMI1/KNR4 family protein	NA	O64022	Bacillus_phage	100.0	3.6e-106
WP_004398855.1|2334785_2336501_+	ribonuclease	NA	O64023	Bacillus_phage	99.8	1.4e-302
WP_003246188.1|2336509_2337007_+	SMI1/KNR4 family protein	NA	O64024	Bacillus_phage	100.0	1.9e-95
WP_004399123.1|2337070_2337649_+	SMI1/KNR4 family protein	NA	O64025	Bacillus_phage	100.0	9.4e-110
WP_004399156.1|2337684_2338218_+	GNAT family N-acetyltransferase	NA	O64026	Bacillus_phage	100.0	6.2e-100
WP_009967548.1|2338496_2338613_-	type I toxin-antitoxin system toxin BsrG	NA	Q96209	Bacillus_phage	100.0	9.8e-11
WP_003246138.1|2338843_2339311_+	DUF4879 domain-containing protein	NA	O64027	Bacillus_phage	100.0	5.1e-82
WP_004398595.1|2339316_2339673_+	hypothetical protein	NA	O64028	Bacillus_phage	100.0	5.0e-61
WP_004399073.1|2339715_2340051_-	hypothetical protein	NA	O64029	Bacillus_phage	100.0	2.1e-53
WP_004398710.1|2340224_2340557_+	YolD-like family protein	NA	O64030	Bacillus_phage	100.0	1.3e-55
WP_004398504.1|2340549_2341800_+	UV-damage repair protein uvrX	NA	O64031	Bacillus_phage	100.0	4.2e-240
WP_009967545.1|2341901_2342219_+	sublancin immunity protein SunI	NA	NA	NA	NA	NA
WP_009967544.1|2342515_2342686_+|bacteriocin	bacteriocin sublancin-168	bacteriocin	NA	NA	NA	NA
WP_003246186.1|2342743_2344861_+	sublancin transporter SunT	NA	W8CYL7	Bacillus_phage	26.1	6.9e-25
WP_003230920.1|2344857_2345271_+	disulfide bond formation protein BdbA	NA	NA	NA	NA	NA
WP_004399050.1|2345270_2346539_+	SunS family peptide S-glycosyltransferase	NA	NA	NA	NA	NA
WP_009967541.1|2346535_2346982_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_004399099.1|2347037_2347304_-	SPBc2 prophage-derived protein BhlB	NA	A0A2H4J6M0	uncultured_Caudovirales_phage	50.0	1.1e-15
WP_003246119.1|2347314_2347527_-	SPBc2 prophage-derived protein BhlA	NA	A0A290GDY2	Caldibacillus_phage	59.7	4.2e-15
WP_004399108.1|2347614_2348718_-	N-acetylmuramoyl-L-alanine amidase BlyA	NA	O64040	Bacillus_phage	100.0	2.8e-187
WP_004399160.1|2348737_2348956_-	hypothetical protein	NA	A0A1P8CWN7	Bacillus_phage	100.0	1.7e-35
WP_004398829.1|2348945_2349770_-	hypothetical protein	NA	A0A1P8CWP0	Bacillus_phage	100.0	1.5e-164
WP_003246098.1|2349939_2351874_-	hypothetical protein	NA	O64042	Bacillus_phage	100.0	0.0e+00
WP_010886548.1|2351910_2352732_-	hypothetical protein	NA	O64043	Bacillus_phage	100.0	1.2e-134
WP_004398800.1|2352747_2355375_-	hypothetical protein	NA	O64044	Bacillus_phage	100.0	0.0e+00
WP_004398627.1|2355386_2356145_-	hypothetical protein	NA	O64045	Bacillus_phage	100.0	1.4e-145
WP_004398858.1|2356195_2363053_-	transglycosylase CwlP	NA	A0A1P8CWQ1	Bacillus_phage	67.7	0.0e+00
WP_003246141.1|2363106_2363790_-	hypothetical protein	NA	Q37974	Bacillus_phage	100.0	2.1e-116
WP_009967530.1|2363871_2364318_-	hypothetical protein	NA	O64047	Bacillus_phage	100.0	8.1e-77
WP_009966645.1|2364663_2364840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009967529.1|2364864_2365551_+	hypothetical protein	NA	O64048	Bacillus_phage	100.0	2.2e-126
WP_004399258.1|2365726_2366056_+	hypothetical protein	NA	A0A1P8CWQ2	Bacillus_phage	99.1	1.2e-61
WP_009969431.1|2366058_2367060_-	SPBc2 prophage-derived recombinase-like protein YomM	NA	A0A1P8CWP6	Bacillus_phage	100.0	4.8e-194
WP_004399281.1|2367073_2367493_-	hypothetical protein	NA	A0A1P8CWQ4	Bacillus_phage	100.0	4.8e-71
WP_004399471.1|2367476_2367977_-	hypothetical protein	NA	A0A1P8CWQ6	Bacillus_phage	100.0	5.7e-87
WP_004399574.1|2368026_2368218_-	XkdX family protein	NA	A0A1P8CWR4	Bacillus_phage	100.0	3.5e-29
WP_004399254.1|2368214_2368565_-	hypothetical protein	NA	O64053	Bacillus_phage	100.0	5.4e-60
WP_004399226.1|2368575_2369793_-	hypothetical protein	NA	A0A1P8CWR7	Bacillus_phage	100.0	2.5e-173
WP_009967523.1|2369794_2370151_-	hypothetical protein	NA	O64055	Bacillus_phage	100.0	1.4e-58
WP_009967521.1|2370214_2370442_-	hypothetical protein	NA	A0A1P8CWR2	Bacillus_phage	100.0	6.4e-38
WP_010886547.1|2370441_2371053_-	hypothetical protein	NA	A0A1P8CWQ5	Bacillus_phage	100.0	3.3e-65
WP_004399252.1|2371070_2371868_-	hypothetical protein	NA	A0A1P8CWR0	Bacillus_phage	100.0	2.1e-91
WP_003230954.1|2371910_2372621_-	hypothetical protein	NA	A0A1P8CWQ7	Bacillus_phage	100.0	1.8e-131
WP_004399477.1|2372617_2373124_-	hypothetical protein	NA	O64060	Bacillus_phage	100.0	5.9e-92
WP_003230958.1|2373120_2373771_-	hypothetical protein	NA	A0A1P8CWR8	Bacillus_phage	100.0	3.2e-122
WP_009967519.1|2373754_2374009_-	hypothetical protein	NA	A0A1P8CWS7	Bacillus_phage	100.0	2.2e-39
WP_004399452.1|2374005_2374401_-	hypothetical protein	NA	A0A1P8CWR5	Bacillus_phage	100.0	2.5e-69
WP_004399413.1|2374415_2374886_-	hypothetical protein	NA	A0A1P8CWS5	Bacillus_phage	100.0	6.7e-82
WP_004399434.1|2374921_2375938_-	hypothetical protein	NA	A0A1P8CWR9	Bacillus_phage	100.0	1.3e-186
WP_004399581.1|2375976_2376513_-	hypothetical protein	NA	A0A1P8CWS2	Bacillus_phage	100.0	3.6e-95
WP_004399245.1|2376537_2377974_-	hypothetical protein	NA	A0A1P8CWR1	Bacillus_phage	100.0	2.7e-267
WP_004399314.1|2378004_2379525_-	hypothetical protein	NA	O64068	Bacillus_phage	100.0	1.4e-282
WP_004399591.1|2379542_2381312_-	hypothetical protein	NA	O64069	Bacillus_phage	100.0	0.0e+00
WP_004399257.1|2381298_2382219_-	hypothetical protein	NA	A0A1P8CWS6	Bacillus_phage	100.0	5.4e-176
WP_004399264.1|2382321_2382822_-	hypothetical protein	NA	A0A1P8CWS3	Bacillus_phage	100.0	3.6e-89
WP_004399334.1|2383040_2383451_+	hypothetical protein	NA	A0A1P8CWT0	Bacillus_phage	100.0	8.8e-70
WP_004399278.1|2383484_2384702_-	hypothetical protein	NA	O64073	Bacillus_phage	99.8	1.3e-230
WP_004399317.1|2384718_2384910_-	hypothetical protein	NA	O64074	Bacillus_phage	100.0	1.5e-27
WP_119123066.1|2385860_2386031_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004399274.1|2386591_2386870_-	HU-related DNA-binding protein HupN	NA	A0A1P8CWT5	Bacillus_phage	76.9	1.2e-30
WP_004399271.1|2387113_2389633_-	hypothetical protein	NA	O64076	Bacillus_phage	100.0	0.0e+00
WP_004399291.1|2389672_2389867_-	hypothetical protein	NA	O64077	Bacillus_phage	100.0	2.7e-29
2389898:2389923	attL	TATACATATTATTTGTATTTGTCTAT	NA	NA	NA	NA
WP_009967517.1|2390819_2391146_+	helix-turn-helix transcriptional regulator	NA	O64078	Bacillus_phage	100.0	9.8e-56
WP_009967516.1|2391260_2391872_+	lipoprotein	NA	O64079	Bacillus_phage	100.0	5.0e-85
WP_009967515.1|2392246_2392423_+	hypothetical protein	NA	O64080	Bacillus_phage	100.0	6.7e-11
WP_010886546.1|2392441_2392693_+	hypothetical protein	NA	A0A1P8CWU4	Bacillus_phage	94.4	1.6e-29
WP_004399547.1|2392737_2392926_+	hypothetical protein	NA	O64081	Bacillus_phage	100.0	1.5e-24
WP_004399445.1|2393007_2394240_+	hypothetical protein	NA	O64082	Bacillus_phage	100.0	1.7e-238
WP_004399486.1|2394567_2395074_+	hypothetical protein	NA	O64083	Bacillus_phage	100.0	4.9e-70
WP_004399369.1|2395430_2396747_+	hypothetical protein	NA	O64084	Bacillus_phage	100.0	1.1e-257
WP_004399298.1|2397007_2397235_+	helix-turn-helix transcriptional regulator	NA	O64085	Bacillus_phage	100.0	1.0e-35
WP_004399370.1|2397342_2398671_+	RES domain-containing protein	NA	O64086	Bacillus_phage	100.0	8.7e-260
WP_009967512.1|2398728_2399124_+	UPF0715 family protein	NA	O64087	Bacillus_phage	100.0	1.0e-62
WP_009967511.1|2399128_2399359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003231000.1|2399460_2399640_-	hypothetical protein	NA	A0A1P8CWV7	Bacillus_phage	96.6	3.6e-28
WP_004399430.1|2399710_2399962_+	hypothetical protein	NA	A0A1P8CWV6	Bacillus_phage	100.0	1.6e-37
WP_004399349.1|2399965_2400181_+	hypothetical protein	NA	O64089	Bacillus_phage	100.0	5.0e-32
WP_004399255.1|2400191_2400323_+	hypothetical protein	NA	O64090	Bacillus_phage	100.0	1.7e-19
WP_004399323.1|2400361_2400898_+	hypothetical protein	NA	O64091	Bacillus_phage	100.0	2.2e-97
WP_009967509.1|2400924_2401458_+	hypothetical protein	NA	O64092	Bacillus_phage	100.0	9.3e-88
WP_004399583.1|2401459_2401876_+	hypothetical protein	NA	O64093	Bacillus_phage	100.0	1.2e-71
WP_009968986.1|2402052_2403213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009967508.1|2403226_2403352_+	lysogeny pheromone AimP family peptide	NA	NA	NA	NA	NA
WP_004399418.1|2403678_2403879_+	hypothetical protein	NA	O64096	Bacillus_phage	100.0	9.0e-28
WP_009967507.1|2403881_2404199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004399407.1|2404246_2404459_+	helix-turn-helix transcriptional regulator	NA	O64098	Bacillus_phage	100.0	8.6e-29
WP_004399272.1|2404448_2405525_+|integrase	SPBc2 prophage-derived probable integrase/recombinase YopP	integrase	O64099	Bacillus_phage	100.0	1.5e-198
WP_004399247.1|2405631_2407014_+	hypothetical protein	NA	O64100	Bacillus_phage	100.0	1.3e-263
WP_003231032.1|2407037_2408015_+	hypothetical protein	NA	O64101	Bacillus_phage	99.7	4.0e-177
WP_004399410.1|2408203_2408428_-	helix-turn-helix transcriptional regulator	NA	O64102	Bacillus_phage	100.0	1.9e-34
WP_003231034.1|2408610_2408829_+	hypothetical protein	NA	O64103	Bacillus_phage	100.0	6.6e-32
WP_009967504.1|2408898_2409096_+	hypothetical protein	NA	O64104	Bacillus_phage	100.0	3.6e-29
WP_003231036.1|2409207_2409402_+	hypothetical protein	NA	O64105	Bacillus_phage	100.0	1.9e-27
WP_004399316.1|2409490_2409826_+	hypothetical protein	NA	A0A1P8CWX6	Bacillus_phage	100.0	3.2e-46
WP_004399266.1|2409822_2410227_+	hypothetical protein	NA	A0A1P8CWX0	Bacillus_phage	100.0	2.9e-73
WP_004399424.1|2410223_2410502_+	hypothetical protein	NA	A0A1P8CWX5	Bacillus_phage	100.0	9.2e-47
WP_009967502.1|2410515_2410719_+	hypothetical protein	NA	A0A1P8CWX9	Bacillus_phage	100.0	5.7e-30
WP_014906374.1|2410731_2411082_+	hypothetical protein	NA	A0A1P8CWX8	Bacillus_phage	100.0	8.3e-61
WP_004399388.1|2411078_2411417_+	hypothetical protein	NA	O64111	Bacillus_phage	100.0	8.9e-52
WP_004399569.1|2411423_2411831_+	hypothetical protein	NA	A0A1P8CWY3	Bacillus_phage	100.0	2.6e-74
WP_004399389.1|2411871_2412627_+	SPBc2 prophage-derived antirepressor protein YoqD	NA	A0A1P8CWY0	Bacillus_phage	100.0	1.1e-137
WP_004399423.1|2412680_2412845_+	hypothetical protein	NA	O64114	Bacillus_phage	100.0	1.7e-24
WP_009967498.1|2412853_2413057_+	hypothetical protein	NA	O64115	Bacillus_phage	100.0	1.3e-34
WP_004399295.1|2413101_2413359_+	hypothetical protein	NA	O64116	Bacillus_phage	100.0	3.0e-44
WP_009967496.1|2413441_2413894_+	hypothetical protein	NA	O64117	Bacillus_phage	100.0	6.7e-79
WP_004399432.1|2413942_2414137_+	hypothetical protein	NA	O64118	Bacillus_phage	100.0	3.2e-30
WP_009967495.1|2414236_2414863_+	DUF1273 domain-containing protein	NA	A0A1P8CWY2	Bacillus_phage	89.8	5.6e-108
WP_010886544.1|2414882_2415086_+	hypothetical protein	NA	O64120	Bacillus_phage	100.0	8.5e-34
WP_010886543.1|2415125_2415818_+	HNH endonuclease	NA	O64121	Bacillus_phage	100.0	7.2e-133
WP_009967493.1|2415942_2416221_-	hypothetical protein	NA	O64122	Bacillus_phage	100.0	2.3e-45
WP_004399461.1|2416424_2416643_+	hypothetical protein	NA	O64123	Bacillus_phage	100.0	2.7e-33
WP_009967489.1|2416659_2417034_-	hypothetical protein	NA	A0A1P8CWZ2	Bacillus_phage	100.0	3.4e-60
WP_004399557.1|2417147_2417489_+	hypothetical protein	NA	O64125	Bacillus_phage	100.0	8.1e-61
WP_009967487.1|2417448_2417805_+	hypothetical protein	NA	O64126	Bacillus_phage	100.0	1.6e-51
WP_004399296.1|2417806_2418154_+	hypothetical protein	NA	O64127	Bacillus_phage	100.0	1.1e-60
WP_004399538.1|2418230_2418380_-	hypothetical protein	NA	O64128	Bacillus_phage	100.0	2.7e-21
WP_004399463.1|2418545_2418959_+	hypothetical protein	NA	O64129	Bacillus_phage	100.0	1.8e-78
WP_004399261.1|2419024_2419837_-	SPBc2 prophage-derived DNA ligase-like protein LigB	NA	O64130	Bacillus_phage	100.0	2.5e-156
WP_004399300.1|2419906_2420581_-	SOS response-associated peptidase	NA	A0A1P8CX02	Bacillus_phage	98.6	5.9e-79
WP_004399584.1|2420651_2420873_+	hypothetical protein	NA	O64132	Bacillus_phage	100.0	5.8e-36
WP_004399280.1|2420927_2421323_+	hypothetical protein	NA	O64133	Bacillus_phage	100.0	7.7e-71
WP_004399555.1|2421421_2422246_+	gamma-polyglutamate hydrolase PghZ	NA	O64134	Bacillus_phage	100.0	7.8e-150
WP_009967482.1|2422242_2424003_+	hypothetical protein	NA	O64135	Bacillus_phage	100.0	0.0e+00
WP_004399516.1|2424091_2424388_+	hypothetical protein	NA	O64136	Bacillus_phage	100.0	8.1e-49
WP_004399313.1|2424450_2424831_+	hypothetical protein	NA	O64137	Bacillus_phage	100.0	3.8e-67
WP_004399509.1|2424907_2425222_+	SPBc2 prophage-derived stress response protein SCP1	NA	NA	NA	NA	NA
WP_004399457.1|2425395_2425767_+	hypothetical protein	NA	O64139	Bacillus_phage	100.0	2.6e-65
WP_004399276.1|2425788_2426703_+	hypothetical protein	NA	O64140	Bacillus_phage	100.0	3.0e-171
WP_004399537.1|2426785_2427757_+	ATP-binding protein	NA	A0A1P8CX29	Bacillus_phage	100.0	1.7e-180
WP_009967478.1|2427799_2428270_+	hypothetical protein	NA	A0A1P8CX08	Bacillus_phage	100.0	1.4e-87
WP_004399302.1|2428284_2429799_+	hypothetical protein	NA	A0A1P8CWZ7	Bacillus_phage	100.0	3.6e-286
WP_009967477.1|2429814_2430951_+	hypothetical protein	NA	A0A1P8CX05	Bacillus_phage	100.0	1.2e-225
WP_004399433.1|2430950_2432681_+	single-stranded-DNA-specific exonuclease RecJ	NA	A0A1P8CX07	Bacillus_phage	98.3	0.0e+00
WP_009967475.1|2432693_2436611_+	DNA polymerase III subunit alpha	NA	A0A1P8CX14	Bacillus_phage	96.9	0.0e+00
WP_010886542.1|2436638_2437355_+	hypothetical protein	NA	O64147	Bacillus_phage	100.0	2.1e-127
WP_004399415.1|2437472_2437622_+	hypothetical protein	NA	O64148	Bacillus_phage	100.0	7.9e-21
WP_009967473.1|2437657_2437855_+	hypothetical protein	NA	O64149	Bacillus_phage	100.0	1.9e-30
WP_009967472.1|2437887_2438103_+	hypothetical protein	NA	O64150	Bacillus_phage	100.0	7.9e-38
WP_004399305.1|2438095_2438251_+	hypothetical protein	NA	A0A1P8CX36	Bacillus_phage	100.0	2.0e-22
WP_004399428.1|2438250_2438748_+	hypothetical protein	NA	A0A1P8CX28	Bacillus_phage	100.0	1.0e-88
WP_004399368.1|2438756_2439275_+	5'-3'-deoxyribonucleotidase	NA	A0A1P8CX15	Bacillus_phage	100.0	2.2e-97
WP_004399507.1|2439306_2439426_+	hypothetical protein	NA	O64154	Bacillus_phage	100.0	1.7e-13
WP_004399270.1|2439474_2440806_+	DNA (cytosine-5-)-methyltransferase	NA	Q77YW9	Bacillus_phage	100.0	1.5e-256
WP_004399346.1|2440849_2441068_+	hypothetical protein	NA	O64155	Bacillus_phage	100.0	4.3e-31
WP_004399530.1|2441070_2441436_+	hypothetical protein	NA	O64156	Bacillus_phage	100.0	4.9e-64
WP_004399541.1|2441475_2441703_+	hypothetical protein	NA	O64157	Bacillus_phage	100.0	9.2e-37
WP_010886541.1|2441715_2441898_+	hypothetical protein	NA	O64158	Bacillus_phage	100.0	1.5e-26
WP_009969822.1|2441964_2442177_+	hypothetical protein	NA	O64159	Bacillus_phage	100.0	1.2e-35
WP_004399362.1|2442280_2442400_-	YhzE/YjcZ family sporulation protein YosA	NA	NA	NA	NA	NA
WP_004399458.1|2442530_2442710_+	hypothetical protein	NA	O64161	Bacillus_phage	100.0	6.8e-27
WP_009967465.1|2442754_2443297_+	hypothetical protein	NA	O64162	Bacillus_phage	100.0	1.4e-99
WP_009967464.1|2443335_2443731_+	hypothetical protein	NA	O64163	Bacillus_phage	100.0	4.1e-72
WP_004399279.1|2443745_2444093_+	hypothetical protein	NA	O64164	Bacillus_phage	100.0	1.2e-56
WP_004399307.1|2444106_2444232_+	hypothetical protein	NA	O64165	Bacillus_phage	100.0	3.5e-14
WP_004399442.1|2444274_2444637_+	hypothetical protein	NA	O64166	Bacillus_phage	100.0	8.6e-61
WP_004399315.1|2444697_2445168_+	hypothetical protein	NA	O64167	Bacillus_phage	100.0	1.4e-82
WP_004399476.1|2445199_2445334_+	hypothetical protein	NA	O64168	Bacillus_phage	100.0	2.5e-18
WP_004399360.1|2445354_2445549_+	hypothetical protein	NA	O64169	Bacillus_phage	100.0	7.6e-32
WP_009967463.1|2445593_2445794_+	hypothetical protein	NA	O64170	Bacillus_phage	100.0	2.1e-32
WP_004399275.1|2445881_2446235_+	hypothetical protein	NA	O64171	Bacillus_phage	100.0	1.1e-60
WP_004399478.1|2446234_2446630_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A1P8CX56	Bacillus_phage	95.4	3.7e-65
WP_080031206.1|2446637_2447315_+	ribonucleotide-diphosphate reductase subunit alpha	NA	A0A1P8CX40	Bacillus_phage	88.4	2.3e-107
WP_095374983.1|2447561_2450099_+	hypothetical protein	NA	A0A1P8CX40	Bacillus_phage	99.1	0.0e+00
WP_004399561.1|2451120_2451642_+	HNH endonuclease	NA	A0A1P8CX39	Bacillus_phage	100.0	7.4e-98
WP_004399328.1|2452222_2452465_+	thioredoxin family protein	NA	A0A1P8CX24	Bacillus_phage	100.0	1.4e-38
WP_004399492.1|2452510_2452939_+	SPBc2 prophage-derived deoxyuridine 5'-triphosphate nucleotidohydrolase YosS	NA	A0A1P8CX51	Bacillus_phage	100.0	5.4e-78
WP_004399409.1|2453033_2453483_+	SPBc2 prophage-derived transcriptional regulator YosT	NA	A0A1P8CX48	Bacillus_phage	100.0	2.0e-83
WP_009967458.1|2453522_2453768_-	hypothetical protein	NA	A0A1P8CX50	Bacillus_phage	100.0	1.6e-31
WP_004399585.1|2453919_2454087_+	hypothetical protein	NA	A0A1P8CX64	Bacillus_phage	88.9	1.8e-21
WP_004399449.1|2454087_2454378_+	hypothetical protein	NA	O64180	Bacillus_phage	100.0	4.3e-47
WP_010886537.1|2454524_2454866_+	hypothetical protein	NA	O64181	Bacillus_phage	100.0	5.1e-55
WP_004399299.1|2455096_2455450_+	hypothetical protein	NA	A0A1P8CX43	Bacillus_phage	64.1	3.9e-34
2454960:2454985	attR	ATAGACAAATACAAATAATATGTATA	NA	NA	NA	NA
WP_009967454.1|2455749_2455968_-	acid-soluble spore protein SspC	NA	Q77YX0	Bacillus_phage	100.0	5.6e-31
WP_004399351.1|2456086_2456914_+	hypothetical protein	NA	O64184	Bacillus_phage	100.0	4.4e-169
WP_004399249.1|2456957_2457149_+	hypothetical protein	NA	A0A1P8CX54	Bacillus_phage	100.0	1.0e-33
WP_009967449.1|2457188_2457320_+	rubrerythrin family protein	NA	A0A1P8CX61	Bacillus_phage	100.0	2.6e-20
WP_009967447.1|2457355_2457502_+	hypothetical protein	NA	A0A1P8CX49	Bacillus_phage	100.0	1.0e-17
WP_010886536.1|2457533_2457611_+	hypothetical protein	NA	A0A1P8CX55	Bacillus_phage	100.0	7.4e-07
WP_010886535.1|2457623_2457941_+	hypothetical protein	NA	A0A1P8CX53	Bacillus_phage	100.0	2.1e-55
WP_010886534.1|2457956_2458130_+	hypothetical protein	NA	O64190	Bacillus_phage	100.0	3.4e-23
WP_004399562.1|2458126_2458489_+	hypothetical protein	NA	A0A1P8CX73	Bacillus_phage	100.0	1.1e-63
WP_009967444.1|2458554_2458767_+	hypothetical protein	NA	O64192	Bacillus_phage	100.0	5.2e-34
WP_010886533.1|2458850_2459036_+	hypothetical protein	NA	O64193	Bacillus_phage	100.0	2.1e-26
WP_004399259.1|2459037_2459280_-	helix-turn-helix transcriptional regulator	NA	O64194	Bacillus_phage	100.0	8.6e-41
WP_004399411.1|2459354_2459942_+	hypothetical protein	NA	O64195	Bacillus_phage	100.0	3.6e-109
WP_004399451.1|2459944_2460121_+	recombination directionality factor SprB	NA	O64196	Bacillus_phage	100.0	5.3e-24
WP_004399353.1|2460155_2460581_-	SDR family NAD(P)-dependent oxidoreductase	NA	A0A1V0SAI8	Catovirus	36.8	4.9e-15
>prophage 184
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	2493938	2498443	4211343		Phthorimaea_operculella_granulovirus(33.33%)	4	NA	NA
WP_004399256.1|2493938_2495156_+	glycosyl transferase family 1	NA	G4WEM5	Phthorimaea_operculella_granulovirus	30.7	6.6e-12
WP_004399265.1|2495537_2496782_+	D-gamma-glutamyl-meso-diaminopimelic acid endopeptidase CwlS	NA	A0A1V0DZX6	Clostridioides_phage	41.2	1.0e-15
WP_004399243.1|2496874_2497465_+	superoxide dismutase-like protein YojM	NA	NA	NA	NA	NA
WP_010886530.1|2497528_2498443_+	MoxR family ATPase	NA	R4TG24	Halovirus	27.6	5.1e-09
>prophage 185
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	2507305	2508151	4211343		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
WP_004399227.1|2507305_2508151_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	38.6	8.5e-35
>prophage 186
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	2516422	2519309	4211343		Moumouvirus(50.0%)	2	NA	NA
WP_004399229.1|2516422_2518198_+	DNA helicase RecQ	NA	M1PGQ0	Moumouvirus	37.3	1.1e-81
WP_003231267.1|2518445_2519309_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A217ER34	Bacillus_phage	71.7	1.4e-32
>prophage 187
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	2526227	2529141	4211343		Streptococcus_phage(100.0%)	4	NA	NA
WP_003231283.1|2526227_2526905_-	lysozyme family protein	NA	A0A1S5SEZ8	Streptococcus_phage	35.0	7.6e-18
WP_003231284.1|2527098_2527422_+	Zn(II)-responsive metalloregulatory transcriptional repressor CzrA	NA	NA	NA	NA	NA
WP_004399253.1|2527448_2527994_-	protein csk22	NA	NA	NA	NA	NA
WP_003231290.1|2528199_2529141_+	YafY family transcriptional regulator	NA	A0A1B0RXM1	Streptococcus_phage	26.6	1.1e-06
>prophage 188
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	2533581	2542946	4211343	holin	Bacillus_phage(80.0%)	8	NA	NA
WP_004399426.1|2533581_2536002_-	peptidase G2	NA	D6R401	Bacillus_phage	50.1	1.1e-220
WP_004399325.1|2536428_2537865_-	flavin monoamine oxidase family protein	NA	A0A2K9L022	Tupanvirus	30.6	1.5e-07
WP_004399321.1|2537992_2538550_+	SMI1/KNR4 family protein	NA	O64022	Bacillus_phage	95.7	1.2e-101
WP_004399481.1|2538651_2540454_+	type II toxin-antitoxin system toxin ribonuclease YobL	NA	A0A1P8CWI7	Bacillus_phage	83.0	7.5e-214
WP_003231326.1|2540463_2540922_+	type II toxin-antitoxin system antitoxin YobK	NA	NA	NA	NA	NA
WP_003231327.1|2541121_2541964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_120322743.1|2542232_2542394_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_009967411.1|2542646_2542946_+	hypothetical protein	NA	A0A1P8CWJ9	Bacillus_phage	97.0	1.1e-48
>prophage 189
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	2546830	2563675	4211343	holin	Bacillus_phage(84.62%)	23	NA	NA
WP_009967409.1|2546830_2547166_-	hypothetical protein	NA	A0A1P8CWM9	Bacillus_phage	86.5	7.2e-46
WP_003231333.1|2547374_2547668_+	YolD-like family protein	NA	O64030	Bacillus_phage	86.6	7.5e-39
WP_010886527.1|2547660_2548008_+	DNA repair protein YozK	NA	O64031	Bacillus_phage	95.7	1.5e-57
WP_003231337.1|2548044_2548698_+	DNA repair protein YobH	NA	O64031	Bacillus_phage	95.3	6.2e-118
WP_004399440.1|2548823_2548946_-	Phr family secreted Rap phosphatase inhibitor	NA	NA	NA	NA	NA
WP_003231340.1|2548942_2550058_-	response regulator aspartate phosphatase RapK	NA	D6R410	Bacillus_phage	49.2	1.5e-95
WP_075058859.1|2550212_2550377_-|holin	phage holin	holin	A0A1P8CWN5	Bacillus_phage	92.6	3.9e-21
WP_010886526.1|2551130_2551391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003231345.1|2551515_2551971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009967407.1|2551974_2552199_-	hypothetical protein	NA	A0A1P8CWZ1	Bacillus_phage	82.0	8.9e-16
WP_003231348.1|2552343_2552517_+	hypothetical protein	NA	A0A1P8CWY7	Bacillus_phage	82.5	5.6e-18
WP_003231350.1|2552569_2553493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004399318.1|2553747_2554407_-	SOS response-associated peptidase	NA	A0A1P8CX02	Bacillus_phage	90.9	5.4e-69
WP_003231354.1|2554628_2554994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004399488.1|2555201_2555558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009967401.1|2555591_2555930_-	helix-turn-helix transcriptional regulator	NA	A0A1B1P7A0	Bacillus_phage	34.4	4.6e-08
WP_003231362.1|2556100_2556340_+	TM2 domain-containing protein	NA	M4ZS56	Bacillus_phage	67.1	2.4e-19
WP_003231377.1|2556967_2557609_+	endo-1,4-beta-xylanase XynA	NA	NA	NA	NA	NA
WP_003231379.1|2558278_2560879_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	34.8	9.6e-45
WP_009967400.1|2561255_2561519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003231381.1|2561622_2561835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003231383.1|2561895_2562258_+	DUF3221 domain-containing protein	NA	NA	NA	NA	NA
WP_003231385.1|2562754_2563675_-	class A beta-lactamase	NA	A0A1B0VBP7	Salmonella_phage	45.9	8.6e-57
>prophage 190
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	2575485	2576169	4211343		Bacillus_phage(100.0%)	1	NA	NA
WP_004399422.1|2575485_2576169_-	SOS response-associated peptidase	NA	A0A1P8CX02	Bacillus_phage	83.8	9.9e-66
>prophage 191
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	2581093	2582779	4211343		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_003231425.1|2581093_2582779_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	46.0	2.8e-13
>prophage 192
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	2587131	2588166	4211343		Streptococcus_phage(100.0%)	1	NA	NA
WP_009967372.1|2587131_2588166_+	2-hydroxyacid dehydrogenase	NA	M1NSB9	Streptococcus_phage	30.1	5.7e-25
>prophage 193
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	2592937	2596475	4211343		Streptococcus_phage(50.0%)	4	NA	NA
WP_004399223.1|2592937_2593654_+	3-ketoacyl-ACP reductase	NA	W8CYX9	Bacillus_phage	78.0	9.7e-48
WP_003220337.1|2593953_2594322_+	replication termination protein	NA	A0A0K2CP62	Brevibacillus_phage	41.8	9.2e-18
WP_010886524.1|2594469_2595363_+	Pyrroline-5-carboxylate reductase 1	NA	A0A1X9I6T5	Streptococcus_phage	32.7	1.0e-30
WP_003231456.1|2595359_2596475_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	41.7	9.1e-69
>prophage 194
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	2604809	2608807	4211343	integrase	Burkholderia_virus(50.0%)	4	2607924:2607937	2628478:2628491
WP_003231468.1|2604809_2605667_+	LysR family transcriptional regulator YofA	NA	Q6JIH3	Burkholderia_virus	35.0	4.5e-07
WP_003231470.1|2605767_2607531_-	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_003231472.1|2607715_2607946_+	excisionase family DNA-binding protein	NA	NA	NA	NA	NA
2607924:2607937	attL	TTGATGTAAAGGAT	NA	NA	NA	NA
WP_003231473.1|2608261_2608807_+|integrase	site-specific integrase	integrase	A0A1B0T6D2	Bacillus_phage	51.4	3.6e-42
WP_003231473.1|2608261_2608807_+|integrase	site-specific integrase	integrase	A0A1B0T6D2	Bacillus_phage	51.4	3.6e-42
2628478:2628491	attR	TTGATGTAAAGGAT	NA	NA	NA	NA
>prophage 195
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	2614250	2629643	4211343		Tupanvirus(100.0%)	2	NA	NA
WP_010886523.1|2614250_2621936_+	non-ribosomal plipastatin synthetase PpsA	NA	A0A2K9KZV5	Tupanvirus	25.7	4.3e-85
WP_003247155.1|2621960_2629643_+	non-ribosomal plipastatin synthetase PpsB	NA	A0A2K9L3I8	Tupanvirus	26.5	8.3e-145
>prophage 196
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	2632980	2647639	4211343		Tupanvirus(100.0%)	2	NA	NA
WP_009967354.1|2632980_2643792_+	non-ribosomal plipastatin synthetase PpsD	NA	A0A2K9KZV5	Tupanvirus	27.5	1.2e-165
WP_010886522.1|2643799_2647639_+	non-ribosomal plipastatin synthetase PpsE	NA	A0A2K9KZV5	Tupanvirus	26.5	9.7e-86
>prophage 197
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	2651662	2653312	4211343		Staphylococcus_phage(100.0%)	1	NA	NA
WP_003244755.1|2651662_2653312_+	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	28.9	3.2e-30
>prophage 198
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	2660241	2661135	4211343		Bacillus_phage(100.0%)	1	NA	NA
WP_003245127.1|2660241_2661135_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	54.9	3.1e-83
>prophage 199
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	2669968	2674360	4211343		Bacillus_phage(50.0%)	2	NA	NA
WP_003231550.1|2669968_2672389_-	DNA topoisomerase IV subunit A	NA	A0A172JHV7	Bacillus_phage	32.5	2.8e-99
WP_003231552.1|2672392_2674360_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	42.2	6.7e-123
>prophage 200
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	2689580	2692616	4211343		Bacillus_phage(66.67%)	4	NA	NA
WP_003238209.1|2689580_2690198_+	repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	62.3	2.5e-15
WP_003231604.1|2690739_2691174_-	metallothiol transferase FosB	NA	Q2LI91	Bacillus_phage	66.4	5.3e-41
WP_003231606.1|2691291_2691831_+	YndM family protein	NA	NA	NA	NA	NA
WP_003245793.1|2691857_2692616_-	gamma-polyglutamate hydrolase PghL	NA	O64134	Bacillus_phage	50.2	6.6e-55
>prophage 201
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	2704778	2707757	4211343	coat	Bacillus_phage(100.0%)	4	NA	NA
WP_003244896.1|2704778_2705618_-	thymidylate synthase	NA	A0A1P8CX42	Bacillus_phage	97.1	4.0e-162
WP_003231643.1|2705891_2706056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003231648.1|2706459_2706720_+|coat	spore coat protein CotU	coat	NA	NA	NA	NA
WP_003245820.1|2707322_2707757_-	dUTP diphosphatase	NA	A0A1P8CX51	Bacillus_phage	93.0	2.0e-72
>prophage 202
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	2711823	2712459	4211343		Bacillus_phage(100.0%)	1	NA	NA
WP_003245469.1|2711823_2712459_+	endonuclease YncB	NA	A0A1P8CWK6	Bacillus_phage	68.5	1.7e-72
>prophage 203
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	2726869	2727214	4211343		Bacillus_phage(100.0%)	1	NA	NA
WP_003244759.1|2726869_2727214_-	hypothetical protein	NA	O64021	Bacillus_phage	83.9	4.2e-33
>prophage 204
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	2732665	2739220	4211343		Bacillus_phage(50.0%)	6	NA	NA
WP_003231746.1|2732665_2733634_-	stage V sporulation protein K	NA	G3MAX6	Bacillus_virus	40.5	5.2e-52
WP_003244862.1|2734257_2735025_+	sporulation-specific N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	49.5	9.1e-52
WP_003245105.1|2735088_2735709_-	hypothetical protein	NA	A0A127AYS1	Bacillus_phage	48.4	1.6e-46
WP_003231754.1|2735758_2736748_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	F8WQ21	Bacillus_phage	83.5	1.9e-155
WP_003245700.1|2736765_2738868_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	U5PY35	Bacillus_phage	87.0	0.0e+00
WP_003231758.1|2738827_2739220_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	G3MBF1	Bacillus_virus	58.3	2.5e-29
>prophage 205
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	2743681	2815031	4211343	protease	Paenibacillus_phage(71.43%)	10	NA	NA
WP_003245758.1|2743681_2744389_-	poly-gamma-glutamate hydrolase family protein	NA	F8WQ53	Bacillus_phage	56.9	3.2e-51
WP_009967303.1|2745124_2746453_+|protease	serine protease AprX	protease	A0A1B0T6A2	Bacillus_phage	33.2	1.6e-27
WP_003244800.1|2746563_2747388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003245436.1|2747466_2747823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003244857.1|2748053_2749271_+	cytochrome P450	NA	NA	NA	NA	NA
WP_003245624.1|2749315_2756947_-	methyltransferase	NA	D0R7J2	Paenibacillus_phage	29.4	2.0e-37
WP_010886514.1|2756961_2773428_-	amino acid adenylation domain-containing protein	NA	D0R7J2	Paenibacillus_phage	56.1	6.8e-120
WP_003245093.1|2773495_2786284_-	polyketide synthase PksM	NA	D0R7J2	Paenibacillus_phage	31.4	4.3e-37
WP_010886513.1|2786299_2799916_-	polyketide synthase PksL	NA	D0R7J2	Paenibacillus_phage	29.0	8.9e-33
WP_003245563.1|2799899_2815031_-	polyketide synthase PksJ	NA	D0R7J2	Paenibacillus_phage	59.6	1.5e-126
>prophage 206
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	2827621	2832097	4211343		Wolbachia_phage(50.0%)	2	NA	NA
WP_003245099.1|2827621_2829505_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	31.0	5.9e-68
WP_003244841.1|2829520_2832097_-	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	27.7	2.4e-40
>prophage 207
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	2835146	2843197	4211343		Bacillus_phage(40.0%)	7	NA	NA
WP_003231837.1|2835146_2836325_-	glycine C-acetyltransferase	NA	D2TEZ5	Emiliania_huxleyi_virus	33.1	7.7e-50
WP_003244880.1|2836337_2837381_-	L-threonine 3-dehydrogenase	NA	E3SJ82	Synechococcus_phage	25.9	6.6e-21
WP_003154135.1|2837646_2837907_-	stage V sporulation protein SpoVS	NA	J9PTX7	Bacillus_phage	42.5	1.2e-08
WP_003245138.1|2838106_2838901_-	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	NA	NA	NA	NA
WP_003221010.1|2838969_2840532_-	ribonuclease Y	NA	NA	NA	NA	NA
WP_003245877.1|2840807_2841983_-	serine hydrolase	NA	A0A0B5A438	Mycobacterium_phage	24.8	1.5e-08
WP_003245789.1|2842150_2843197_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	73.7	1.9e-137
>prophage 208
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	2847460	2855566	4211343		Trichoplusia_ni_ascovirus(25.0%)	6	NA	NA
WP_003244676.1|2847460_2848189_-	EF-P-5 aminopentanone reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	28.4	4.2e-14
WP_003244823.1|2848243_2849530_-	insulinase family protein	NA	A0A2H4UVM3	Bodo_saltans_virus	27.9	6.1e-08
WP_010886510.1|2849526_2850807_-	insulinase family protein	NA	A0A1X9I714	Streptococcus_phage	29.1	7.5e-51
WP_010886509.1|2850986_2852195_-	bacillibactin exporter BcbE	NA	NA	NA	NA	NA
WP_003245732.1|2852333_2853059_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003245350.1|2853202_2855566_-	DNA translocase SpoIIIE	NA	A0A218M9A2	Mycobacterium_phage	47.1	1.4e-87
>prophage 209
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	2863997	2865227	4211343		Bacillus_virus(100.0%)	1	NA	NA
WP_003245717.1|2863997_2865227_-	insulinase family protein	NA	G3MBJ8	Bacillus_virus	32.1	8.8e-49
>prophage 210
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	2869058	2880710	4211343	tRNA	Indivirus(33.33%)	10	NA	NA
WP_003245551.1|2869058_2870009_-	bifunctional riboflavin kinase/FAD synthetase	NA	A0A1V0SD03	Indivirus	28.5	2.0e-08
WP_003244678.1|2870027_2870957_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_009967251.1|2871038_2871392_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_003220950.1|2871408_2871687_-	DUF503 domain-containing protein	NA	NA	NA	NA	NA
WP_003231906.1|2871683_2873834_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	25.2	3.8e-23
WP_003220946.1|2873853_2874156_-	YlxQ family RNA-binding protein	NA	NA	NA	NA	NA
WP_009967250.1|2874157_2874433_-	glucose-induced regulator RulR	NA	NA	NA	NA	NA
WP_003231912.1|2874446_2875562_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_003231915.1|2875596_2876067_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_003245843.1|2876396_2880710_-	PolC-type DNA polymerase III	NA	A0A0A7RWA3	Clostridium_phage	33.2	1.6e-23
>prophage 211
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	2885846	2886629	4211343		Flavobacterium_phage(100.0%)	1	NA	NA
WP_003231925.1|2885846_2886629_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	43.0	3.7e-24
>prophage 212
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	2890585	2891350	4211343		Bacillus_phage(100.0%)	1	NA	NA
WP_003220911.1|2890585_2891350_-	RNA polymerase sigma-28 factor SigD	NA	A0A0A0PIT2	Bacillus_phage	26.0	1.8e-07
>prophage 213
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	2917763	2925263	4211343	protease,tRNA	Erwinia_phage(25.0%)	6	NA	NA
WP_003245556.1|2917763_2919167_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	27.4	3.7e-43
WP_003238555.1|2919183_2919729_-|protease	ATP-dependent protease subunit ClpQ	protease	NA	NA	NA	NA
WP_003231988.1|2919741_2920656_-	tyrosine recombinase XerC	NA	A0A0K2CP59	Brevibacillus_phage	29.8	5.2e-30
WP_003244725.1|2920723_2922031_-|tRNA	FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))- methyltransferase TrmFO	tRNA	NA	NA	NA	NA
WP_003245599.1|2922106_2924182_-	type I DNA topoisomerase	NA	A0A2K9L5F8	Tupanvirus	40.1	3.3e-104
WP_003245871.1|2924369_2925263_-	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	37.1	1.3e-28
>prophage 214
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	2929624	2930392	4211343		Cafeteria_roenbergensis_virus(100.0%)	1	NA	NA
WP_003245658.1|2929624_2930392_-	ribonuclease HII	NA	E3T5H8	Cafeteria_roenbergensis_virus	43.1	8.6e-26
>prophage 215
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	2941383	2943330	4211343		Micromonas_pusilla_virus(33.33%)	3	NA	NA
WP_003232030.1|2941383_2942133_-	ribonuclease III	NA	M4QMG4	Micromonas_pusilla_virus	35.9	4.2e-25
WP_003154310.1|2942272_2942506_-	acyl carrier protein	NA	M4M9G2	Vibrio_phage	44.9	7.1e-08
WP_003232035.1|2942589_2943330_-	3-oxoacyl-[acyl-carrier-protein] reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.4	3.0e-20
>prophage 216
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	2954754	2956701	4211343		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_003232062.1|2954754_2956701_-	serine/threonine protein kinase PrkC	NA	A0A1B1IUU3	uncultured_Mediterranean_phage	36.1	8.3e-25
>prophage 217
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	2959890	2969878	4211343	tRNA	Prochlorococcus_phage(20.0%)	9	NA	NA
WP_003232070.1|2959890_2960844_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	32.9	1.1e-09
WP_003232077.1|2960848_2961331_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	42.7	7.0e-18
WP_003232079.1|2961357_2963775_-	primosomal protein N'	NA	NA	NA	NA	NA
WP_009967219.1|2963771_2964992_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.6	9.1e-46
WP_003221520.1|2965072_2965276_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_003232083.1|2965279_2965894_-	guanylate kinase	NA	S4W1R9	Pandoravirus	33.7	1.1e-12
WP_003154355.1|2965901_2966171_-	extracellular matrix/biofilm regulator RemA	NA	NA	NA	NA	NA
WP_009967215.1|2966247_2967123_-	YicC family protein	NA	NA	NA	NA	NA
WP_003232087.1|2967205_2969878_-	calcium-translocating P-type ATPase, SERCA-type	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	29.5	1.8e-86
>prophage 218
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	2973880	2975635	4211343		Freshwater_phage(50.0%)	2	NA	NA
WP_003232097.1|2973880_2974474_-	adenylyl-sulfate kinase	NA	A0A1B0XTK9	Freshwater_phage	41.9	3.3e-09
WP_003245745.1|2974486_2975635_-	sulfate adenylyltransferase	NA	A0A2K9L0F0	Tupanvirus	29.7	1.0e-38
>prophage 219
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	2984091	2994486	4211343	tRNA	Halovirus(25.0%)	9	NA	NA
WP_003232115.1|2984091_2985186_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	38.2	1.5e-60
WP_003245035.1|2985182_2986469_-	dihydroorotase	NA	NA	NA	NA	NA
WP_003245123.1|2986452_2987367_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	36.4	5.8e-37
WP_003221479.1|2987512_2988820_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	35.7	1.5e-59
WP_003232127.1|2988993_2989539_-	bifunctional pyrimidine operon transcriptional regulator/uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_003245307.1|2989721_2990633_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_003245047.1|2990634_2991099_-	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_003245479.1|2991201_2991576_-	sporulation-related RNA polymerase-binding protein YlyA	NA	NA	NA	NA	NA
WP_003245512.1|2991720_2994486_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2P1ELB8	Moumouvirus	25.9	1.4e-81
>prophage 220
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	3000488	3008560	4211343		Bacillus_phage(75.0%)	5	NA	NA
WP_003232156.1|3000488_3001283_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.6	1.6e-11
WP_009967190.1|3001430_3002213_-	RNA polymerase sporulation sigma factor SigG	NA	A0A0Y0AU18	Bacillus_phage	43.9	2.0e-46
WP_003221446.1|3002352_3003072_-	RNA polymerase sporulation sigma factor SigE	NA	A0A0A0RV91	Bacillus_phage	28.3	8.1e-18
WP_003232163.1|3003134_3004064_-	sigma-E processing peptidase SpoIIGA	NA	NA	NA	NA	NA
WP_003245629.1|3004258_3008560_-	bacillopeptidase F	NA	A0A217EQY2	Bacillus_phage	32.1	3.5e-23
>prophage 221
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	3037279	3041464	4211343		uncultured_Mediterranean_phage(50.0%)	7	NA	NA
WP_003245283.1|3037279_3037765_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	40.5	3.2e-26
WP_003232227.1|3037769_3038324_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_009967171.1|3038646_3038919_-	YlbG family protein	NA	NA	NA	NA	NA
WP_003221370.1|3038973_3039423_-	competence/sporulation regulator complex protein RicF	NA	NA	NA	NA	NA
WP_003232231.1|3039538_3039778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003232233.1|3039793_3040192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003245434.1|3040423_3041464_-	CAP domain-containing protein	NA	U5Q1E2	Bacillus_phage	39.5	9.9e-17
>prophage 222
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	3057049	3061722	4211343		Vibrio_phage(50.0%)	5	NA	NA
WP_003245272.1|3057049_3058378_-	PhoH family protein	NA	A0A2I7SAD7	Vibrio_phage	34.3	3.1e-55
WP_003232269.1|3058532_3059162_+	YhcN/YlaJ family sporulation lipoprotein	NA	NA	NA	NA	NA
WP_003232271.1|3059244_3059454_+	YlaI family protein	NA	NA	NA	NA	NA
WP_003232274.1|3059509_3059827_-	membrane protein	NA	NA	NA	NA	NA
WP_003232278.1|3059883_3061722_-	translational GTPase TypA	NA	A0A1S5SF82	Streptococcus_phage	38.8	3.8e-19
>prophage 223
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	3074560	3075973	4211343		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_003232309.1|3074560_3075973_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.3	7.5e-44
>prophage 224
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	3081093	3082457	4211343		Synechococcus_phage(50.0%)	2	NA	NA
WP_003245474.1|3081093_3081648_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.8	3.2e-14
WP_003245153.1|3081683_3082457_-	Cof-type HAD-IIB family hydrolase	NA	Q0GXW5	Lactococcus_phage	22.6	2.0e-06
>prophage 225
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	3088223	3089978	4211343		Bacillus_phage(50.0%)	2	NA	NA
WP_003232333.1|3088223_3089510_-	two-component sensor histidine kinase KinC	NA	W8CYF6	Bacillus_phage	29.7	4.8e-21
WP_003244728.1|3089699_3089978_-	transcriptional regulator AbhA	NA	A0A2I7SC16	Paenibacillus_phage	47.3	7.4e-12
>prophage 226
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	3093847	3095470	4211343		Tupanvirus(100.0%)	1	NA	NA
WP_003232344.1|3093847_3095470_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	27.0	7.6e-48
>prophage 227
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	3101734	3107954	4211343		Bacillus_phage(66.67%)	5	NA	NA
WP_003232356.1|3101734_3102427_-	ABC transporter ATP-binding protein YknY	NA	G9BWD6	Planktothrix_phage	39.5	4.8e-36
WP_003244902.1|3102427_3103561_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_003232360.1|3103565_3104261_-	YIP1 family protein	NA	NA	NA	NA	NA
WP_003232362.1|3104370_3106185_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.7	2.7e-54
WP_009967136.1|3106196_3107954_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	33.5	1.1e-63
>prophage 228
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	3114521	3114968	4211343		Bacillus_phage(100.0%)	1	NA	NA
WP_003245810.1|3114521_3114968_-	thiol-disulfide oxidoreductase YkuV	NA	A0A127AW88	Bacillus_phage	47.9	2.9e-34
>prophage 229
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	3118974	3120805	4211343		Bacillus_phage(100.0%)	3	NA	NA
WP_003245242.1|3118974_3119430_-	flavodoxin	NA	A7KUZ7	Bacillus_phage	39.1	7.6e-14
WP_003232385.1|3119445_3120339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003232386.1|3120328_3120805_-	flavodoxin	NA	A7KUZ7	Bacillus_phage	36.5	6.5e-16
>prophage 230
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	3129006	3129771	4211343		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_003232398.1|3129006_3129771_-	2,4-dienoyl-CoA reductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	39.0	1.0e-39
>prophage 231
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	3133326	3144215	4211343		Bacillus_thuringiensis_phage(25.0%)	8	NA	NA
WP_009967126.1|3133326_3134238_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	33.8	6.1e-47
WP_003245246.1|3134441_3134603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003232415.1|3134804_3135986_+	aminotransferase A	NA	NA	NA	NA	NA
WP_003245779.1|3135996_3137817_-	PAS domain-containing protein	NA	Q8QKV7	Ectocarpus_siliculosus_virus	23.6	1.1e-07
WP_003245075.1|3137980_3140095_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_003244693.1|3140431_3141205_+	hypothetical protein	NA	U5Q0C0	Bacillus_phage	65.6	1.1e-41
WP_003245029.1|3141243_3142110_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003245443.1|3142247_3144215_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.8	1.3e-12
>prophage 232
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	3148556	3159337	4211343		Vibrio_phage(25.0%)	9	NA	NA
WP_003244661.1|3148556_3150656_-	PTS glucose transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	50.0	2.0e-08
WP_009967114.1|3150884_3151751_-	ptsGHI operon transcription antiterminator GlcT	NA	NA	NA	NA	NA
WP_003244772.1|3151813_3152779_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	26.9	9.8e-19
WP_003244662.1|3153060_3154152_-	di/tri-peptidase	NA	NA	NA	NA	NA
WP_003245332.1|3154317_3154521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003245873.1|3154558_3156472_-	metal-transporting ATPase PfeT	NA	E4ZFI9	Streptococcus_phage	41.1	3.7e-118
WP_003245444.1|3156707_3157205_-	sporulation thiol-disulfide oxidoreductase StoA	NA	NA	NA	NA	NA
WP_003245552.1|3157255_3158593_-	sporulation protein YkvU	NA	NA	NA	NA	NA
WP_003232442.1|3158710_3159337_-	cell wall hydrolase	NA	A0A141HRV8	Bacillus_phage	52.7	1.8e-26
>prophage 233
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	3164224	3172215	4211343	protease	Pneumococcus_phage(40.0%)	8	NA	NA
WP_003245309.1|3164224_3164971_-	glucose 1-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.7	7.8e-16
WP_003245808.1|3165139_3165496_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003218613.1|3166054_3166552_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	74.1	1.4e-56
WP_003232460.1|3166569_3167301_-	7-carboxy-7-deazaguanine synthase QueE	NA	E7DN68	Pneumococcus_phage	47.2	7.6e-56
WP_003232462.1|3167293_3167743_-	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
WP_003245417.1|3167735_3168395_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	57.5	9.5e-66
WP_003244712.1|3168707_3169751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009967104.1|3170115_3172215_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	42.9	1.1e-131
>prophage 234
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	3185919	3188630	4211343		Acanthamoeba_polyphaga_mimivirus(50.0%)	2	NA	NA
WP_003232502.1|3185919_3186417_-	methylated-DNA--protein-cysteine methyltransferase	NA	A0A0G2Y3R2	Acanthamoeba_polyphaga_mimivirus	50.5	5.9e-20
WP_003232504.1|3186413_3188630_-	sporulation two-component system sensor histidine kinase KinE	NA	W8CYF6	Bacillus_phage	29.8	8.8e-23
>prophage 235
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	3193848	3197189	4211343		Bacillus_phage(100.0%)	4	NA	NA
WP_003218568.1|3193848_3194043_+	alpha/beta-type small acid-soluble spore protein	NA	A0A217EQS5	Bacillus_phage	66.7	1.4e-14
WP_003244727.1|3194053_3195199_-	anti-sigma-I factor RsgI	NA	NA	NA	NA	NA
WP_003245855.1|3195195_3195951_-	RNA polymerase sigma factor SigI	NA	NA	NA	NA	NA
WP_009967096.1|3196214_3197189_-	TerC family protein	NA	A0A068EP98	Bacillus_phage	41.9	2.5e-30
>prophage 236
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	3200550	3204364	4211343		Mycobacterium_phage(50.0%)	3	NA	NA
WP_010886496.1|3200550_3201486_+	Ku protein	NA	A0A218M9C0	Mycobacterium_phage	38.4	1.7e-44
WP_010886495.1|3201489_3203325_+	DNA ligase D	NA	NA	NA	NA	NA
WP_003245533.1|3203350_3204364_-	glycosyltransferase family 2 protein	NA	A8CG95	Salmonella_phage	41.0	2.1e-51
>prophage 237
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	3213835	3229347	4211343	protease	Streptococcus_phage(33.33%)	16	NA	NA
WP_003245526.1|3213835_3215200_-	two-component system sensor histidine kinase YkoH	NA	A0A1V0SGX0	Hokovirus	29.0	7.1e-15
WP_003232551.1|3215203_3215890_-	two-component system response regulator YkoG	NA	NA	NA	NA	NA
WP_003244962.1|3216200_3216803_+	HMP/thiamine ABC transporter substrate-binding protein ThiU	NA	NA	NA	NA	NA
WP_003232554.1|3216804_3217404_+	ECF transporter S component	NA	NA	NA	NA	NA
WP_003245821.1|3217390_3219034_+	energy-coupling factor ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.6	2.0e-19
WP_003245037.1|3219008_3219773_+	HMP/thiamine ABC transporter permease ThiX	NA	NA	NA	NA	NA
WP_003232560.1|3219803_3220637_-	RsbT co-antagonist RsbRB	NA	NA	NA	NA	NA
WP_003232562.1|3220859_3221819_+|protease	serine protease Isp	protease	A0A127AWU5	Bacillus_phage	49.5	5.6e-75
WP_003232565.1|3222234_3224523_+	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_003245084.1|3224695_3225166_+	guanine deaminase	NA	S4VYZ2	Pandoravirus	45.8	1.8e-26
WP_003232568.1|3225215_3225386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003232570.1|3225412_3225823_-	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_003245653.1|3225965_3226409_+	organic hydroperoxide resistance transcriptional regulator OhrR	NA	NA	NA	NA	NA
WP_003232574.1|3226439_3226865_-	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_003245312.1|3226990_3228238_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	50.1	7.2e-99
WP_003244794.1|3228249_3229347_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	41.8	9.6e-71
>prophage 238
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	3238009	3239902	4211343		Bacillus_virus(50.0%)	2	NA	NA
WP_009967074.1|3238009_3238999_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	33.5	3.2e-17
WP_003245577.1|3239011_3239902_-	gamma-D-glutamyl-L-lysine dipeptidyl-peptidase	NA	A0A0A8WIF2	Clostridium_phage	42.7	3.1e-19
>prophage 239
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	3243694	3244702	4211343		Planktothrix_phage(100.0%)	1	NA	NA
WP_003232615.1|3243694_3244702_-	dipeptide ABC transporter ATP-binding subunit DppD	NA	G9BWD6	Planktothrix_phage	28.7	1.8e-15
>prophage 240
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	3248557	3293393	4211343	protease,plate,terminase,holin,portal	Bacillus_phage(25.71%)	57	NA	NA
WP_009967069.1|3248557_3249907_+|protease	serine protease HtrA	protease	A0A1B1IT49	uncultured_Mediterranean_phage	33.7	5.7e-25
WP_003232632.1|3250424_3251396_-	glycosyltransferase family 2 protein	NA	A0A2H5BFL1	Salmonella_phage	41.0	1.9e-62
WP_003245387.1|3251407_3253558_-	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_003244977.1|3253565_3253712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003245086.1|3253812_3254763_-	ring-cleaving dioxygenase	NA	NA	NA	NA	NA
WP_003244819.1|3255151_3256468_+	serine/threonine exchanger	NA	NA	NA	NA	NA
WP_003218470.1|3256743_3257361_+	DUF47 domain-containing protein	NA	NA	NA	NA	NA
WP_065826289.1|3257373_3258375_+	inorganic phosphate transporter	NA	NA	NA	NA	NA
WP_003244695.1|3258484_3259231_+	toxin-antitoxin-antitoxin system toxin SpoIISA	NA	NA	NA	NA	NA
WP_003232646.1|3259230_3259401_+	type II toxin-antitoxin system SpoIISB family antitoxin	NA	NA	NA	NA	NA
WP_003232648.1|3259486_3259624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003245230.1|3259660_3260554_-	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXD7	Bacillus_phage	69.7	1.8e-83
WP_003232653.1|3260566_3260830_-|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	65.5	4.7e-24
WP_003232655.1|3260842_3261112_-	hypothetical protein	NA	A0A2H4JD40	uncultured_Caudovirales_phage	64.8	6.2e-24
WP_003245597.1|3261164_3262004_-	phage-like element PBSX protein XepA	NA	NA	NA	NA	NA
WP_003232658.1|3262047_3262212_-	XkdX family protein	NA	A0A2H4JAA1	uncultured_Caudovirales_phage	66.0	3.2e-15
WP_003232660.1|3262208_3262538_-	phage-like element PBSX protein XkdW	NA	A0A2H4JCI0	uncultured_Caudovirales_phage	41.3	1.7e-15
WP_003244681.1|3262549_3264613_-	phage-like element PBSX protein XkdV	NA	A0A2H4J4R1	uncultured_Caudovirales_phage	37.4	4.8e-31
WP_003232665.1|3264615_3264888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003244743.1|3264884_3265463_-	YmfQ family protein	NA	A0A2H4J717	uncultured_Caudovirales_phage	34.2	3.0e-15
WP_003232669.1|3265446_3266493_-|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	44.3	1.3e-72
WP_003232671.1|3266485_3266911_-	DUF2634 domain-containing protein	NA	A0A2H4J6K5	uncultured_Caudovirales_phage	38.0	7.8e-13
WP_003244812.1|3266967_3267234_-	DUF2577 domain-containing protein	NA	S6C459	Thermus_phage	36.4	1.7e-05
WP_003245730.1|3267233_3268211_-	phage-like element PBSX protein XkdQ	NA	H7BV96	unidentified_phage	32.6	1.0e-39
WP_003232674.1|3268226_3268886_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A090DBR9	Clostridium_phage	34.0	3.7e-25
WP_010886493.1|3268878_3272877_-	phage-like element PBSX protein XkdO	NA	A0A1L2JY60	Aeribacillus_phage	44.9	2.1e-43
WP_003239113.1|3272878_3273028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003232676.1|3273057_3273504_-	phage-like element PBSX protein XkdN	NA	A0A249XXA9	Clostridium_phage	33.6	7.5e-14
WP_003232677.1|3273595_3274039_-	phage-like element PBSX protein XkdM	NA	A0A0K2CNG3	Brevibacillus_phage	45.2	8.4e-26
WP_003245369.1|3274040_3275441_-	phage-like element PBSX protein XkdK	NA	A0A0A7S087	Clostridium_phage	39.3	2.3e-77
WP_003232679.1|3275437_3275656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003232680.1|3275659_3276100_-	phage-like element PBSX protein XkdJ	NA	NA	NA	NA	NA
WP_003245226.1|3276112_3276598_-	HK97 gp10 family phage protein	NA	A0A249XXA4	Clostridium_phage	47.0	2.1e-38
WP_009967053.1|3276594_3276951_-	DUF3599 family protein	NA	NA	NA	NA	NA
WP_003245011.1|3276947_3277331_-	DUF3199 family protein	NA	A0A1B1P7D6	Bacillus_phage	40.2	1.9e-13
WP_003232690.1|3277352_3278288_-	phage-like element PBSX protein XkdG	NA	A0A1B1P7E3	Bacillus_phage	63.8	1.1e-104
WP_003245836.1|3278313_3279141_-	phage-like element PBSX protein XkdF	NA	A0A1B1P7E4	Bacillus_phage	58.7	2.1e-54
WP_003245427.1|3279160_3280648_-|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	55.7	1.7e-139
WP_003245584.1|3280651_3281953_-|terminase	PBSX family phage terminase large subunit	terminase	A0A2P1JTW5	Anoxybacillus_phage	60.2	2.4e-153
WP_003244697.1|3281949_3282747_-|terminase	PBSX phage terminase small subunit	terminase	A0A0S2MVB6	Bacillus_phage	50.2	8.0e-59
WP_003245797.1|3282862_3283372_-	sigma-70 family RNA polymerase sigma factor	NA	A0A1L2JY33	Aeribacillus_phage	38.6	1.9e-21
WP_109789043.1|3283492_3283687_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_003245290.1|3283690_3284041_-	phage-like element PBSX protein XkdD	NA	NA	NA	NA	NA
WP_003245588.1|3284125_3284293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010886492.1|3284292_3285093_-	ATP-binding protein	NA	A6XMI1	Bacillus_virus	51.7	5.0e-61
WP_003245799.1|3284992_3285829_-	phage-like element PBSX protein XkdB	NA	S6BFM4	Thermus_phage	28.2	1.8e-24
WP_003232712.1|3285815_3285995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003232719.1|3286172_3286514_+	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	45.8	1.3e-18
WP_003232721.1|3286676_3287273_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	51.7	8.1e-40
WP_003245071.1|3287316_3288153_-	manganese catalase	NA	NA	NA	NA	NA
WP_003244789.1|3288229_3288832_-	poly-gamma-glutamate hydrolase family protein	NA	F8WQ53	Bacillus_phage	49.2	3.8e-45
WP_003245254.1|3288937_3289315_+	PH domain-containing protein	NA	A5GYQ0	Lactococcus_phage	42.3	6.1e-17
WP_003244876.1|3289354_3290308_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A218KC88	Bacillus_phage	74.1	7.3e-67
WP_003232731.1|3290428_3290686_+	YciI family protein	NA	NA	NA	NA	NA
WP_003245487.1|3290716_3290851_-	phosphatase RapA inhibitor PhrA	NA	NA	NA	NA	NA
WP_010886491.1|3290840_3291977_-	response regulator aspartate phosphatase RapA	NA	A0A1P8CWN8	Bacillus_phage	47.4	8.3e-94
WP_003245490.1|3292121_3293393_-	ATPase YjoB	NA	A0A1V0SEI6	Indivirus	37.1	8.6e-15
>prophage 241
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	3300447	3301284	4211343		Moumouvirus(100.0%)	1	NA	NA
WP_003245605.1|3300447_3301284_-	SDR family oxidoreductase	NA	M1NMS3	Moumouvirus	30.4	2.7e-09
>prophage 242
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	3311345	3315289	4211343		Planktothrix_phage(33.33%)	5	NA	NA
WP_003232774.1|3311345_3312098_+	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.4	6.4e-18
WP_003232776.1|3312097_3312850_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_003245334.1|3312895_3313708_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_003232781.1|3313881_3314070_+	hypothetical protein	NA	A0A1P8CWV7	Bacillus_phage	77.6	3.4e-21
WP_003232783.1|3314110_3315289_-	UDP-glucosyltransferase	NA	Q0IKX4	Leucania_separata_nucleopolyhedrovirus	28.3	5.6e-08
>prophage 243
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	3326971	3358404	4211343	coat,tRNA	uncultured_Caudovirales_phage(40.0%)	40	NA	NA
WP_003245601.1|3326971_3327220_+|coat	spore coat protein CotT	coat	NA	NA	NA	NA
WP_010886488.1|3327342_3328332_+	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_003232822.1|3328951_3329281_+	YjdJ family protein	NA	NA	NA	NA	NA
WP_003232825.1|3329446_3329641_+	DUF4177 domain-containing protein	NA	NA	NA	NA	NA
WP_003244878.1|3329680_3330160_-|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
WP_009967031.1|3330388_3330784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003232828.1|3331002_3331509_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_010886487.1|3331554_3332037_-	YjdF family protein	NA	NA	NA	NA	NA
WP_003232833.1|3332206_3333154_-	mannose-6-phosphate isomerase, class I	NA	NA	NA	NA	NA
WP_003245781.1|3333168_3335121_-	PTS mannose transporter subunit IIABC	NA	NA	NA	NA	NA
WP_003245617.1|3335268_3337215_-	mannose transport/utilization transcriptional regulator ManR	NA	NA	NA	NA	NA
WP_003232839.1|3337765_3338113_+	Ig-like domain-containing protein	NA	NA	NA	NA	NA
WP_003245148.1|3338261_3339017_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010886486.1|3339253_3339571_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_003245120.1|3339744_3340272_-	hypothetical protein	NA	A0A2H4J4R0	uncultured_Caudovirales_phage	55.0	8.2e-36
WP_003245536.1|3340432_3340717_-	hypothetical protein	NA	Q9AYW8	Lactococcus_phage	33.3	3.1e-05
WP_003245581.1|3340728_3341232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003245063.1|3341497_3341959_-	sigma-70 family RNA polymerase sigma factor	NA	A0A2H4J4R7	uncultured_Caudovirales_phage	46.7	1.8e-23
WP_003245022.1|3341995_3342169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009967026.1|3342184_3342316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009967025.1|3342468_3342789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003245203.1|3342914_3344144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009967022.1|3345229_3346420_+	DUF819 domain-containing protein	NA	NA	NA	NA	NA
WP_003245116.1|3346489_3347035_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003244787.1|3347067_3348240_-	cystathionine beta-lyase	NA	NA	NA	NA	NA
WP_003232857.1|3348232_3349354_-	cystathionine gamma-synthase/O-acetylhomoserine thiolyase	NA	A0A0B5JD48	Pandoravirus	26.3	3.7e-17
WP_003245358.1|3349709_3350432_+	esterase family protein	NA	NA	NA	NA	NA
WP_003232861.1|3350468_3350984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003245407.1|3350987_3351410_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003232866.1|3351482_3351737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003245380.1|3351853_3354133_+	ATP-dependent helicase	NA	A0A068EQC7	Bacillus_phage	34.8	1.0e-90
WP_003232870.1|3354206_3354461_-	sporulation-specific transcription regulator SopVIF	NA	NA	NA	NA	NA
WP_003232872.1|3354593_3354743_-	sporulation protein YjcZ	NA	NA	NA	NA	NA
WP_003244769.1|3354824_3355031_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003244844.1|3355312_3355669_-	sporulation protein YjcA	NA	NA	NA	NA	NA
WP_003244871.1|3355828_3356215_+|coat	spore coat protein CotV	coat	NA	NA	NA	NA
WP_003245818.1|3356255_3356573_+|coat	spore coat protein CotW	coat	NA	NA	NA	NA
WP_003244668.1|3356671_3357190_+|coat	spore coat protein CotX	coat	NA	NA	NA	NA
WP_003239243.1|3357341_3357830_+|coat	spore coat protein CotY	coat	NA	NA	NA	NA
WP_003244982.1|3357957_3358404_+|coat	spore coat protein CotZ	coat	NA	NA	NA	NA
>prophage 244
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	3367724	3368459	4211343		Vibrio_phage(100.0%)	1	NA	NA
WP_003244765.1|3367724_3368459_+	bis(5'-nucleosyl)-tetraphosphatase PrpE	NA	M4Q4T6	Vibrio_phage	25.0	3.2e-06
>prophage 245
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	3372137	3372683	4211343		Bacillus_phage(100.0%)	1	NA	NA
WP_010886480.1|3372137_3372683_+	bifunctional muramidase/murein lytic transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	60.4	4.8e-39
>prophage 246
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	3379054	3384391	4211343		Pseudomonas_phage(33.33%)	6	NA	NA
WP_003232944.1|3379054_3379711_+	TerC family protein	NA	A0A2R2YAT9	Pseudomonas_phage	38.0	1.1e-29
WP_003245483.1|3379753_3380149_-	transcriptional regulator Spx	NA	NA	NA	NA	NA
WP_003244921.1|3380329_3380908_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_010886478.1|3381071_3382289_-	MFS transporter	NA	NA	NA	NA	NA
WP_003245567.1|3382395_3383313_-	oligopeptide ABC transporter ATP-binding protein OppF	NA	M1HP82	Acanthocystis_turfacea_Chlorella_virus	24.6	1.2e-05
WP_014906294.1|3383314_3384391_-	oligopeptide ABC transporter ATP-binding protein OppD	NA	G9BWD6	Planktothrix_phage	30.8	2.1e-17
>prophage 247
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	3389766	3390519	4211343		Bacillus_phage(100.0%)	1	NA	NA
WP_003239298.1|3389766_3390519_-	DUF3603 family protein	NA	A0A0A0RP53	Bacillus_phage	43.9	5.4e-49
>prophage 248
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	3394396	3396369	4211343		Organic_Lake_phycodnavirus(50.0%)	2	NA	NA
WP_003232964.1|3394396_3395386_-	oligopeptide ABC transporter ATP-binding protein AppF	NA	F2Y302	Organic_Lake_phycodnavirus	26.1	6.7e-07
WP_003232965.1|3395382_3396369_-	oligopeptide ABC transporter ATP-binding protein AppD	NA	G9BWD6	Planktothrix_phage	32.9	5.7e-22
>prophage 249
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	3403425	3404385	4211343		Only_Syngen_Nebraska_virus(100.0%)	1	NA	NA
WP_003232980.1|3403425_3404385_-	ornithine carbamoyltransferase	NA	A0A1J0F9B8	Only_Syngen_Nebraska_virus	28.6	1.2e-21
>prophage 250
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	3407457	3409747	4211343		Halovirus(50.0%)	2	NA	NA
WP_003232984.1|3407457_3408519_-	carbamoyl phosphate synthase small subunit	NA	R4TGJ8	Halovirus	39.8	1.0e-61
WP_003232985.1|3408589_3409747_-	acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.0	2.8e-28
>prophage 251
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	3413557	3415219	4211343		Tupanvirus(50.0%)	2	NA	NA
WP_003232994.1|3413557_3414988_-	FAD-binding oxidoreductase	NA	A0A2K9KZR0	Tupanvirus	29.4	3.2e-50
WP_003232996.1|3415048_3415219_-	YqaE/Pmp3 family membrane protein	NA	A0A0C5AJ71	Bacteriophage	60.0	9.4e-10
>prophage 252
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	3419294	3420146	4211343		Staphylococcus_phage(100.0%)	1	NA	NA
WP_003245785.1|3419294_3420146_+	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	32.1	4.6e-12
>prophage 253
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	3436203	3438803	4211343		Tupanvirus(33.33%)	3	NA	NA
WP_003233054.1|3436203_3437373_+	sulfate adenylyltransferase	NA	A0A2K9L0F0	Tupanvirus	32.6	3.8e-49
WP_003245829.1|3437369_3437969_+	adenylyl-sulfate kinase	NA	A0A1B0XTK9	Freshwater_phage	40.2	3.0e-10
WP_003245141.1|3437996_3438803_-	alpha/beta hydrolase	NA	A0A0A1ELD0	Mycobacterium_phage	26.9	2.5e-12
>prophage 254
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	3448764	3454057	4211343	protease	Cafeteria_roenbergensis_virus(50.0%)	3	NA	NA
WP_003233080.1|3448764_3450609_-	asparagine synthase (glutamine-hydrolyzing)	NA	E3T4J5	Cafeteria_roenbergensis_virus	24.6	9.2e-34
WP_010886469.1|3450754_3451342_+	DUF2777 domain-containing protein	NA	NA	NA	NA	NA
WP_003244653.1|3451372_3454057_-|protease	cell wall-associated protease WprA	protease	A0A217EQY2	Bacillus_phage	37.0	8.2e-31
>prophage 255
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	3459704	3468039	4211343		Bacillus_virus(50.0%)	3	NA	NA
WP_003245201.1|3459704_3463097_-	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	27.1	3.5e-10
WP_003233099.1|3463093_3464269_-	exonuclease SbcCD subunit D	NA	NA	NA	NA	NA
WP_003233100.1|3464340_3468039_-	helicase-exonuclease AddAB subunit AddA	NA	Q331U3	Clostridium_botulinum_C_phage	23.6	1.6e-16
>prophage 256
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	3478234	3479560	4211343		Bathycoccus_sp._RCC1105_virus(100.0%)	1	NA	NA
WP_003245503.1|3478234_3479560_+	3-dehydro-glucose-6-phosphate--glutamate transaminase	NA	E5ES42	Bathycoccus_sp._RCC1105_virus	27.8	2.2e-29
>prophage 257
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	3489212	3497367	4211343		Trichoplusia_ni_ascovirus(50.0%)	8	NA	NA
WP_003245421.1|3489212_3490112_+	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	51.6	3.0e-70
WP_003245329.1|3490158_3490737_-	competence transcription factor ComK	NA	NA	NA	NA	NA
WP_003233142.1|3491029_3491263_+	IDEAL domain-containing protein	NA	NA	NA	NA	NA
WP_003245662.1|3491290_3492148_-	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	44.6	3.5e-52
WP_003245031.1|3492259_3493789_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003245216.1|3493927_3495226_+	heme-based aerotactic transducer HemAT	NA	A0A2H4J162	uncultured_Caudovirales_phage	66.7	2.6e-06
WP_003233151.1|3495360_3495921_+	biotin transporter BioY	NA	NA	NA	NA	NA
WP_003244910.1|3495927_3497367_+	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	25.9	6.1e-25
>prophage 258
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	3502277	3506866	4211343		Bacillus_phage(50.0%)	4	NA	NA
WP_003233171.1|3502277_3503423_+	subtilisin AprE	NA	A0A217EQY2	Bacillus_phage	48.8	1.6e-52
WP_003233175.1|3503461_3504742_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_003245187.1|3504890_3505286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003244686.1|3505324_3506866_-	long-chain-fatty-acid--CoA ligase LcfB	NA	A0A2H4PQM9	Staphylococcus_phage	28.2	2.8e-44
>prophage 259
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	3529663	3532558	4211343		Staphylococcus_phage(50.0%)	3	NA	NA
WP_003233230.1|3529663_3530407_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	9.2e-25
WP_003233231.1|3530894_3531332_+	HIT family protein	NA	NA	NA	NA	NA
WP_003233234.1|3531478_3532558_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	44.7	1.4e-82
>prophage 260
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	3544359	3545256	4211343		Staphylococcus_phage(100.0%)	1	NA	NA
WP_003233262.1|3544359_3545256_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.2	1.7e-25
>prophage 261
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	3552747	3553101	4211343		Streptococcus_phage(100.0%)	1	NA	NA
WP_003224239.1|3552747_3553101_-	YlbF family regulator	NA	A0A1X9I5Y8	Streptococcus_phage	27.9	4.5e-06
>prophage 262
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	3557612	3562529	4211343		Bacillus_phage(66.67%)	5	NA	NA
WP_003233287.1|3557612_3557816_+	alpha/beta-type small acid-soluble spore protein	NA	Q77YX0	Bacillus_phage	76.6	4.5e-19
WP_003245136.1|3557920_3558046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003245013.1|3558084_3558705_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_003233292.1|3558753_3560775_-	multidrug resistance ABC transporter ATP-binding protein/permease BmrD	NA	A0A076FI99	Aureococcus_anophage	25.6	3.1e-30
WP_003245157.1|3560771_3562529_-	multidrug ABC transporter ATP-binding protein BmrC	NA	W8CYL7	Bacillus_phage	30.1	4.1e-55
>prophage 263
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	3567009	3570541	4211343		Bacillus_phage(33.33%)	5	NA	NA
WP_003233309.1|3567009_3567753_-	sirtuin NAD-dependent deacetylase	NA	A0A068EPD4	Bacillus_phage	31.2	1.8e-20
WP_003245529.1|3567822_3568938_-	small-conductance mechanosensitive channel protein MscY	NA	NA	NA	NA	NA
WP_009966908.1|3569086_3569194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003244958.1|3569427_3570159_+	glycerophosphoryl diester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	29.1	2.2e-15
WP_003245042.1|3570145_3570541_+	CrcB family protein	NA	A0A2H4PQR0	Staphylococcus_phage	36.5	6.8e-11
>prophage 264
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	3584746	3588849	4211343		Trichoplusia_ni_ascovirus(50.0%)	4	NA	NA
WP_003244867.1|3584746_3585616_-	glucose 1-dehydrogenase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	45.1	5.6e-58
WP_003244745.1|3585689_3586790_-	citrate synthase/methylcitrate synthase	NA	NA	NA	NA	NA
WP_003233357.1|3586898_3587774_+	transcriptional regulator CitR	NA	NA	NA	NA	NA
WP_003244816.1|3587844_3588849_-	peptidoglycan endopeptidase LytE	NA	M1HNA7	Bacillus_virus	43.8	3.4e-14
>prophage 265
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	3594588	3596055	4211343		Clostridium_phage(100.0%)	1	NA	NA
WP_003244874.1|3594588_3596055_+	peptidoglycan endopeptidase LytF	NA	A0A0A8WF62	Clostridium_phage	40.7	1.7e-14
>prophage 266
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	3599327	3601073	4211343		Streptococcus_phage(100.0%)	1	NA	NA
WP_003244986.1|3599327_3601073_-	phosphoglucomutase	NA	A0A1X9I671	Streptococcus_phage	49.3	3.5e-160
>prophage 267
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	3604521	3605346	4211343		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_003233386.1|3604521_3605346_-	glycerol uptake facilitator protein GlpF	NA	M1IAZ4	Acanthocystis_turfacea_Chlorella_virus	34.6	1.1e-31
>prophage 268
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	3609460	3612223	4211343		Synechococcus_phage(33.33%)	4	NA	NA
WP_003245030.1|3609460_3610123_-	HAD family hydrolase	NA	A0A1D8KNV9	Synechococcus_phage	26.6	5.9e-07
WP_003245462.1|3610249_3610672_-	CBS domain-containing protein	NA	A0A2I6B2H4	Macacine_betaherpesvirus	35.0	4.6e-13
WP_003233401.1|3610808_3611204_-	YhcU family protein	NA	NA	NA	NA	NA
WP_003244785.1|3611314_3612223_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	25.3	1.1e-06
>prophage 269
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	3621033	3626243	4211343		Staphylococcus_phage(50.0%)	6	NA	NA
WP_003244833.1|3621033_3622113_+	diguanylate cyclase DgcK	NA	A0A127AWB9	Bacillus_phage	37.0	9.9e-20
WP_003245726.1|3622115_3622946_-	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003224086.1|3623381_3623585_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	61.5	1.2e-16
WP_003233421.1|3623676_3624618_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003245448.1|3624610_3625528_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	38.0	1.2e-39
WP_003233423.1|3625544_3626243_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.4	1.2e-21
>prophage 270
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	3631437	3634691	4211343		Bacillus_phage(50.0%)	2	NA	NA
WP_003233432.1|3631437_3632616_-	sporulation protein YhbH	NA	X2JIL8	Bacillus_phage	45.3	6.5e-25
WP_003233433.1|3632795_3634691_-	serine/threonine protein kinase PrkA	NA	A0MN77	Thermus_phage	36.5	1.4e-101
>prophage 271
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	3645685	3650142	4211343		Bacillus_virus(33.33%)	4	NA	NA
WP_010886450.1|3645685_3646453_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.9	4.2e-33
WP_003245322.1|3646860_3648312_+	Vegetative catalase	NA	A0A2K9L0T1	Tupanvirus	41.3	1.2e-108
WP_003245192.1|3648338_3648536_-	transcriptional regulator SenS	NA	NA	NA	NA	NA
WP_003233470.1|3648786_3650142_+	FAD-binding oxidoreductase	NA	S4VRT3	Pandoravirus	39.5	2.7e-43
>prophage 272
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	3666752	3668495	4211343		Bacillus_phage(100.0%)	1	NA	NA
WP_009966836.1|3666752_3668495_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.5	1.5e-46
>prophage 273
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	3676036	3678119	4211343		Oenococcus_phage(50.0%)	2	NA	NA
WP_003244113.1|3676036_3677026_-	glycosyltransferase family 2 protein	NA	V5USA4	Oenococcus_phage	42.4	1.5e-59
WP_003243419.1|3677258_3678119_-	alpha/beta hydrolase	NA	A0A0S2MV32	Mycobacterium_phage	27.4	2.9e-06
>prophage 274
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	3693383	3693920	4211343		Paenibacillus_phage(100.0%)	1	NA	NA
WP_003243944.1|3693383_3693920_-	bacillithiol transferase BstA	NA	D0R7I3	Paenibacillus_phage	44.0	5.4e-19
>prophage 275
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	3701092	3702028	4211343		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_003244346.1|3701092_3702028_-	linearmycin resistance ATP-binding protein LnrL	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	36.2	1.4e-30
>prophage 276
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	3710410	3713940	4211343		Bacillus_phage(100.0%)	2	NA	NA
WP_003244082.1|3710410_3712225_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.8	1.0e-56
WP_003243936.1|3712218_3713940_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.5	3.2e-52
>prophage 277
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	3721670	3722000	4211343		uncultured_virus(100.0%)	1	NA	NA
WP_010886445.1|3721670_3722000_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	41.5	1.6e-13
>prophage 278
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	3733041	3734442	4211343		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_003233644.1|3733041_3734442_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	39.6	2.9e-88
>prophage 279
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	3763847	3765797	4211343		Streptococcus_phage(100.0%)	1	NA	NA
WP_003233694.1|3763847_3765797_+	lipoteichoic acid synthase	NA	W6LM83	Streptococcus_phage	43.2	2.2e-134
>prophage 280
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	3768923	3769061	4211343		Bacillus_virus(100.0%)	1	NA	NA
WP_003233704.1|3768923_3769061_+	YflJ family protein	NA	G3MBD1	Bacillus_virus	58.1	8.6e-06
>prophage 281
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	3784140	3784941	4211343		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_003233737.1|3784140_3784941_+	Fe(3+)-citrate ABC transporter ATP-binding protein YfmF	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.2	8.4e-16
>prophage 282
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	3790600	3799282	4211343		Klosneuvirus(25.0%)	8	NA	NA
WP_003233750.1|3790600_3791731_-	DEAD/DEAH box helicase	NA	A0A1V0SIR5	Klosneuvirus	30.6	6.2e-41
WP_003233752.1|3791903_3793460_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	29.3	2.1e-55
WP_010886440.1|3793579_3793735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003233759.1|3794025_3795216_-	MFS transporter	NA	NA	NA	NA	NA
WP_003243655.1|3795281_3795704_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003243426.1|3795828_3796275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003244423.1|3796397_3798287_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A1V0SGN0	Hokovirus	31.9	3.6e-41
WP_003233767.1|3798421_3799282_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	41.0	2.2e-09
>prophage 283
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	3807635	3815162	4211343		Tupanvirus(33.33%)	4	NA	NA
WP_003244102.1|3807635_3808604_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A2K9L0I7	Tupanvirus	29.3	1.1e-30
WP_003244408.1|3808610_3809375_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_003243930.1|3809610_3811530_-	Lipoteichoic acid synthase 1	NA	W6LM83	Streptococcus_phage	43.5	1.0e-128
WP_003242884.1|3811976_3815162_-	cytochrome P450	NA	V5UQK0	Mycobacterium_phage	37.5	3.0e-80
>prophage 284
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	3847391	3849125	4211343		Enterobacteria_phage(100.0%)	1	NA	NA
WP_003243833.1|3847391_3849125_-	two-component system sensor histidine kinase YesM	NA	Q9EYF3	Enterobacteria_phage	27.5	1.5e-22
>prophage 285
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	3855754	3860290	4211343		Bacillus_phage(100.0%)	3	NA	NA
WP_003243267.1|3855754_3856885_-	response regulator aspartate phosphatase RapH	NA	A0A1P8CWN8	Bacillus_phage	45.6	6.4e-86
WP_003243884.1|3857046_3858069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003242909.1|3858280_3860290_+	ribonuclease YeeF family protein	NA	A0A1P8CWI7	Bacillus_phage	57.6	1.3e-145
>prophage 286
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	3864916	3874889	4211343		Leptospira_phage(40.0%)	6	NA	NA
WP_003244282.1|3864916_3867556_-	class I SAM-dependent DNA methyltransferase	NA	Q6NE04	Leptospira_phage	39.5	3.4e-154
WP_010886433.1|3867630_3867966_-	recombinase family protein	NA	A0A0A8WIK3	Clostridium_phage	64.9	7.5e-19
WP_075058856.1|3867895_3868849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003233892.1|3868861_3870241_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	44.7	5.0e-109
WP_003233894.1|3870496_3871408_-	diacylglycerol kinase	NA	A0A1V0SBJ0	Catovirus	29.7	1.2e-21
WP_003242663.1|3871730_3874889_-	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.5	6.6e-64
>prophage 287
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	3881110	3888474	4211343		Bacillus_virus(33.33%)	5	NA	NA
WP_010886431.1|3881110_3881809_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	37.9	2.7e-18
WP_010886430.1|3881846_3882857_-	phosphotransferase enzyme family protein	NA	NA	NA	NA	NA
WP_003242795.1|3883018_3884209_-	CamS family sex pheromone protein	NA	NA	NA	NA	NA
WP_003233916.1|3884224_3886231_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	40.0	3.5e-127
WP_003233919.1|3886254_3888474_-	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	41.7	7.2e-134
>prophage 288
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	3897711	3915104	4211343		Synechococcus_phage(30.0%)	17	NA	NA
WP_003244516.1|3897711_3899250_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	52.6	3.9e-78
WP_003244322.1|3899246_3899834_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	40.4	7.0e-28
WP_003242485.1|3899830_3900871_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	41.7	1.1e-63
WP_003233947.1|3900972_3902403_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.5	1.2e-52
WP_003244429.1|3902378_3904607_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.1	3.8e-159
WP_003243954.1|3904590_3905274_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_003219409.1|3905270_3905525_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_003242871.1|3905517_3906243_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3G7P8	Synechococcus_phage	44.1	7.0e-46
WP_003233955.1|3906316_3907612_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	25.7	5.9e-19
WP_009966735.1|3907608_3908751_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_003244134.1|3908743_3909232_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	44.9	8.7e-24
WP_003219403.1|3909554_3909752_-	NETI motif-containing protein	NA	NA	NA	NA	NA
WP_009966729.1|3909751_3910306_-	DUF2179 domain-containing protein	NA	NA	NA	NA	NA
WP_003244066.1|3910519_3910687_-	Fur-regulated basic protein FbpA	NA	NA	NA	NA	NA
WP_003242783.1|3910845_3911649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003243780.1|3911859_3913182_-	hypoxanthine/guanine permease PbuG	NA	A0A0R6PHV4	Moraxella_phage	29.7	5.8e-38
WP_003244399.1|3913562_3915104_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	30.5	5.7e-21
>prophage 289
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	3925481	3926297	4211343		Mycobacterium_phage(100.0%)	1	NA	NA
WP_003244040.1|3925481_3926297_+	alpha/beta hydrolase	NA	H9NCP0	Mycobacterium_phage	30.8	1.4e-10
>prophage 290
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	3950145	3952620	4211343		Vibrio_phage(50.0%)	2	NA	NA
WP_003242904.1|3950145_3951315_-	DNA cytosine methyltransferase	NA	A0A2I7QSC9	Vibrio_phage	32.4	4.6e-31
WP_003234063.1|3951336_3952620_-	DNA (cytosine-5-)-methyltransferase	NA	A0A0R6PG08	Moraxella_phage	28.8	2.1e-24
>prophage 291
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	3955974	3964585	4211343	protease,tRNA	uncultured_virus(40.0%)	10	NA	NA
WP_003243151.1|3955974_3957609_-	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	57.7	2.8e-159
WP_003155970.1|3957655_3957940_-	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	51.6	2.2e-19
WP_003234069.1|3958178_3958913_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003225680.1|3958909_3959101_+	YdiK family protein	NA	NA	NA	NA	NA
WP_010886426.1|3959138_3959903_-	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	30.8	8.8e-23
WP_003234072.1|3959909_3960083_-	sec-independent protein translocase protein TatAY	NA	NA	NA	NA	NA
WP_003234073.1|3960104_3960752_-	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_003243499.1|3960748_3961261_-	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_003244150.1|3961386_3963315_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	30.4	3.6e-57
WP_003244138.1|3963544_3964585_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	43.9	5.2e-66
>prophage 292
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	3977812	3979210	4211343		Pandoravirus(100.0%)	1	NA	NA
WP_003243625.1|3977812_3979210_-	6-phospho-beta-glucosidase GmuD	NA	A0A0B5JD41	Pandoravirus	29.1	1.9e-47
>prophage 293
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	3988557	3989745	4211343		Lambdina_fiscellaria_nucleopolyhedrovirus(100.0%)	1	NA	NA
WP_003234124.1|3988557_3989745_-	glycosyltransferase	NA	A0A0E3URP0	Lambdina_fiscellaria_nucleopolyhedrovirus	29.1	1.7e-09
>prophage 294
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	3995019	3995649	4211343		Clostridioides_phage(100.0%)	1	NA	NA
WP_003234135.1|3995019_3995649_+	nitroreductase family protein	NA	A0A1V0E011	Clostridioides_phage	53.1	6.2e-06
>prophage 295
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	4001461	4003105	4211343		Streptococcus_phage(100.0%)	1	NA	NA
WP_003234144.1|4001461_4003105_+	ABC-F type ribosomal protection protein VmlR	NA	Q6DMX7	Streptococcus_phage	32.7	6.5e-55
>prophage 296
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	4026644	4027952	4211343		Staphylococcus_phage(100.0%)	1	NA	NA
WP_003243030.1|4026644_4027952_-	arsenic transporter	NA	A0A2H4PQU3	Staphylococcus_phage	66.6	3.1e-153
>prophage 297
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	4032278	4033151	4211343		Streptococcus_phage(100.0%)	1	NA	NA
WP_003234217.1|4032278_4033151_-	YitT family protein	NA	M1Q1P6	Streptococcus_phage	33.0	1.1e-32
>prophage 298
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	4043354	4044227	4211343		Streptococcus_phage(100.0%)	1	NA	NA
WP_003234236.1|4043354_4044227_+	AraC family transcriptional regulator	NA	A0A1B0RXG1	Streptococcus_phage	41.4	4.7e-28
>prophage 299
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	4048376	4051079	4211343		Lactococcus_phage(50.0%)	4	NA	NA
WP_003234247.1|4048376_4048577_-	cold shock protein CspC	NA	Q9AZD3	Lactococcus_phage	75.8	9.6e-22
WP_003234249.1|4048839_4049433_-	glutamine amidotransferase	NA	NA	NA	NA	NA
WP_009966647.1|4049782_4049968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004399401.1|4050392_4051079_-	hypothetical protein	NA	O64048	Bacillus_phage	98.2	2.7e-124
>prophage 300
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	4059360	4063820	4211343		Bacillus_phage(50.0%)	5	NA	NA
WP_009966637.1|4059360_4060536_-	response regulator aspartate phosphatase RapI	NA	A0A1P8CWN8	Bacillus_phage	34.4	2.5e-56
WP_009966636.1|4060875_4061676_+	toll/interleukin-1 receptor domain-containing protein	NA	NA	NA	NA	NA
WP_009969670.1|4061866_4062247_-	DUF4467 domain-containing protein	NA	NA	NA	NA	NA
WP_009966634.1|4062309_4062816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009966633.1|4062830_4063820_-	endopeptidase	NA	A0A1S5SEZ8	Streptococcus_phage	43.2	7.1e-65
>prophage 301
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	4072010	4079713	4211343	integrase	Streptococcus_phage(40.0%)	11	4070547:4070561	4079309:4079323
4070547:4070561	attL	ATGAACCCTGACAGA	NA	NA	NA	NA
WP_009966621.1|4072010_4073069_-	DNA relaxase NicK	NA	A0A1S5SEX3	Streptococcus_phage	40.5	6.4e-64
WP_009966620.1|4073061_4074504_-	coupling conjugation protein ConQ	NA	A0A1S5SFB5	Streptococcus_phage	50.9	1.9e-119
WP_009966619.1|4074539_4074920_-	helicase processivity factor HelP	NA	NA	NA	NA	NA
WP_119122843.1|4074955_4075084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009966618.1|4075289_4075550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010886413.1|4075603_4075864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003240395.1|4075860_4076055_-	ICEBs1 excisionase	NA	NA	NA	NA	NA
WP_003240393.1|4076328_4076712_+	helix-turn-helix transcriptional regulator	NA	A0A0B5CYL9	Listeria_phage	36.9	1.2e-12
WP_009966616.1|4076708_4077218_+	metallopeptidase ImmA	NA	NA	NA	NA	NA
WP_009966615.1|4077230_4078337_+|integrase	site-specific integrase	integrase	A0A0A8WF08	Clostridium_phage	34.2	1.4e-37
WP_003246525.1|4079260_4079713_-	SprT family protein	NA	U5J9G1	Bacillus_phage	29.8	4.9e-05
4079309:4079323	attR	TCTGTCAGGGTTCAT	NA	NA	NA	NA
>prophage 302
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	4084191	4084980	4211343		Bacillus_phage(100.0%)	1	NA	NA
WP_003246715.1|4084191_4084980_-	RNA polymerase sigma factor SigB	NA	A0A0Y0AU18	Bacillus_phage	35.2	2.2e-24
>prophage 303
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	4088548	4088899	4211343		Lactobacillus_phage(100.0%)	1	NA	NA
WP_003156187.1|4088548_4088899_-	type II toxin-antitoxin system endoribonuclease NdoA	NA	A0A2P0ZKX3	Lactobacillus_phage	38.6	5.8e-14
>prophage 304
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	4095200	4096685	4211343		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_003246685.1|4095200_4096685_-	ATP-dependent RNA helicase CshA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	37.3	7.6e-63
>prophage 305
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	4099768	4100089	4211343		Staphylococcus_phage(100.0%)	1	NA	NA
WP_003234326.1|4099768_4100089_+	thioredoxin family protein	NA	A0A1X9I9P5	Staphylococcus_phage	33.3	2.2e-07
>prophage 306
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	4104007	4104934	4211343		Staphylococcus_phage(100.0%)	1	NA	NA
WP_003246573.1|4104007_4104934_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	35.7	5.9e-37
>prophage 307
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	4117287	4119528	4211343		Micromonas_pusilla_virus(50.0%)	2	NA	NA
WP_003246569.1|4117287_4119012_-	pyruvate oxidase	NA	G8DDL3	Micromonas_pusilla_virus	25.8	1.2e-35
WP_003246544.1|4119078_4119528_-	8-oxo-dGTP diphosphatase MutT	NA	E5EYY7	Acinetobacter_phage	48.1	3.7e-05
>prophage 308
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	4129100	4131284	4211343		Streptococcus_phage(100.0%)	1	NA	NA
WP_003246684.1|4129100_4131284_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	31.0	1.6e-40
>prophage 309
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	4135272	4138416	4211343		Trichoplusia_ni_ascovirus(50.0%)	3	NA	NA
WP_003246648.1|4135272_4136133_-	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	45.3	1.2e-57
WP_009966584.1|4136339_4136885_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003246534.1|4136904_4138416_-	acyl--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	27.5	7.6e-42
>prophage 310
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	4161711	4166270	4211343		Trichoplusia_ni_ascovirus(50.0%)	4	NA	NA
WP_003246720.1|4161711_4162497_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.9	6.3e-24
WP_003234455.1|4162516_4163380_-	glucose uptake protein GlcU	NA	NA	NA	NA	NA
WP_003246615.1|4163502_4164891_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_003234459.1|4164959_4166270_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	24.5	4.0e-23
>prophage 311
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	4172826	4181264	4211343		Bacillus_phage(60.0%)	10	NA	NA
WP_003234487.1|4172826_4173585_-	petrobactin ABC transporter ATP-binding protein YclP	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	30.6	3.4e-19
WP_003246705.1|4173578_4174526_-	petrobactin ABC transporter permease YclO	NA	NA	NA	NA	NA
WP_003234491.1|4174518_4175469_-	petrobactin ABC transporter permease YclN	NA	A0A2H4IY97	uncultured_Caudovirales_phage	54.8	1.8e-94
WP_003234493.1|4175853_4177218_+	aspartate kinase	NA	NA	NA	NA	NA
WP_003234495.1|4177371_4177485_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_015482794.1|4177566_4177656_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_003224994.1|4177755_4177878_-	phosphatase RapC inhibitor PhrC	NA	NA	NA	NA	NA
WP_003246686.1|4177861_4179010_-	response regulator aspartate phosphatase RapC	NA	A0A1P8CWN8	Bacillus_phage	44.6	5.9e-79
WP_009969263.1|4179172_4180594_-	two-component system sensor histidine kinase YclK	NA	W8CYF6	Bacillus_phage	35.0	6.0e-41
WP_003246532.1|4180580_4181264_-	two-component system response regulator YclJ	NA	W8CYM9	Bacillus_phage	40.4	3.6e-44
>prophage 312
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	4188093	4191606	4211343		Bacillus_phage(50.0%)	2	NA	NA
WP_003246729.1|4188093_4189848_-	hypothetical protein	NA	U5PSS0	Bacillus_phage	39.1	1.2e-120
WP_003246610.1|4190127_4191606_+	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	38.8	1.2e-81
>prophage 313
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	4197889	4201709	4211343		Planktothrix_phage(50.0%)	4	NA	NA
WP_003246629.1|4197889_4198633_+	cystine ABC transporter ATP-binding protein TcyC	NA	G9BWD6	Planktothrix_phage	37.7	5.4e-33
WP_003246558.1|4198953_4199601_+	YitT family protein	NA	NA	NA	NA	NA
WP_003246659.1|4199705_4200380_+	4'-phosphopantetheinyl transferase	NA	NA	NA	NA	NA
WP_003246711.1|4200374_4201709_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	39.7	5.1e-66
>prophage 314
NZ_CP015375	Bacillus subtilis subsp. subtilis strain KCTC 3135, complete genome	4211343	4205480	4209308	4211343		Tupanvirus(100.0%)	1	NA	NA
WP_003234570.1|4205480_4209308_-	surfactin non-ribosomal peptide synthetase SrfAC	NA	A0A2K9KZV5	Tupanvirus	26.5	1.1e-89
