The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP014672	Thermoclostridium stercorarium subsp. thermolacticum DSM 2910 chromosome, complete genome	3035622	139699	247596	3035622	head,portal,plate,capsid,protease,transposase,integrase,tRNA,terminase	Bacillus_phage(11.11%)	97	218820:218879	251460:251532
WP_034842267.1|139699_140662_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_054632815.1|140995_144214_+	Ig-like domain-containing protein	NA	NA	NA	NA	NA
WP_083191792.1|144700_145204_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_054632816.1|145229_146564_+	exopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_054632817.1|146663_149753_+	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_054632818.1|149788_150412_+	sugar transferase	NA	NA	NA	NA	NA
WP_065821226.1|150408_150630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054632844.1|152058_152934_+	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_054632845.1|152938_154174_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_065821227.1|154179_155241_+	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	37.4	4.2e-39
WP_065821228.1|155249_156407_+	capsular polysaccharide biosynthesis protein CapF	NA	NA	NA	NA	NA
WP_065821229.1|156363_157488_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SJE0	Klosneuvirus	52.4	2.9e-107
WP_054632846.1|157490_158726_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_065821230.1|158712_160083_+	oligosaccharide repeat unit polymerase	NA	NA	NA	NA	NA
WP_003512473.1|160326_161547_+|transposase	IS256-like element ISCth5 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	49.0	5.6e-96
WP_054632788.1|161777_162806_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	37.3	4.5e-14
WP_054632789.1|163020_164169_+	polysaccharide pyruvyl transferase family protein	NA	NA	NA	NA	NA
WP_054632799.1|164188_165685_+	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_157882680.1|165739_166924_+	Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain	NA	NA	NA	NA	NA
WP_054632790.1|167138_168980_+	polysaccharide biosynthesis protein	NA	A0A2P1ELS8	Moumouvirus	30.0	5.2e-29
WP_015357882.1|169123_171406_+	S-layer homology domain-containing protein	NA	NA	NA	NA	NA
WP_015357883.1|171486_174198_-	glycoside hydrolase family 2	NA	NA	NA	NA	NA
WP_015357884.1|174339_174546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065821231.1|174660_175752_-	phosphodiester glycosidase family protein	NA	NA	NA	NA	NA
WP_034836550.1|175815_176301_+	histidine kinase	NA	NA	NA	NA	NA
WP_015357888.1|177906_178104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015357889.1|178276_179587_+	nucleotide sugar dehydrogenase	NA	NA	NA	NA	NA
WP_015357890.1|179650_180103_+	large-conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_015357891.1|180119_180638_+	antiterminator LoaP	NA	NA	NA	NA	NA
WP_015357892.1|180666_181641_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_054632792.1|181646_182708_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_054632793.1|182732_184016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065821232.1|184083_184500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054632794.1|184639_188362_-	bacterial Ig-like domain-containing protein	NA	NA	NA	NA	NA
WP_015357897.1|188773_189088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015357898.1|189084_189945_-	cell wall hydrolase	NA	A0A0K2FM09	Brevibacillus_phage	36.3	2.5e-10
WP_034836530.1|190786_191434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015357901.1|191651_191912_+	DUF3343 domain-containing protein	NA	NA	NA	NA	NA
WP_015357903.1|192238_193021_+	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_015357904.1|193045_193927_+	sulfate adenylyltransferase subunit 2	NA	NA	NA	NA	NA
WP_034836519.1|193985_195800_+	GTP-binding protein	NA	A0A1V0SGC3	Hokovirus	32.2	3.3e-44
WP_015357906.1|195831_196239_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_083191793.1|196241_196427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015357909.1|196834_197590_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_015357910.1|197831_201077_+	SNF2 helicase associated domain-containing protein	NA	A0A2L0WU59	Oxyplax_ochracea_nucleopolyhedrovirus	26.1	1.8e-40
WP_034836513.1|201176_202247_+	peptide chain release factor 1	NA	A0A0S4KWG0	Pseudomonas_phage	47.5	7.8e-09
WP_015357913.1|202411_203263_-	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_015357914.1|203392_203800_-	hemerythrin family protein	NA	NA	NA	NA	NA
WP_054632796.1|206918_208019_+	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_015357923.1|208197_208521_+	rhodanese-like domain-containing protein	NA	R4TF91	Phaeocystis_globosa_virus	31.6	2.7e-05
WP_054632797.1|208502_209708_+	radical SAM protein	NA	NA	NA	NA	NA
WP_015357921.1|209709_210912_+	MFS transporter	NA	NA	NA	NA	NA
WP_065821233.1|210908_212288_+	radical SAM protein	NA	NA	NA	NA	NA
WP_054632798.1|212272_213439_+|protease	protease	protease	NA	NA	NA	NA
WP_144050590.1|214025_215357_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_015358154.1|215370_215811_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_015358103.1|216856_218083_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	30.7	9.2e-14
218820:218879	attL	CTTTATTTTGGCGGAGAGAGAGGGATTCGAACCCTCGGTACCCCTTTTGGGGGTACACAC	NA	NA	NA	NA
WP_065821237.1|218959_220117_-|integrase	site-specific integrase	integrase	A0A2H4JCB7	uncultured_Caudovirales_phage	27.1	3.5e-31
WP_065821238.1|220117_220477_-	helix-turn-helix transcriptional regulator	NA	A0A2H4JDE4	uncultured_Caudovirales_phage	42.4	3.5e-06
WP_065821239.1|220652_220874_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_157882681.1|220879_221050_+	excisionase family DNA-binding protein	NA	NA	NA	NA	NA
WP_065821241.1|221064_221820_+	phage antirepressor KilAC domain-containing protein	NA	A0A290FZK7	Caldibacillus_phage	47.1	4.5e-43
WP_065821242.1|221840_222065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162270825.1|222021_222159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157882682.1|222237_222408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065821243.1|222427_224404_+	AAA family ATPase	NA	A0A1L2K2K3	Aeribacillus_phage	46.6	3.5e-140
WP_065821244.1|224387_225227_+	recombinase RecT	NA	A8ATY6	Listeria_phage	44.7	4.0e-45
WP_065821245.1|225226_225961_+	MBL fold metallo-hydrolase	NA	A0A1L2JY21	Aeribacillus_phage	66.8	4.1e-94
WP_065821246.1|225944_226670_+	DNA cytosine methyltransferase	NA	A0A0C5ABP5	Bacteriophage	53.1	2.3e-65
WP_065821248.1|227022_227808_+	hypothetical protein	NA	A0A2K9V3F2	Faecalibacterium_phage	45.7	2.9e-13
WP_065821249.1|227804_228332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065821250.1|228402_228669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065821251.1|228674_229067_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0A7S133	Clostridium_phage	49.1	3.3e-26
WP_065821252.1|229081_229327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065821430.1|229482_230130_+	HNH endonuclease	NA	M1PKJ5	Streptococcus_phage	41.0	4.5e-36
WP_065821253.1|230145_230559_+	single-stranded DNA-binding protein	NA	S5MP28	Brevibacillus_phage	40.9	3.2e-19
WP_083191798.1|230600_230759_+	DUF2292 domain-containing protein	NA	NA	NA	NA	NA
WP_065821254.1|230894_231086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065821255.1|231181_231616_+	DUF1492 domain-containing protein	NA	NA	NA	NA	NA
WP_065821256.1|231801_232089_+	HNH endonuclease	NA	R9TNN2	Paenibacillus_phage	68.4	1.7e-35
WP_065821257.1|232210_232564_+	hypothetical protein	NA	A0A290GJQ7	Caldibacillus_phage	45.9	8.5e-21
WP_065821258.1|232570_234220_+|terminase	terminase large subunit	terminase	A0A290GJW3	Caldibacillus_phage	54.4	2.2e-172
WP_065821259.1|234222_235431_+|portal	phage portal protein	portal	A0A1L2BY94	Clostridium_phage	41.4	7.6e-69
WP_157882703.1|235621_236221_+|head,protease	HK97 family phage prohead protease	head,protease	A0A288WFX1	Bacillus_phage	32.2	9.1e-15
WP_065821260.1|236235_237405_+|capsid	phage major capsid protein	capsid	NA	NA	NA	NA
WP_065821261.1|237450_237654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065821262.1|237653_237941_+	DNA-packaging protein	NA	R9TMB7	Paenibacillus_phage	59.1	1.5e-23
WP_065821263.1|237941_238244_+|head	phage head closure protein	head	A0A0S2SXM4	Bacillus_phage	47.4	2.9e-17
WP_065821264.1|238245_238683_+	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_065821265.1|238687_239023_+	hypothetical protein	NA	E2ELJ0	Clostridium_phage	34.0	1.0e-07
WP_065821266.1|239025_239616_+	hypothetical protein	NA	A0A2K5B294	Erysipelothrix_phage	35.4	3.9e-18
WP_157882683.1|239621_240065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065821268.1|240238_241963_+	hypothetical protein	NA	A0A2K5B297	Erysipelothrix_phage	38.8	2.1e-08
WP_065821269.1|241962_243654_+	hypothetical protein	NA	A0A2H4JAI8	uncultured_Caudovirales_phage	28.3	2.4e-52
WP_065821270.1|243650_244754_+	hypothetical protein	NA	A0A2I7QIN8	Bacillus_phage	46.6	5.1e-88
WP_157882684.1|244750_244990_+	hypothetical protein	NA	M1IDW4	Bacillus_phage	51.4	2.6e-13
WP_065821271.1|244986_247596_+|plate	BppU family phage baseplate upper protein	plate	B5LPS6	Bacillus_virus	28.1	4.2e-08
251460:251532	attR	CTTTATTTTGGCGGAGAGAGAGGGATTCGAACCCTCGGTACCCCTTTTGGGGGTACACACGATTTCCAGTCGT	NA	NA	NA	NA
>prophage 2
NZ_CP014672	Thermoclostridium stercorarium subsp. thermolacticum DSM 2910 chromosome, complete genome	3035622	1277659	1289078	3035622		Bacillus_phage(42.86%)	9	NA	NA
WP_023559464.1|1277659_1278514_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.4	1.7e-54
WP_015358849.1|1278564_1278807_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A0K2CZ86	Paenibacillus_phage	60.0	1.4e-19
WP_015358850.1|1279096_1279684_+	spore maturation protein A	NA	NA	NA	NA	NA
WP_034837886.1|1279686_1280217_+	spore maturation protein	NA	NA	NA	NA	NA
WP_015358852.1|1280345_1281032_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	43.2	7.4e-53
WP_015358853.1|1281031_1282501_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	35.5	3.0e-43
WP_054632590.1|1282566_1283334_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A172JHR8	Bacillus_phage	31.5	4.9e-21
WP_015358855.1|1283693_1285079_+	trypsin-like peptidase domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	30.2	2.7e-22
WP_015358856.1|1285322_1289078_+	phosphoribosylformylglycinamidine synthase	NA	A6N228	Microbacterium_phage	25.8	3.1e-36
>prophage 3
NZ_CP014672	Thermoclostridium stercorarium subsp. thermolacticum DSM 2910 chromosome, complete genome	3035622	1507988	1605640	3035622	tRNA,protease,transposase,portal	uncultured_virus(14.81%)	72	NA	NA
WP_065821323.1|1507988_1509299_-|portal	phage portal protein	portal	NA	NA	NA	NA
WP_065821325.1|1509707_1510301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065821326.1|1510451_1511516_-	hypothetical protein	NA	A0A1B1IT91	uncultured_Mediterranean_phage	30.0	7.2e-15
WP_003512473.1|1511554_1512775_-|transposase	IS256-like element ISCth5 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	49.0	5.6e-96
WP_065821327.1|1512850_1513429_-	hypothetical protein	NA	A0A218MMS9	uncultured_virus	41.9	3.5e-16
WP_065821328.1|1513591_1514029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065821329.1|1514058_1514415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015358103.1|1514555_1515782_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	30.7	9.2e-14
WP_065821330.1|1515763_1516816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157882691.1|1516805_1517009_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_157882692.1|1517143_1518025_-	DUF5309 family protein	NA	NA	NA	NA	NA
WP_065821333.1|1518028_1518436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065821334.1|1519029_1521660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003512270.1|1523810_1524536_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	35.4	5.4e-30
WP_011837913.1|1524529_1526044_-|transposase	IS21-like element ISCth12 family transposase	transposase	NA	NA	NA	NA
WP_157882705.1|1527740_1528824_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	31.7	5.3e-21
WP_065821336.1|1528871_1530098_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	30.7	2.1e-13
WP_157882693.1|1530075_1530195_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_003511744.1|1532386_1533457_-|transposase	IS30-like element ISCth3 family transposase	transposase	H7BUM7	unidentified_phage	36.7	6.1e-54
WP_015359067.1|1536168_1537950_-	beta-glucuronidase UidA	NA	B9U1V4	Vaccinia_virus	24.0	4.9e-48
WP_015484995.1|1538099_1538465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015359069.1|1538527_1539988_-	coproporphyrinogen dehydrogenase HemZ	NA	NA	NA	NA	NA
WP_015359070.1|1540010_1540643_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_015359071.1|1540656_1541118_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_065821433.1|1541129_1543313_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A1X9SH80	Bradyrhizobium_phage	34.6	2.3e-07
WP_054632810.1|1543323_1545498_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	30.4	4.8e-82
WP_015359074.1|1545734_1545911_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_015359075.1|1546051_1546396_-	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_065821337.1|1546449_1549089_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	34.7	4.8e-68
WP_015359078.1|1549505_1550462_-	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	35.8	4.0e-41
WP_065821338.1|1550567_1551605_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_015359080.1|1551690_1551870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034845094.1|1551882_1552416_-	PRC-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_034845097.1|1552603_1553974_+	DUF1015 domain-containing protein	NA	NA	NA	NA	NA
WP_015359083.1|1553961_1554468_-	amidase domain-containing protein	NA	NA	NA	NA	NA
WP_015359084.1|1554603_1555359_-	RNA polymerase sporulation sigma factor, SigF/SigG family	NA	A0A0A0RV91	Bacillus_phage	42.0	4.0e-44
WP_034845100.1|1555401_1555830_-	anti-sigma F factor	NA	NA	NA	NA	NA
WP_015359086.1|1555884_1556196_-	anti-sigma factor antagonist	NA	NA	NA	NA	NA
WP_015359087.1|1556242_1557193_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	30.8	7.6e-32
WP_065821339.1|1557231_1559196_-	glycogen debranching enzyme N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_015359089.1|1559196_1560468_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	36.8	1.4e-49
WP_015359090.1|1560454_1561339_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	23.7	2.3e-06
WP_015359091.1|1561341_1562262_-	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_015359092.1|1562298_1563258_-	HPr kinase/phosphorylase	NA	NA	NA	NA	NA
WP_065821340.1|1563306_1564800_-	threonine synthase	NA	NA	NA	NA	NA
WP_034845109.1|1565154_1567428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054632806.1|1567704_1568160_+	GtrA family protein	NA	NA	NA	NA	NA
WP_065821341.1|1568183_1570427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065821342.1|1570451_1571750_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_054632805.1|1571785_1572730_+	glycosyltransferase	NA	I1TED8	Salmonella_phage	42.2	1.0e-65
WP_015359099.1|1572732_1573797_-	FAD-binding protein	NA	NA	NA	NA	NA
WP_003511744.1|1574164_1575235_+|transposase	IS30-like element ISCth3 family transposase	transposase	H7BUM7	unidentified_phage	36.7	6.1e-54
WP_065821343.1|1575971_1576619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054632836.1|1576670_1577126_-	DUF1669 domain-containing protein	NA	NA	NA	NA	NA
WP_065821344.1|1577122_1578931_-	DUF1998 domain-containing protein	NA	NA	NA	NA	NA
WP_065821345.1|1578944_1582874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157882694.1|1583074_1584334_-	DNA (cytosine-5-)-methyltransferase	NA	M1PSQ0	Streptococcus_phage	31.9	3.3e-43
WP_157882695.1|1584614_1584755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065821346.1|1584874_1586992_-	UvrD-helicase domain-containing protein	NA	G3MA40	Bacillus_virus	33.4	1.6e-82
WP_003512473.1|1587406_1588627_-|transposase	IS256-like element ISCth5 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	49.0	5.6e-96
WP_065821348.1|1589013_1589445_-	prepilin peptidase	NA	NA	NA	NA	NA
WP_054632839.1|1589827_1590880_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	39.5	1.9e-60
WP_054632840.1|1591048_1591492_+	NPCBM/NEW2 domain-containing protein	NA	NA	NA	NA	NA
WP_157882696.1|1591589_1591733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065821349.1|1591946_1594568_-	DEAD/DEAH box helicase family protein	NA	A0A2K5B256	Erysipelothrix_phage	35.5	2.7e-143
WP_054632843.1|1594581_1596447_-	site-specific DNA-methyltransferase	NA	A0A2K5B2C1	Erysipelothrix_phage	40.3	4.7e-102
WP_065821350.1|1597168_1598395_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	30.7	9.2e-14
WP_065821352.1|1598828_1600559_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_015359101.1|1600592_1601180_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_034843806.1|1601241_1603104_-	molecular chaperone HtpG	NA	A0A1V0SAD6	Catovirus	26.9	1.1e-55
WP_015359103.1|1603290_1604352_-	flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase	NA	NA	NA	NA	NA
WP_015359104.1|1604353_1605640_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
>prophage 4
NZ_CP014672	Thermoclostridium stercorarium subsp. thermolacticum DSM 2910 chromosome, complete genome	3035622	2125118	2187824	3035622	protease,transposase,tRNA	Escherichia_phage(20.0%)	55	NA	NA
WP_011837913.1|2125118_2126633_+|transposase	IS21-like element ISCth12 family transposase	transposase	NA	NA	NA	NA
WP_003512270.1|2126626_2127352_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	35.4	5.4e-30
WP_015359549.1|2128950_2129874_+	type I-B CRISPR-associated protein Cas7/Cst2/DevR	NA	NA	NA	NA	NA
WP_015359550.1|2129938_2130649_+	type I-B CRISPR-associated protein Cas5	NA	NA	NA	NA	NA
WP_054632786.1|2131118_2133332_+	CRISPR-associated helicase/endonuclease Cas3	NA	NA	NA	NA	NA
WP_015359553.1|2133660_2136621_-	glycoside hydrolase family 9 protein	NA	NA	NA	NA	NA
WP_015359554.1|2136763_2139508_-	exoglucanase-2	NA	G0YQI6	Erwinia_phage	39.5	5.6e-128
WP_015359555.1|2140314_2141535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015359556.1|2141548_2144836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015359557.1|2144832_2145480_-	DUF4194 domain-containing protein	NA	NA	NA	NA	NA
WP_034836407.1|2145472_2146909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065821381.1|2147286_2148651_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_015359562.1|2149289_2150120_-	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_054632784.1|2150193_2150859_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_065821382.1|2150961_2152155_-|protease	26S protease regulatory subunit	protease	G8DDJ2	Micromonas_pusilla_virus	40.1	3.3e-48
WP_015359565.1|2152470_2153385_-	radical SAM protein	NA	NA	NA	NA	NA
WP_015359566.1|2153469_2154171_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_144050622.1|2154369_2154666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034836399.1|2154789_2154969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015359570.1|2155070_2155283_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_015359571.1|2155543_2155861_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_015359573.1|2156432_2158538_-	glutamine synthetase III	NA	NA	NA	NA	NA
WP_015359574.1|2159196_2160612_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_015359575.1|2160608_2162069_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_015359576.1|2162065_2162359_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_065821383.1|2162421_2164167_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_015359579.1|2165076_2165580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015359581.1|2165874_2166087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015359583.1|2166711_2167155_-	flavin reductase	NA	NA	NA	NA	NA
WP_041746585.1|2167300_2167741_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015359585.1|2167982_2168171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081594892.1|2168792_2169482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015359589.1|2170405_2172361_+	carbohydrate-binding protein	NA	NA	NA	NA	NA
WP_015359590.1|2172908_2173034_-	acetyltransferase, GNAT family	NA	NA	NA	NA	NA
WP_015359591.1|2173047_2173296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015359592.1|2173664_2174399_+	DUF3788 domain-containing protein	NA	NA	NA	NA	NA
WP_015485069.1|2174539_2175202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015359594.1|2175321_2175816_-	energy coupling factor transporter S component ThiW	NA	NA	NA	NA	NA
WP_034836377.1|2176352_2177498_-	DUF362 domain-containing protein	NA	NA	NA	NA	NA
WP_015485070.1|2177763_2178240_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_034836371.1|2178473_2178782_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_015359599.1|2178816_2179119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034836368.1|2179241_2179505_-	TfoX/Sxy family protein	NA	NA	NA	NA	NA
WP_144050623.1|2180112_2180211_+	recombinase family protein	NA	NA	NA	NA	NA
WP_015359601.1|2180399_2180870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051492260.1|2181066_2181312_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_015359602.1|2181338_2181611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015359603.1|2181626_2182226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015359604.1|2182236_2183076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015359605.1|2183124_2183694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015485072.1|2183847_2184279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095666464.1|2184607_2185760_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	31.7	5.6e-21
WP_065821384.1|2185829_2186525_-	DUF4367 domain-containing protein	NA	NA	NA	NA	NA
WP_065821385.1|2186514_2187057_-	RNA polymerase sigma factor	NA	A0A1V0DZZ1	Clostridioides_phage	44.8	7.4e-32
WP_015358154.1|2187383_2187824_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
