The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP016625	Escherichia coli O157:H7 strain FRIK944 chromosome, complete genome	5770602	234127	307371	5770602	protease,plate,tRNA,transposase	uncultured_Caudovirales_phage(20.0%)	60	NA	NA
WP_001295561.1|234127_235480_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_001240896.1|235509_237942_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_000758956.1|238062_238548_+	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001139282.1|238551_239577_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|239681_240137_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_000565963.1|240140_240929_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000139661.1|240928_242077_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000569419.1|242073_242670_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	3.9e-26
WP_001294772.1|242706_246189_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.8e-209
WP_000055741.1|246201_247161_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001020954.1|247259_249401_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000901098.1|249457_249847_+	VOC family protein	NA	NA	NA	NA	NA
WP_000176537.1|249911_251207_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000062312.1|251259_251520_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000417058.1|251506_251707_-	YaeP family protein	NA	NA	NA	NA	NA
WP_001185286.1|251872_252418_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_000635546.1|252414_252825_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000239181.1|252838_253549_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_001302206.1|253748_254573_-	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001260720.1|254625_256344_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000094000.1|256454_257162_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202328.1|257158_257563_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874227.1|257680_258496_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294606.1|258535_259189_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000593994.1|259181_260213_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001140187.1|260400_260976_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000997018.1|266735_267539_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.6	5.4e-39
WP_000648586.1|267535_268450_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|268690_269491_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000211693.1|269568_270339_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644686.1|270386_271745_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052715.1|271816_272572_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001301721.1|272605_273328_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|273324_273792_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001301976.1|273856_274588_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.5	9.9e-40
WP_001302684.1|276402_276852_-	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_000964776.1|276854_277451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000002701.1|277529_277751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001284958.1|277771_278251_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_001087743.1|278216_279626_-	ImpA family type VI secretion system protein	NA	NA	NA	NA	NA
WP_001310198.1|279636_283071_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001240517.1|283207_284620_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_000088854.1|284624_285368_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_000614377.1|285364_288148_-	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	28.4	6.2e-82
WP_000343292.1|288156_288918_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000246433.1|288922_290254_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001080153.1|290256_290781_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_001113707.1|290777_292058_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_000348794.1|292082_293165_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000393844.1|293128_294979_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000599596.1|294982_295396_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000056994.1|295486_296878_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000123970.1|296928_297153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000037399.1|297187_297688_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_001142958.1|298384_298903_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000103335.1|299112_301254_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	1.4e-25
WP_000509142.1|301329_305553_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	42.3	2.4e-21
WP_000247943.1|305754_306018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_120795385.1|305932_306118_-	protein YncO	NA	NA	NA	NA	NA
WP_000027427.1|306198_307371_+|transposase	ISAs1-like element ISEc26 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP016625	Escherichia coli O157:H7 strain FRIK944 chromosome, complete genome	5770602	326157	405361	5770602	plate,integrase,head,tail,protease,lysis,holin,portal,capsid,terminase,transposase	Shigella_phage(44.07%)	95	328696:328712	412189:412205
WP_000749881.1|326157_327213_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
WP_001285288.1|327500_328604_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893282.1|328615_329869_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	3.4e-96
328696:328712	attL	GCTGGAAAAAATCGCCG	NA	NA	NA	NA
WP_000051887.1|330073_331237_-|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	100.0	2.4e-229
WP_000206732.1|331463_331769_-	hypothetical protein	NA	U5P0J0	Shigella_phage	100.0	6.8e-51
WP_001242749.1|331768_332131_-	phage protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
WP_000008235.1|332121_332658_-	5'-deoxynucleotidase	NA	S5MW55	Escherichia_phage	98.9	8.2e-100
WP_000917896.1|333334_333631_-	hypothetical protein	NA	Q8SBF7	Shigella_phage	100.0	1.2e-52
WP_001020634.1|333886_334579_-	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	100.0	1.0e-126
WP_001191674.1|334676_334937_+	helix-turn-helix transcriptional regulator	NA	S5FKP1	Shigella_phage	100.0	7.1e-41
WP_000515845.1|334929_335481_+	protein YmfL	NA	S5FXP0	Shigella_phage	99.5	3.4e-101
WP_001250269.1|335656_335836_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000104949.1|335825_336767_+	helix-turn-helix domain-containing protein	NA	S5FM81	Shigella_phage	99.7	3.3e-144
WP_072141203.1|336763_337258_+	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.1	1.6e-86
WP_001303054.1|337257_337911_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	2.1e-126
WP_000210141.1|337907_338234_+	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	97.2	3.9e-52
WP_000767113.1|338230_338620_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_001061444.1|338639_339449_+	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	100.0	1.8e-151
WP_001360050.1|339456_340446_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	100.0	1.5e-195
WP_001008431.1|340459_341212_+	antitermination protein	NA	Q8SBE4	Shigella_phage	98.0	1.7e-135
WP_000484663.1|341425_341965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001310393.1|342108_342342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001449601.1|342620_342914_+	site-specific DNA-methyltransferase	NA	Q8SBE2	Shigella_phage	90.7	1.5e-42
WP_001120501.1|343050_343386_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	99.1	2.0e-59
WP_001197766.1|343389_343866_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	96.2	3.0e-85
WP_001228695.1|344082_344265_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_000738423.1|344355_344649_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_001135207.1|345174_345525_+	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	98.3	2.1e-64
WP_000929189.1|345650_346145_+|terminase	phage terminase small subunit P27 family	terminase	U5P067	Shigella_phage	98.8	1.9e-87
WP_128484532.1|346378_347875_+|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	98.8	5.3e-290
WP_000838374.1|347871_348033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000923141.1|348022_349249_+|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	98.8	4.1e-240
WP_000999805.1|349241_349844_+|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	100.0	6.8e-111
WP_000766100.1|349854_351084_+|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	99.3	7.6e-226
WP_000924828.1|351162_351486_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	100.0	3.5e-53
WP_000702395.1|351482_351893_+|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	93.4	5.7e-69
WP_000224836.1|351867_352374_+	hypothetical protein	NA	Q8SBH5	Shigella_phage	92.9	2.9e-83
WP_000779288.1|352370_352931_+	hypothetical protein	NA	M1FQV7	Enterobacteria_phage	99.5	6.8e-105
WP_000497751.1|352939_353110_+	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_000155728.1|353093_354590_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	M1FN90	Enterobacteria_phage	98.8	1.1e-271
WP_000090993.1|354589_354946_+|tail	phage tail tube protein	tail	U5P076	Shigella_phage	99.2	1.2e-62
WP_000661054.1|354945_355215_+|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	100.0	3.5e-43
WP_000807197.1|355356_357192_+|tail	phage tail tape measure protein	tail	Q8SBG9	Shigella_phage	99.7	1.5e-307
WP_000219910.1|357252_358581_+	DNA circularization N-terminal domain-containing protein	NA	Q8SBG8	Shigella_phage	98.9	2.5e-246
WP_001259066.1|359640_360189_+|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	97.8	3.6e-95
WP_000424732.1|360188_360614_+	phage GP46 family protein	NA	U5P0R9	Shigella_phage	100.0	2.3e-81
WP_000785302.1|360600_361659_+|plate	baseplate J/gp47 family protein	plate	Q8SBG4	Shigella_phage	98.9	1.6e-200
WP_000383550.1|361649_362234_+	YmfQ family protein	NA	O22003	Shigella_phage	98.5	7.8e-112
WP_000554706.1|362237_363008_+|tail	tail fiber protein	tail	U5P0I1	Shigella_phage	94.4	2.7e-51
WP_000368084.1|363007_363610_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	90.5	1.2e-99
WP_001008234.1|363581_364025_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	100.0	2.2e-82
WP_001145350.1|364045_364456_-	hypothetical protein	NA	A0A0F7LBW5	Escherichia_phage	97.6	6.5e-65
WP_000905124.1|364486_365041_+	site-specific DNA recombinase	NA	A0A0F7LA37	Escherichia_phage	87.8	2.8e-87
WP_000355484.1|365101_365875_-	hypothetical protein	NA	G9IA57	Pseudomonas_phage	38.5	2.4e-36
WP_000246059.1|366699_367443_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001130487.1|368405_369587_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.3	2.4e-144
WP_000082144.1|369590_370007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303996.1|369979_370597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000251694.1|370596_371055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000999326.1|371047_371680_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000647284.1|371710_372301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000350115.1|372300_372867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001185340.1|373276_373549_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000968317.1|373554_374106_-	Polarity suppression protein	NA	NA	NA	NA	NA
WP_000154958.1|374102_374855_-	septation initiation protein	NA	NA	NA	NA	NA
WP_001244581.1|375788_376049_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	65.1	1.3e-23
WP_000973389.1|376045_376603_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	64.9	9.3e-30
WP_001071227.1|376599_376821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000562750.1|376820_377144_+	DUF5375 family protein	NA	NA	NA	NA	NA
WP_000016225.1|377157_379491_+	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	72.5	0.0e+00
WP_000205213.1|379623_380580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000687183.1|381255_382155_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000361969.1|382253_382976_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001301751.1|383142_383421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010917758.1|384123_385026_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001303808.1|385271_386330_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000171065.1|386471_387599_+	MFS transporter	NA	NA	NA	NA	NA
WP_000121344.1|387777_388734_-	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_000667043.1|388743_390942_-	aldehyde oxidoreductase molybdenum-binding subunit PaoC	NA	A0A0P0I429	Acinetobacter_phage	25.7	1.5e-38
WP_000643340.1|390938_391895_-	aldehyde oxidoreductase FAD-binding subunit PaoB	NA	NA	NA	NA	NA
WP_000070685.1|391891_392581_-	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_001019920.1|392998_393613_+	YagU family protein	NA	NA	NA	NA	NA
WP_001303809.1|393860_394190_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001301550.1|394502_395213_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_001265657.1|395181_396825_-	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001131063.1|396814_399340_-	fimbrial usher EcpC	NA	NA	NA	NA	NA
WP_000716386.1|399365_400034_-	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_000730972.1|400091_400679_-	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000389022.1|400753_401296_-	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_001147284.1|402120_402312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000866436.1|402381_402522_-	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_000803998.1|402521_402785_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_001171554.1|403048_403429_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|403425_403773_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|403822_405361_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
412189:412205	attR	GCTGGAAAAAATCGCCG	NA	NA	NA	NA
>prophage 3
NZ_CP016625	Escherichia coli O157:H7 strain FRIK944 chromosome, complete genome	5770602	948529	986624	5770602	integrase,tail,protease,lysis,holin,portal	Enterobacteria_phage(54.76%)	49	937971:937985	970260:970274
937971:937985	attL	CTGACGCCGGAAAAG	NA	NA	NA	NA
WP_089625990.1|948529_949468_-|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	99.7	2.0e-173
WP_001303849.1|949573_949792_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000545728.1|949831_949999_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_000120056.1|950241_950844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000763363.1|951054_951276_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_000188862.1|951374_951590_-	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	98.6	2.9e-32
WP_000548536.1|951666_951858_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
WP_000682316.1|951830_952013_-	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
WP_000186844.1|952009_952690_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_001254218.1|953387_953570_+	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	96.7	4.8e-28
WP_000567001.1|953566_953737_+	protein ninF	NA	Q716C4	Shigella_phage	96.4	7.9e-25
WP_001108055.1|953729_954350_+	recombination protein NinG	NA	Q716C3	Shigella_phage	96.1	1.6e-94
WP_001028857.1|954346_955012_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.1	9.4e-130
WP_000750155.1|955223_956183_-	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_032160865.1|956520_956643_+	YlcG family protein	NA	NA	NA	NA	NA
WP_001097238.1|956657_957347_+	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_001302581.1|957530_958274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499454.1|958359_958518_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_012578864.1|958598_958997_-	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000284524.1|959139_959355_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000075107.1|959354_959852_+	lysozyme RrrD	NA	A0A1B5FP97	Escherichia_phage	98.2	7.1e-90
WP_000092302.1|959848_960316_+|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	97.4	9.4e-76
WP_001139679.1|960303_960456_+	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	8.9e-20
WP_001072975.1|963719_963932_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_010904538.1|963859_964984_+|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.4	5.4e-194
WP_127446149.1|965105_965441_+|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.1	9.1e-57
WP_001136598.1|965385_967413_+|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.2	0.0e+00
WP_001097050.1|967499_967823_+	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001283153.1|967815_968091_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_000677094.1|968102_968681_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.0	6.1e-101
WP_001079422.1|968677_969079_+|tail	tail protein	tail	A5LH34	Enterobacteria_phage	98.5	2.0e-71
WP_000211123.1|969089_969833_+|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	98.0	9.5e-131
WP_001300035.1|969893_970280_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
970260:970274	attR	CTGACGCCGGAAAAG	NA	NA	NA	NA
WP_001161009.1|970288_970618_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_000371994.1|970589_973655_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.9	0.0e+00
WP_000447253.1|973654_973984_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_001152360.1|973993_974692_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	3.9e-134
WP_000194779.1|974697_975441_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_000090841.1|975377_975986_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.1	2.4e-100
WP_000515429.1|976046_977912_+	host specificity protein J	NA	A5LH43	Enterobacteria_phage	97.4	0.0e+00
WP_000881110.1|977954_979460_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	96.4	3.5e-281
WP_001233141.1|979530_980130_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	92.5	1.8e-103
WP_000741874.1|980189_981506_+|tail	phage tail protein	tail	Q6H9S9	Enterobacteria_phage	95.6	2.0e-67
WP_001024022.1|981507_981777_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJT0	Stx_converting_phage	98.9	4.9e-45
WP_000950813.1|981953_982934_+	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
WP_115801843.1|982967_983987_+|protease	type III secretion system effector zinc metalloprotease NleC	protease	NA	NA	NA	NA
WP_072127173.1|984483_984645_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	72.5	3.9e-13
WP_000951026.1|984813_985695_+	type III secretion system effector kinase NleH1-1	NA	A5LH48	Enterobacteria_phage	90.1	8.6e-147
WP_001247925.1|985925_986624_+|protease	T3SS effector zinc metalloprotease NleD	protease	NA	NA	NA	NA
>prophage 4
NZ_CP016625	Escherichia coli O157:H7 strain FRIK944 chromosome, complete genome	5770602	1111309	1165830	5770602	tRNA,protease,integrase,transposase	Moraxella_phage(20.0%)	44	1113049:1113064	1166633:1166648
WP_000520781.1|1111309_1111630_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934041.1|1111660_1113937_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
1113049:1113064	attL	GGATAAAGCCATTGAG	NA	NA	NA	NA
WP_000279872.1|1114456_1115659_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	34.4	2.9e-44
WP_000271854.1|1115846_1117664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014639577.1|1118776_1119073_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000579535.1|1119299_1119497_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_000335694.1|1119715_1121149_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_000282071.1|1122123_1122687_+	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_000273844.1|1122991_1125412_-	NTPase	NA	NA	NA	NA	NA
WP_001081278.1|1126818_1127559_-	HIRAN domain-containing protein	NA	NA	NA	NA	NA
WP_000090034.1|1127548_1128478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001200020.1|1128938_1130705_+	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	A0A0R6PI85	Moraxella_phage	25.5	6.0e-22
WP_001075571.1|1130717_1140347_+|tRNA	contact-dependent inhibition effector tRNA nuclease	tRNA	A0A0R6PJK4	Moraxella_phage	33.8	3.2e-29
WP_000779468.1|1140346_1140886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001449593.1|1141118_1141319_+	VENN motif pre-toxin domain-containing protein	NA	NA	NA	NA	NA
WP_001310368.1|1141315_1142173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001449592.1|1142585_1143029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001477171.1|1143538_1144192_+	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
WP_001003689.1|1144243_1144621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000912479.1|1144803_1145253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000832132.1|1145262_1145676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001258566.1|1145745_1146600_+	VENN motif pre-toxin domain-containing protein	NA	NA	NA	NA	NA
WP_000118523.1|1146596_1146860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000877779.1|1148237_1148495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303001.1|1148517_1149027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000990243.1|1149031_1149487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000266539.1|1149718_1150207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000765181.1|1150203_1150434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000015617.1|1150472_1150610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303003.1|1150713_1151922_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	99.8	2.0e-234
WP_035689358.1|1151931_1152303_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000428546.1|1152435_1153029_+	tetracyline resistance-associated transcriptional repressor TetC	NA	NA	NA	NA	NA
WP_001089072.1|1153141_1154347_-	tetracycline efflux MFS transporter Tet(B)	NA	A0A2H4UVM2	Bodo_saltans_virus	24.4	3.0e-09
WP_000088605.1|1154428_1155052_+	tetracycline resistance transcriptional repressor TetR(B)	NA	NA	NA	NA	NA
WP_001284954.1|1155029_1155716_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000460649.1|1155723_1156110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000562370.1|1156102_1156423_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_000599533.1|1156866_1158072_+	sodium/glutamate symporter	NA	NA	NA	NA	NA
WP_001303007.1|1158437_1159646_-|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	99.5	1.5e-234
WP_001082319.1|1159931_1160735_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
WP_000480968.1|1160734_1161571_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001445143.1|1161809_1162061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001043260.1|1162343_1163159_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_162829202.1|1164617_1165830_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
1166633:1166648	attR	GGATAAAGCCATTGAG	NA	NA	NA	NA
>prophage 5
NZ_CP016625	Escherichia coli O157:H7 strain FRIK944 chromosome, complete genome	5770602	1277422	1346986	5770602	integrase,head,tail,protease,holin,portal,capsid,terminase,transposase	Escherichia_phage(25.0%)	77	1285910:1285925	1307276:1307291
WP_000156526.1|1277422_1279183_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877161.1|1279368_1279821_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000750416.1|1279896_1280937_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288710.1|1281293_1281803_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_000839159.1|1282021_1282651_+	CRP-S regulon transcriptional coactivator Sxy	NA	NA	NA	NA	NA
WP_000875023.1|1282613_1284776_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261230.1|1284785_1285232_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_001301436.1|1285354_1287409_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	5.9e-21
1285910:1285925	attL	GCGGATTTTTTCCGCC	NA	NA	NA	NA
WP_000424181.1|1287440_1287899_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847791.1|1287994_1288657_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000665217.1|1288829_1289243_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_001295356.1|1289287_1289605_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000116288.1|1289662_1290853_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000048252.1|1290947_1291226_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904442.1|1291222_1291552_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000375128.1|1291642_1292302_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	1.8e-48
WP_001299351.1|1292709_1293729_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
WP_000273151.1|1293706_1293949_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000034474.1|1294016_1296488_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_001098307.1|1296581_1296773_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000413705.1|1296769_1296958_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001133046.1|1297531_1297717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394511.1|1297903_1298293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379575.1|1298434_1298590_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_001303876.1|1298867_1299155_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000536233.1|1299154_1299346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000986592.1|1299373_1299775_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000887453.1|1299883_1300156_+	helix-turn-helix domain-containing protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000693855.1|1300139_1300565_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000273724.1|1300771_1301227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001205823.1|1301305_1302397_+	hypothetical protein	NA	V5URT9	Shigella_phage	70.0	5.1e-133
WP_000788751.1|1302403_1303150_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	84.2	6.2e-114
WP_000450992.1|1303171_1303942_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	6.1e-80
WP_001151233.1|1303957_1304371_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_000160654.1|1304722_1305496_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000813263.1|1306100_1306256_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	94.1	1.9e-17
WP_001341388.1|1306423_1306702_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265172.1|1306703_1307753_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.2e-110
1307276:1307291	attR	GGCGGAAAAAATCCGC	NA	NA	NA	NA
WP_001217436.1|1307765_1308137_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_000090264.1|1308126_1308498_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	83.2	4.0e-53
WP_000265265.1|1308649_1309468_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000261909.1|1310088_1310802_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000874392.1|1311568_1313419_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.1	0.0e+00
WP_162829202.1|1313594_1314807_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001303878.1|1315012_1315327_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_012816791.1|1315854_1316040_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000675931.1|1316261_1316375_-	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_001003118.1|1316595_1317129_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000138558.1|1317288_1317561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000411791.1|1317816_1318023_-|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	97.1	4.5e-30
WP_000235421.1|1318773_1319049_+	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	51.5	2.4e-10
WP_001171554.1|1319124_1319505_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|1319501_1319849_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|1319898_1321437_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_001302857.1|1321700_1323629_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	3.3e-260
WP_000259002.1|1323612_1323819_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831796.1|1323815_1325408_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_001254002.1|1325397_1326903_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000256723.1|1326939_1327287_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001301534.1|1327344_1327611_+|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_029208397.1|1327592_1328333_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_000479117.1|1328346_1328778_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_000533402.1|1328804_1329218_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000082473.1|1329198_1331778_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	79.9	0.0e+00
WP_000847298.1|1331774_1332104_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001302968.1|1332103_1332802_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	2.9e-129
WP_000194760.1|1332812_1333556_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.6	2.4e-150
WP_050546863.1|1333501_1334134_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	5.8e-105
WP_000649827.1|1334324_1334852_-	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	55.8	4.8e-52
WP_000515109.1|1334985_1338459_+	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	96.2	0.0e+00
WP_001230444.1|1338526_1339126_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.0	8.8e-111
WP_000268855.1|1339190_1340504_+|tail	phage tail protein	tail	A0A0P0ZE15	Stx2-converting_phage	99.1	2.0e-83
WP_001023407.1|1340505_1340775_+|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_001301613.1|1342767_1343886_+	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_000107391.1|1343882_1345676_+	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001186424.1|1345694_1346402_+	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000003653.1|1346398_1346986_+|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
>prophage 6
NZ_CP016625	Escherichia coli O157:H7 strain FRIK944 chromosome, complete genome	5770602	1439429	1518583	5770602	plate,integrase,head,tail,protease,transposase	Shigella_phage(44.0%)	94	1433599:1433614	1451499:1451514
1433599:1433614	attL	CCAGGTACTGCTGCCG	NA	NA	NA	NA
WP_000279869.1|1439429_1440632_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	34.4	3.8e-44
WP_000282212.1|1440818_1442636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303889.1|1443747_1444044_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000579535.1|1444270_1444468_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_000335698.1|1444686_1446072_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_000282084.1|1446892_1447456_+	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_000233452.1|1447610_1449971_+	DEAD/DEAH box helicase family protein	NA	Q84473	Paramecium_bursaria_Chlorella_virus	32.5	1.8e-34
WP_000136079.1|1450132_1450309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000998048.1|1450727_1452266_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
1451499:1451514	attR	CGGCAGCAGTACCTGG	NA	NA	NA	NA
WP_000612591.1|1452315_1452663_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|1452659_1453040_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_028913479.1|1454431_1455037_+	conjugal transfer protein TraT	NA	NA	NA	NA	NA
WP_001303891.1|1455084_1455336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001304211.1|1455359_1455650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162829202.1|1456043_1457256_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000024297.1|1457648_1458008_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000591997.1|1458100_1459720_-	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_000134927.1|1459944_1460220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010904558.1|1460600_1461299_+	urease accessory protein UreD	NA	NA	NA	NA	NA
WP_000424145.1|1461389_1461692_+	urease subunit gamma	NA	NA	NA	NA	NA
WP_000612150.1|1461700_1462021_+	urease subunit beta	NA	NA	NA	NA	NA
WP_001056416.1|1463487_1464072_-	hypothetical protein	NA	A0A2D1GNR8	Pseudomonas_phage	39.8	4.2e-17
WP_001310454.1|1464239_1464488_+	helix-turn-helix domain-containing protein	NA	A0A2D1GNH1	Pseudomonas_phage	73.2	1.3e-28
WP_001512118.1|1464489_1466580_+|transposase	Mu transposase C-terminal domain-containing protein	transposase	A0A2D1GNK9	Pseudomonas_phage	47.4	4.0e-166
WP_000129790.1|1466651_1467584_+	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	48.3	1.2e-69
WP_000257930.1|1467586_1467808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001057199.1|1467820_1468075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000739863.1|1468076_1468358_+	hypothetical protein	NA	I6WB15	Burkholderia_virus	47.4	2.8e-11
WP_000049432.1|1468354_1468627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000049306.1|1468631_1468925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001129553.1|1468936_1469467_+	host-nuclease inhibitor Gam family protein	NA	C9DGL8	Escherichia_phage	57.1	1.9e-48
WP_000323221.1|1469564_1470107_+	hypothetical protein	NA	A0A0C4UQZ6	Shigella_phage	40.0	2.9e-28
WP_000578573.1|1470110_1470644_+	hypothetical protein	NA	A0A0C4UQU2	Shigella_phage	66.7	5.9e-66
WP_000465562.1|1470643_1471159_+	hypothetical protein	NA	C9DGM0	Escherichia_phage	55.4	1.2e-47
WP_000973023.1|1471162_1471714_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_000633440.1|1471710_1472022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001310341.1|1472036_1472387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001310453.1|1472402_1472735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001086886.1|1472727_1472925_+	hypothetical protein	NA	A0A291AXE7	Shigella_phage	34.5	1.2e-05
WP_000378480.1|1472914_1473211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001214366.1|1473207_1473717_+	gp16 family protein	NA	A0A0C4UQU3	Shigella_phage	41.9	1.1e-26
WP_000852377.1|1473786_1474212_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_001125304.1|1474283_1474784_+	lysozyme	NA	B6SD29	Bacteriophage	42.6	3.0e-27
WP_115801859.1|1474818_1475247_+	endopeptidase	NA	NA	NA	NA	NA
WP_001122256.1|1475230_1475449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000342747.1|1475458_1475686_+	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000270159.1|1475666_1475975_+	DUF2730 family protein	NA	NA	NA	NA	NA
WP_001279082.1|1475971_1476262_+	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	63.2	4.7e-25
WP_000360581.1|1476264_1476846_+	DUF3486 family protein	NA	A0A0C4UQU5	Shigella_phage	57.0	1.9e-49
WP_001057665.1|1476845_1478510_+	hypothetical protein	NA	A0A0C4UR29	Shigella_phage	73.2	8.1e-231
WP_000532592.1|1478509_1480099_+	DUF935 domain-containing protein	NA	A0A0C4UQR8	Shigella_phage	57.7	1.4e-168
WP_000046901.1|1480082_1481414_+|head	phage head morphogenesis protein	head	A0A0C4UQY9	Shigella_phage	58.8	3.9e-151
WP_000094808.1|1481535_1482009_+	phage virion morphogenesis protein	NA	A0A0C4UR01	Shigella_phage	54.6	2.7e-38
WP_000850822.1|1482185_1483310_+|protease	protease	protease	A0A0C4UQU6	Shigella_phage	47.9	2.9e-78
WP_001142982.1|1483309_1484257_+|head	Mu-like prophage major head subunit gpT family protein	head	A0A0C4UQR9	Shigella_phage	67.2	1.2e-122
WP_001002060.1|1484300_1484669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001104956.1|1484665_1485085_+	gp436 family protein	NA	A0A0C4UR02	Shigella_phage	53.6	4.7e-34
WP_000627431.1|1485081_1485642_+	DUF1834 family protein	NA	A0A0C4UQU7	Shigella_phage	47.7	1.1e-41
WP_000848437.1|1485642_1485888_+	DUF2635 domain-containing protein	NA	C9DGP6	Escherichia_phage	54.5	2.8e-07
WP_000606747.1|1485884_1487387_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	C9DGP7	Escherichia_phage	51.3	5.6e-138
WP_000015473.1|1487395_1487761_+|tail	phage tail tube protein	tail	C9DGP8	Escherichia_phage	51.7	2.0e-25
WP_000213225.1|1487775_1488252_+|tail	phage tail assembly protein	tail	A0A0C4UR03	Shigella_phage	50.8	1.0e-21
WP_000113525.1|1488378_1490454_+	tape measure protein	NA	A0A0C4UQU8	Shigella_phage	37.7	2.1e-71
WP_000146116.1|1490440_1491790_+	DNA circularization protein	NA	C9DGQ2	Escherichia_phage	33.1	7.7e-54
WP_000098807.1|1491773_1492898_+|tail	tail protein	tail	C9DGQ3	Escherichia_phage	48.5	2.9e-91
WP_000980532.1|1492887_1493502_+|plate	phage baseplate assembly protein V	plate	A0A0C4UQZ3	Shigella_phage	51.0	4.7e-51
WP_000763330.1|1493494_1493932_+	phage GP46 family protein	NA	A0A0C4UR04	Shigella_phage	53.5	1.9e-38
WP_001146835.1|1493931_1495014_+|plate	baseplate J/gp47 family protein	plate	A0A0C4UQU9	Shigella_phage	53.2	1.1e-98
WP_000301577.1|1495004_1495565_+	YmfQ family protein	NA	C9DGQ7	Escherichia_phage	48.1	2.3e-44
WP_000469162.1|1495564_1496476_+|tail	tail fiber protein	tail	C9DGQ8	Escherichia_phage	47.5	2.9e-36
WP_000420351.1|1496510_1497032_-|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	52.6	2.1e-47
WP_010917875.1|1497111_1497315_-|tail	tail fiber protein	tail	NA	NA	NA	NA
WP_000904930.1|1497537_1498098_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	75.7	4.3e-75
WP_010917876.1|1498197_1500237_+	sialate O-acetylesterase	NA	S5MDQ7	Escherichia_phage	79.4	4.3e-274
WP_000144787.1|1500383_1500566_+	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	54.4	1.3e-09
WP_001114104.1|1500601_1500847_+	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_115801860.1|1500885_1501350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001310452.1|1501464_1501665_+	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000528251.1|1501618_1502356_+	protein mom	NA	A0A0C4UQZ7	Shigella_phage	79.0	1.7e-103
WP_000966485.1|1503000_1503465_+	urease accessory protein UreE	NA	NA	NA	NA	NA
WP_001142971.1|1503465_1504140_+	urease accessory protein UreF	NA	NA	NA	NA	NA
WP_001021389.1|1504151_1504769_+	urease accessory protein UreG	NA	NA	NA	NA	NA
WP_000803992.1|1505980_1506244_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_001135715.1|1506545_1506686_+	Hok/Gef family protein	NA	G9L6L7	Escherichia_phage	66.7	2.4e-11
WP_000397129.1|1507557_1508229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000435663.1|1510566_1510992_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	73.2	1.4e-33
WP_000624701.1|1510988_1511339_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	64.7	1.1e-39
WP_000088522.1|1511369_1512983_+|transposase	IS66-like element IS682 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	65.7	3.1e-166
WP_000957248.1|1513925_1514267_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_000042916.1|1514253_1514583_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_001176766.1|1514843_1515311_-	tellurium resistance protein TerW	NA	NA	NA	NA	NA
WP_000506898.1|1515328_1516537_-	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_000797372.1|1516547_1517504_-	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_001182418.1|1517503_1518583_-|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.4	6.2e-38
>prophage 7
NZ_CP016625	Escherichia coli O157:H7 strain FRIK944 chromosome, complete genome	5770602	1637242	1757800	5770602	integrase,head,tRNA,tail,protease,lysis,holin,portal,capsid,terminase,transposase	Enterobacteria_phage(39.05%)	149	1703161:1703176	1731415:1731430
WP_000952736.1|1637242_1638064_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
WP_000759316.1|1638219_1639266_-	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_000580316.1|1639262_1640057_-	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_000074985.1|1640223_1641342_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	43.9	1.0e-83
WP_000003742.1|1641310_1641580_-	excisionase	NA	NA	NA	NA	NA
WP_077699040.1|1641641_1642031_-	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	60.0	1.3e-38
WP_000559928.1|1642163_1642679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001414141.1|1642793_1642946_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000948454.1|1643261_1643738_-	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_000711018.1|1643862_1644186_+	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000693962.1|1644169_1644595_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262323.1|1644663_1645701_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	79.5	3.3e-89
WP_072143019.1|1645612_1646155_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	92.2	2.3e-81
WP_000451012.1|1646188_1646905_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.4	2.1e-71
WP_072140318.1|1646937_1647219_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.1	1.4e-29
WP_001310212.1|1647215_1647518_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	87.9	1.9e-45
WP_001017965.1|1647507_1647825_+	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	92.4	2.1e-42
WP_000156547.1|1647778_1648096_+	hypothetical protein	NA	A0A088CQ13	Enterobacteria_phage	90.0	4.4e-45
WP_000515959.1|1648082_1648520_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	1.9e-38
WP_001014296.1|1648521_1648713_+	hypothetical protein	NA	G9L660	Escherichia_phage	98.4	1.6e-26
WP_000207955.1|1648715_1649303_+	DUF551 domain-containing protein	NA	K7PH57	Enterobacteria_phage	45.8	7.5e-38
WP_001278450.1|1649418_1649523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000887477.1|1649711_1649924_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001341388.1|1650091_1650370_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265159.1|1650371_1651421_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.2	1.4e-106
WP_001217410.1|1651433_1651808_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.1e-33
WP_000762929.1|1651804_1652626_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.6	1.3e-83
WP_000023147.1|1653704_1655642_+	DUF1737 domain-containing protein	NA	Q6H9W1	Enterobacteria_phage	76.6	4.8e-291
WP_001213059.1|1655789_1655972_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	67.8	1.0e-14
WP_001289717.1|1656009_1656279_+	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	75.3	8.2e-08
WP_000284518.1|1656354_1656570_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_000731241.1|1656574_1656919_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000992148.1|1656969_1657503_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_001056806.1|1657773_1658343_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|1658342_1658489_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001208682.1|1658716_1658923_+	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000735655.1|1658987_1659212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000347013.1|1659568_1659709_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302977.1|1659838_1660024_-	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	90.4	3.7e-20
WP_000279796.1|1660065_1660431_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
WP_000958387.1|1660722_1661286_+|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
WP_001301491.1|1661282_1662944_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000172999.1|1663007_1664945_+|capsid	phage major capsid protein	capsid	B6DZ99	Enterobacteria_phage	100.0	0.0e+00
WP_001063099.1|1664989_1665211_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_015994249.1|1665156_1667742_+|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	100.0	0.0e+00
WP_000125984.1|1667738_1668065_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001007905.1|1668075_1668426_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573374.1|1668422_1668869_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|1668865_1669210_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275464.1|1669275_1669992_+	immunoglobulin domain-containing protein	NA	B6DZA6	Enterobacteria_phage	100.0	1.2e-127
WP_000710952.1|1670006_1670381_+|tail	phage tail assembly chaperone	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001453746.1|1670476_1670686_+	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	100.0	2.6e-33
WP_000212827.1|1670733_1673976_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	100.0	0.0e+00
WP_000807954.1|1673968_1674310_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001152182.1|1674309_1675008_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.3	8.1e-132
WP_000170104.1|1675024_1675279_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_010904626.1|1675388_1675499_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_000835336.1|1675801_1676680_+	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	77.2	2.5e-93
WP_071526731.1|1677415_1677652_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	80.3	2.8e-20
WP_115801847.1|1677664_1677754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301673.1|1677773_1680122_+	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_001301984.1|1680712_1684114_+	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.2	1.7e-219
WP_001303921.1|1686422_1686698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000938118.1|1686758_1688120_-	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.2	1.4e-50
WP_000799385.1|1688483_1689347_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531594.1|1689330_1690467_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000359446.1|1690716_1691943_+	peptidase T	NA	NA	NA	NA	NA
WP_001301987.1|1691991_1693113_-	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_162829200.1|1693474_1694688_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	100.0	1.5e-170
WP_032174463.1|1694686_1695904_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	56.8	6.1e-127
WP_000953272.1|1696268_1696457_+	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.0	2.0e-13
WP_000226782.1|1697261_1697459_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000609225.1|1697451_1697664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000551675.1|1697653_1698118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204985.1|1698110_1698344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770178.1|1698349_1698649_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000833626.1|1698645_1700046_+	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	49.3	3.6e-115
WP_000192401.1|1700246_1700498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126695.1|1700494_1700905_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000233304.1|1700915_1701188_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001132079.1|1701314_1701539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000796968.1|1701790_1701997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000907465.1|1701996_1703052_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	43.3	1.5e-68
WP_000380883.1|1703064_1703400_+|head	head decoration protein	head	NA	NA	NA	NA
1703161:1703176	attL	ACCCCGCTGATGCTGG	NA	NA	NA	NA
WP_000224603.1|1703412_1703826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000835281.1|1704031_1704574_+|terminase	terminase small subunit	terminase	O64316	Escherichia_phage	44.2	1.8e-33
WP_000133424.1|1704829_1705111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000735407.1|1705711_1707172_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265474.1|1707171_1707843_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423729.1|1708011_1709382_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001301618.1|1709385_1710027_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001301861.1|1710062_1711169_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|1711222_1711684_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248690.1|1711693_1712347_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444477.1|1712518_1713769_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_000741454.1|1713882_1715025_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	100.0	8.1e-206
WP_000088657.1|1715014_1715251_-	excisionase	NA	NA	NA	NA	NA
WP_000788869.1|1716175_1716877_+	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	1.3e-129
WP_000145915.1|1716873_1717176_+	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_001070446.1|1717243_1717576_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001302833.1|1717640_1717763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000709077.1|1717820_1719347_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	31.1	1.2e-31
WP_001053040.1|1719848_1720304_+	recombination protein NinB	NA	I6PD71	Cronobacter_phage	64.9	8.6e-58
WP_000224907.1|1720303_1720474_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_000774504.1|1720466_1720757_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_001099695.1|1720753_1721116_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	7.3e-60
WP_000971093.1|1721112_1721253_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	71.1	7.7e-10
WP_001097228.1|1721249_1721939_+	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.9	1.7e-57
WP_000544528.1|1722260_1722566_+|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001180487.1|1722552_1723029_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	4.3e-84
WP_010917798.1|1723245_1723428_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	93.3	4.7e-15
WP_000738495.1|1723518_1723812_-	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	99.0	1.5e-47
WP_000079504.1|1724103_1724514_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	2.7e-71
WP_001031427.1|1724799_1725006_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001300120.1|1725170_1725365_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	1.5e-27
WP_000453564.1|1725753_1726299_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.8	2.6e-93
WP_001027365.1|1726273_1728199_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.2	0.0e+00
WP_000198153.1|1728195_1728402_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001301524.1|1728398_1730000_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000123254.1|1729980_1731300_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001295978.1|1731309_1731642_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
1731415:1731430	attR	ACCCCGCTGATGCTGG	NA	NA	NA	NA
WP_000063233.1|1731696_1732722_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.5	5.6e-190
WP_000158906.1|1732763_1733162_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000752995.1|1733173_1733527_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	99.1	9.9e-62
WP_000975100.1|1733538_1734117_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000683105.1|1734113_1734509_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_001143002.1|1734516_1735257_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	8.3e-127
WP_000479161.1|1735272_1735695_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	2.4e-70
WP_000459457.1|1735676_1736111_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000840323.1|1736103_1738653_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	87.3	0.0e+00
WP_000847331.1|1738649_1738979_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	2.5e-59
WP_001152612.1|1738978_1739677_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_000194779.1|1739682_1740426_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_000090920.1|1740362_1740995_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	1.7e-96
WP_000515612.1|1741055_1744454_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.7	0.0e+00
WP_001230336.1|1744520_1745120_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	99.5	3.0e-111
WP_000279120.1|1745184_1748100_+|tail	phage tail protein	tail	Q6H9S9	Enterobacteria_phage	98.3	1.1e-57
WP_000885630.1|1748099_1748681_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.7	6.1e-101
WP_000488340.1|1748800_1749691_-	manganese catalase family protein	NA	NA	NA	NA	NA
WP_001079482.1|1749709_1750216_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001166090.1|1750252_1750753_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000134810.1|1750831_1751014_-	general stress protein	NA	NA	NA	NA	NA
WP_000239881.1|1751511_1752180_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937476.1|1752236_1752485_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	1.7e-12
WP_001171554.1|1752560_1752941_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|1752937_1753285_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|1753334_1754873_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_001226373.1|1755175_1756660_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001201843.1|1756846_1757800_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
>prophage 8
NZ_CP016625	Escherichia coli O157:H7 strain FRIK944 chromosome, complete genome	5770602	1842374	1892866	5770602	integrase,head,tail,holin,capsid,terminase	Stx2-converting_phage(34.69%)	60	1835100:1835113	1851921:1851934
1835100:1835113	attL	TGGTATGCAGTAAC	NA	NA	NA	NA
WP_000113674.1|1842374_1843505_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.4	3.4e-103
WP_000113189.1|1843482_1843731_-	excisionase	NA	NA	NA	NA	NA
WP_000048549.1|1843795_1846267_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.6	1.5e-58
WP_001090200.1|1846359_1846551_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|1846547_1846736_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_000920491.1|1847294_1847528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|1847505_1847913_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_001171903.1|1847935_1848154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240336.1|1848226_1848526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000787428.1|1848789_1849197_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_000912298.1|1849273_1849501_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705621.1|1849484_1850036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000020556.1|1850007_1851048_+	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_157825328.1|1850959_1851502_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.5e-85
WP_000774808.1|1851688_1852270_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	80.2	8.6e-79
1851921:1851934	attR	GTTACTGCATACCA	NA	NA	NA	NA
WP_001505071.1|1852266_1852431_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001449026.1|1853129_1853888_+	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_000961820.1|1854166_1854379_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	70.0	1.4e-15
WP_001217394.1|1854599_1854857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010917803.1|1854926_1855205_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001302148.1|1855206_1856253_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.2	4.2e-108
WP_000904166.1|1856265_1856625_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.9	3.6e-35
WP_000640048.1|1856633_1857164_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000917750.1|1857405_1857603_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
WP_000935548.1|1857753_1858812_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	94.3	1.1e-199
WP_000143067.1|1859608_1861462_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.9	0.0e+00
WP_000284517.1|1861611_1861827_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000731259.1|1861831_1862176_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000992137.1|1862226_1862760_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_001056806.1|1863030_1863600_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|1863599_1863746_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|1863973_1864159_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000095736.1|1864583_1864811_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_015994246.1|1864852_1865218_+	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	100.0	1.5e-65
WP_001303051.1|1865507_1866071_+|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	99.5	2.8e-90
WP_001303049.1|1866067_1867729_+|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	99.8	0.0e+00
WP_000172999.1|1867792_1869730_+|capsid	phage major capsid protein	capsid	B6DZ99	Enterobacteria_phage	100.0	0.0e+00
WP_001339615.1|1869854_1869995_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	97.8	7.0e-19
WP_000126019.1|1872520_1872847_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001007901.1|1872856_1873207_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000573374.1|1873203_1873650_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|1873646_1873991_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275508.1|1874049_1874766_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_001030063.1|1874771_1875146_+|tail	phage tail assembly chaperone	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|1875241_1875451_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_064261924.1|1875503_1878746_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	99.4	0.0e+00
WP_000807954.1|1878738_1879080_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_065763496.1|1879079_1879778_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	99.6	3.3e-133
WP_001303043.1|1879788_1880532_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	95.5	3.7e-143
WP_187703348.1|1882323_1882788_+	hypothetical protein	NA	A0A0P0ZBW1	Stx2-converting_phage	100.0	9.0e-87
WP_001415161.1|1883296_1884829_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	99.6	2.8e-278
WP_001230509.1|1884896_1885496_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.5	3.3e-110
WP_024748460.1|1885560_1886874_+|tail	phage tail protein	tail	A0A0P0ZE15	Stx2-converting_phage	96.6	6.9e-76
WP_001023407.1|1886875_1887145_+|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_001131658.1|1887258_1887834_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	4.1e-89
WP_001356599.1|1887906_1888536_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	91.5	6.1e-78
WP_001143804.1|1888617_1889259_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	96.7	3.8e-104
WP_001120551.1|1889420_1889663_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_000527769.1|1891166_1892627_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.9e-42
WP_000214712.1|1892662_1892866_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
>prophage 9
NZ_CP016625	Escherichia coli O157:H7 strain FRIK944 chromosome, complete genome	5770602	2163131	2321652	5770602	integrase,head,tail,protease,holin,portal,capsid,terminase,transposase	Enterobacteria_phage(37.14%)	172	2182318:2182335	2230768:2230785
WP_000422055.1|2163131_2164181_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559268.1|2164400_2165159_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	6.7e-07
WP_001278878.1|2165155_2165746_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001291216.1|2165785_2166658_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001302160.1|2166870_2168454_-	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001295575.1|2168481_2169102_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285675.1|2169098_2169980_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|2170117_2170162_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194607.1|2170253_2171816_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763503.1|2171815_2173411_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.2	5.0e-52
WP_000983855.1|2173411_2174773_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	39.8	7.3e-36
WP_000209521.1|2174784_2175978_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443092.1|2175977_2176784_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000807651.1|2177164_2177344_+	general stress protein	NA	NA	NA	NA	NA
WP_001056491.1|2177429_2177930_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079499.1|2177975_2178482_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000251936.1|2178971_2179142_-	hypothetical protein	NA	A0A0U2RK60	Escherichia_phage	62.5	9.4e-10
WP_032156508.1|2179519_2180104_-	protein kinase	NA	NA	NA	NA	NA
WP_001023406.1|2181234_2181504_-|tail	phage tail fiber C-terminal domain-containing protein	tail	Q6H9S8	Enterobacteria_phage	97.8	2.4e-44
WP_065763498.1|2181505_2182819_-|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.4	1.7e-77
2182318:2182335	attL	CGGCTGCACTTTCTGCCG	NA	NA	NA	NA
WP_001426435.1|2182883_2183483_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	7.5e-110
WP_065763499.1|2183550_2187030_-	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	97.2	0.0e+00
WP_122996320.1|2187270_2187900_-|tail	tail assembly protein	tail	A0A0P0ZEN7	Stx2-converting_phage	98.1	1.7e-104
WP_001444516.1|2187845_2188589_-|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	98.0	1.7e-148
WP_001426561.1|2188599_2189298_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	1.4e-131
WP_000847298.1|2189297_2189627_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000532073.1|2192311_2192620_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
WP_000479062.1|2192646_2193069_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.2e-71
WP_000235090.1|2193082_2193835_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000682708.1|2193842_2194241_-|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	99.2	1.0e-70
WP_000974966.1|2194253_2194877_-|tail	phage tail protein	tail	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_001281350.1|2194879_2195161_-	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_001097065.1|2195153_2195480_-	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_187703344.1|2198215_2198530_-|portal	phage portal protein	portal	Q8VNN6	Enterobacteria_phage	76.9	7.0e-35
WP_149025374.1|2199031_2199250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_187703345.1|2201042_2201366_-|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	9.7e-56
WP_000373407.1|2201362_2201839_-	DUF1441 family protein	NA	Q8VNN8	Enterobacteria_phage	100.0	3.3e-84
WP_012816791.1|2202313_2202499_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001092902.1|2203017_2203551_-	lysozyme	NA	G9L6J6	Escherichia_phage	96.6	2.1e-100
WP_001015158.1|2203587_2204145_-	hypothetical protein	NA	Q08JA0	Stx2-converting_phage	80.9	1.5e-48
WP_000284510.1|2204148_2204364_-|holin	class II holin family protein	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_001290234.1|2204441_2204687_-	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	97.5	7.4e-16
WP_000142777.1|2204727_2204907_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	96.6	1.4e-24
WP_065763501.1|2205043_2206990_-	DUF1737 domain-containing protein	NA	Q9EYC8	Enterobacteria_phage	98.3	0.0e+00
WP_000483509.1|2207584_2208643_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	98.6	2.6e-206
WP_000917735.1|2208793_2208991_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.8e-28
WP_000762902.1|2209217_2210039_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.9	2.8e-83
WP_000904171.1|2210035_2210410_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	4.2e-34
WP_001265189.1|2210422_2211472_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.3	3.4e-110
WP_024177817.1|2211473_2211743_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	52.5	2.7e-11
WP_001452497.1|2211796_2212024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217944.1|2212247_2212619_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000042395.1|2212611_2212929_+	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000882662.1|2213031_2213244_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	2.5e-28
WP_000211435.1|2213458_2214007_-	ORF6N domain-containing protein	NA	A0A2R2Z302	Escherichia_phage	75.4	1.4e-41
WP_000215514.1|2214354_2214540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000537579.1|2214599_2215358_-	DUF1627 domain-containing protein	NA	A0A088CE47	Shigella_phage	68.8	1.9e-81
WP_157837342.1|2215392_2215935_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	97.4	2.9e-84
WP_000020565.1|2215846_2216887_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	86.2	6.7e-90
WP_000705370.1|2216858_2217410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000476986.1|2217393_2217621_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001003379.1|2217698_2218106_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	45.4	7.2e-24
WP_000379589.1|2218295_2218451_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_001171955.1|2218610_2218829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302137.1|2218832_2218997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000450222.1|2219394_2219583_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000092782.1|2219579_2219768_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000102168.1|2219860_2222305_+	exonuclease	NA	V5UQJ3	Shigella_phage	58.3	8.4e-176
WP_000113189.1|2222369_2222618_+	excisionase	NA	NA	NA	NA	NA
WP_000113674.1|2222595_2223726_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.4	3.4e-103
WP_001023426.1|2229807_2230077_-|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	97.8	1.6e-43
WP_065763502.1|2230078_2231392_-|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.6	6.3e-77
2230768:2230785	attR	CGGCTGCACTTTCTGCCG	NA	NA	NA	NA
WP_001230509.1|2231456_2232056_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.5	3.3e-110
WP_001444516.1|2236413_2237157_-|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	98.0	1.7e-148
WP_001426561.1|2237166_2237865_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	1.4e-131
WP_000847298.1|2237864_2238194_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000479062.1|2241212_2241635_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.2e-71
WP_000235090.1|2241648_2242401_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000682708.1|2242408_2242807_-|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	99.2	1.0e-70
WP_000974966.1|2242819_2243443_-|tail	phage tail protein	tail	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_001281350.1|2243445_2243727_-	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_001114427.1|2244132_2246157_-|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.7	0.0e+00
WP_000974564.1|2246101_2247604_-|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
WP_000102415.1|2247603_2247816_-	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_001101699.1|2252170_2252440_-|tail	phage tail fiber C-terminal domain-containing protein	tail	Q6H9S8	Enterobacteria_phage	98.9	1.9e-44
WP_065763498.1|2252441_2253755_-|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.4	1.7e-77
WP_001230509.1|2253819_2254419_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.5	3.3e-110
WP_129137391.1|2258210_2258843_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	95.7	3.5e-102
WP_001303043.1|2258788_2259532_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	95.5	3.7e-143
WP_001303044.1|2259542_2260241_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	8.1e-132
WP_000847298.1|2260240_2260570_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000081804.1|2260566_2263179_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	95.9	0.0e+00
WP_000533440.1|2263159_2263573_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000479046.1|2263599_2264022_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.4e-70
WP_000235090.1|2264035_2264788_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000683063.1|2264795_2265191_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	3.3e-58
WP_000975020.1|2265187_2265721_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	5.9e-58
WP_000753016.1|2265735_2266089_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	92.3	1.9e-57
WP_000158906.1|2266100_2266499_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000063265.1|2266540_2267566_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_001295978.1|2267621_2267954_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000123254.1|2267963_2269283_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001301524.1|2269263_2270865_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000198153.1|2270861_2271068_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001027230.1|2271064_2272990_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.1	0.0e+00
WP_000867498.1|2272964_2273510_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.3	9.6e-80
WP_001303940.1|2273896_2274121_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_001302717.1|2274202_2274517_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208680.1|2275042_2275228_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_000539795.1|2275450_2275597_-	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	87.0	1.1e-11
WP_001056806.1|2275596_2276166_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992137.1|2276436_2276970_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_000731259.1|2277020_2277365_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_024180155.1|2277369_2277585_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_000023184.1|2278024_2279875_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.9	0.0e+00
WP_001302123.1|2280352_2280784_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.5	1.6e-66
WP_000301797.1|2281234_2281948_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000917763.1|2282083_2282281_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000640035.1|2282505_2283060_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	1.0e-65
WP_001217444.1|2283122_2283428_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.3	7.1e-32
WP_001265229.1|2283440_2284490_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_000191872.1|2284491_2284764_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_000756596.1|2284885_2285230_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000935259.1|2285349_2285562_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000104474.1|2285795_2286353_-	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000683609.1|2286354_2286573_-	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_001289673.1|2286700_2287012_-	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
WP_000699809.1|2287004_2287232_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_000603384.1|2287228_2287510_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000450627.1|2287542_2288259_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.8	3.3e-72
WP_000139447.1|2288292_2288754_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	4.0e-79
WP_001262402.1|2288746_2289790_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	65.1	1.4e-82
WP_000693878.1|2289858_2290284_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000747948.1|2290267_2290510_-	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_001416688.1|2290901_2291240_+	peptidase S24	NA	H9C160	Pectobacterium_phage	30.1	1.9e-06
WP_000380316.1|2291532_2291685_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_000394548.1|2291696_2292335_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_000449175.1|2293108_2293297_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199475.1|2293293_2293482_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000102123.1|2293574_2294819_+	exonuclease	NA	H6WRX1	Salmonella_phage	50.3	1.4e-86
WP_001120551.1|2295528_2295771_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_001500906.1|2296682_2296979_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	1.3e-43
WP_000267292.1|2297058_2299560_-|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	99.2	0.0e+00
WP_001063099.1|2299505_2299727_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000172999.1|2299771_2301709_-|capsid	phage major capsid protein	capsid	B6DZ99	Enterobacteria_phage	100.0	0.0e+00
WP_001303049.1|2301772_2303434_-|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	99.8	0.0e+00
WP_001303051.1|2303430_2303994_-|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	99.5	2.8e-90
WP_015994246.1|2304283_2304649_-	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	100.0	1.5e-65
WP_000095736.1|2304690_2304918_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_012816791.1|2305342_2305528_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|2305755_2305902_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|2305901_2306471_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992137.1|2306741_2307275_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_000998048.1|2307438_2308977_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|2309026_2309374_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|2309370_2309751_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000731257.1|2309826_2310120_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	8.3e-46
WP_024180155.1|2310124_2310340_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_024748470.1|2310779_2312630_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.2	0.0e+00
WP_001303509.1|2313108_2313537_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	97.8	4.4e-64
WP_001059381.1|2314172_2314862_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_001217455.1|2314858_2315218_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	5.9e-38
WP_001265161.1|2315230_2316280_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.7	1.4e-108
WP_012779366.1|2316281_2316560_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000887477.1|2316727_2316940_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001278450.1|2317128_2317233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000206793.1|2317348_2317933_-	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	84.8	1.9e-33
WP_001118159.1|2317989_2318385_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	7.8e-31
WP_000788936.1|2319195_2319936_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	89.8	2.3e-124
WP_000095670.1|2319942_2320905_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	57.0	1.8e-81
WP_000693943.1|2320927_2321353_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000172738.1|2321349_2321652_-	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
>prophage 10
NZ_CP016625	Escherichia coli O157:H7 strain FRIK944 chromosome, complete genome	5770602	2465750	2510668	5770602	plate,integrase,head,tRNA,tail,holin,portal,capsid,terminase	Enterobacteria_phage(74.47%)	61	2468153:2468177	2503310:2503334
WP_000029463.1|2465750_2466500_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	9.3e-09
WP_001154193.1|2466499_2467051_-	bifunctional thioredoxin/glutathione peroxidase	NA	NA	NA	NA	NA
WP_000956513.1|2467113_2468094_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
2468153:2468177	attL	AAAGAAAAAAGGCCGCAGAGCGGCC	NA	NA	NA	NA
WP_001689686.1|2468286_2468724_-	DUF1640 domain-containing protein	NA	NA	NA	NA	NA
WP_000403439.1|2468824_2469325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001247210.1|2469327_2470266_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	51.5	5.1e-81
WP_000904674.1|2470354_2470663_-	helix-turn-helix transcriptional regulator	NA	A0A0M5M1I9	Salmonella_phage	52.1	8.7e-22
WP_001151410.1|2470759_2471038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917809.1|2471052_2471391_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	87.1	2.3e-52
WP_000158974.1|2471401_2471689_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	75.8	6.6e-32
WP_000514277.1|2471700_2471943_+	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_000021666.1|2471939_2472053_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	89.2	2.0e-08
WP_029238958.1|2472242_2472563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985157.1|2472586_2472790_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000153707.1|2472786_2473053_+	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	77.3	3.1e-31
WP_000104308.1|2473049_2473349_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	88.9	1.4e-40
WP_001310326.1|2473360_2473978_+	ash family protein	NA	K7PLX4	Enterobacteria_phage	51.1	2.2e-11
WP_000564228.1|2473974_2474364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001001609.1|2474360_2477201_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	90.1	0.0e+00
WP_000708312.1|2477277_2478237_+	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	98.4	1.5e-176
WP_000211267.1|2478241_2478553_+	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	83.5	2.2e-41
WP_001594304.1|2478917_2479187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000087812.1|2479674_2480721_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	100.0	1.5e-206
WP_000613768.1|2480720_2482472_-	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	99.8	0.0e+00
WP_001262673.1|2482626_2483463_+|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	100.0	2.7e-150
WP_001055117.1|2483485_2484538_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	99.7	2.6e-198
WP_000632347.1|2484583_2485384_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	92.5	1.6e-131
WP_000063103.1|2485485_2485980_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	99.4	1.2e-89
WP_000864901.1|2485979_2486180_+|tail	tail protein X	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_000104350.1|2486182_2486506_+|holin	phage holin family protein	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_000072327.1|2486502_2486895_+	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	100.0	5.8e-71
WP_000780572.1|2486891_2487299_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	99.3	9.0e-67
WP_000920579.1|2487436_2487904_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	98.1	9.3e-84
WP_000356344.1|2487896_2488532_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.5	2.4e-114
WP_001449632.1|2488543_2489110_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	95.7	4.7e-98
WP_001067548.1|2489127_2489457_+	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	100.0	2.2e-55
WP_001111970.1|2489460_2490357_+|plate	baseplate J/gp47 family protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.3	7.4e-154
WP_000071724.1|2490349_2490958_+|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	74.9	1.5e-86
WP_000217007.1|2490954_2492589_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	57.0	3.7e-143
WP_000368062.1|2492588_2493191_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	89.5	6.2e-96
WP_001008232.1|2493162_2493606_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	99.3	6.3e-82
WP_001743818.1|2493626_2494037_-	hypothetical protein	NA	A0A0F7LBW5	Escherichia_phage	98.4	7.7e-66
WP_000905082.1|2494067_2494667_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	82.2	8.9e-87
WP_000979945.1|2494693_2495182_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	1.4e-85
WP_000853421.1|2495194_2498002_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	95.6	0.0e+00
WP_000333495.1|2497988_2498144_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	100.0	8.8e-23
WP_000665308.1|2498152_2498518_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	97.5	3.8e-56
WP_000290466.1|2498572_2499085_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	96.5	3.3e-90
WP_000005394.1|2499084_2500269_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	99.2	3.6e-225
WP_000132850.1|2500426_2501536_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	93.0	1.1e-191
WP_000069998.1|2501688_2502294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302981.1|2502454_2502715_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000078916.1|2502905_2503046_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
WP_001229265.1|2503351_2503651_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
2503310:2503334	attR	AAAGAAAAAAGGCCGCAGAGCGGCC	NA	NA	NA	NA
WP_000672328.1|2503655_2506043_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_000018588.1|2506057_2507041_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.1e-33
WP_001386830.1|2507323_2507368_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000124850.1|2507490_2507847_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001124225.1|2507899_2508097_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001700733.1|2508193_2508736_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001144201.1|2508739_2510668_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.1	9.4e-130
>prophage 11
NZ_CP016625	Escherichia coli O157:H7 strain FRIK944 chromosome, complete genome	5770602	2670377	2722812	5770602	integrase,tRNA,tail,transposase	Enterobacteria_phage(58.06%)	60	2663601:2663616	2722891:2722906
2663601:2663616	attL	TCAGCCAGAAGCGCAG	NA	NA	NA	NA
WP_001025318.1|2670377_2672111_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	4.0e-87
WP_001302043.1|2672287_2672776_+	lysozyme inhibitor LprI family protein	NA	NA	NA	NA	NA
WP_001259575.1|2672895_2673288_-	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_000067016.1|2673287_2675366_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_001278932.1|2675358_2676507_-	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_000983602.1|2676708_2677353_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_000763867.1|2677363_2677753_-	chemotaxis response regulator CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000036370.1|2677767_2678817_-	protein-glutamate methylesterase/protein glutamine deamidase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000204340.1|2678819_2679680_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000483251.1|2679698_2681300_-	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.8	5.4e-14
WP_001302081.1|2681345_2683007_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	38.4	5.8e-11
WP_000147302.1|2683149_2683653_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_001322280.1|2683673_2685638_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_000795630.1|2685642_2686569_-	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_000906325.1|2686565_2687453_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_001291603.1|2687579_2688158_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_001302091.1|2688160_2688511_-	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_000122432.1|2689290_2689719_+	universal stress protein UspC	NA	NA	NA	NA	NA
WP_001295646.1|2689725_2691150_-	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_001302045.1|2691124_2691925_-	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_001302082.1|2692091_2693078_-	arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_001187819.1|2693092_2694607_-	arabinose ABC transporter ATP binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	4.3e-13
WP_000548680.1|2694676_2695666_-	arabinose ABC transporter substrate-binding protein AraF	NA	NA	NA	NA	NA
WP_000179469.1|2696462_2696966_+	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_000084172.1|2697045_2697297_-	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_010723106.1|2697411_2697498_-	stress response protein AzuC	NA	NA	NA	NA	NA
WP_001237873.1|2697759_2698083_+	YecR-like lipofamily protein	NA	NA	NA	NA	NA
WP_000917208.1|2698253_2698751_+	non-heme ferritin	NA	NA	NA	NA	NA
WP_000377224.1|2698787_2699027_-	YecH family protein	NA	NA	NA	NA	NA
WP_000797566.1|2699218_2700430_+	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_000847882.1|2700491_2701157_-	UPF0149 family protein YecA	NA	NA	NA	NA	NA
WP_001303019.1|2701513_2702515_-|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	59.1	3.5e-104
WP_000865208.1|2702520_2702868_-	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_000290345.1|2702897_2703548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000786773.1|2703563_2703968_-	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	2.7e-23
WP_001673482.1|2704057_2704195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000014504.1|2704266_2704470_+	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_000739029.1|2704491_2704842_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	8.6e-50
WP_000159449.1|2704852_2705131_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	80.4	4.8e-35
WP_000514287.1|2705142_2705385_+	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	1.2e-37
WP_000021655.1|2705381_2705495_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	6.2e-10
WP_000991913.1|2705587_2706004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985157.1|2706027_2706231_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000153707.1|2706227_2706494_+	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	77.3	3.1e-31
WP_000104305.1|2706490_2706790_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	89.9	1.6e-41
WP_001310314.1|2706801_2707419_+	ash family protein	NA	S5MQL6	Escherichia_phage	46.2	2.1e-06
WP_000599379.1|2707415_2707781_+	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	6.6e-61
WP_000123463.1|2707787_2710610_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	97.7	0.0e+00
WP_000686523.1|2710686_2711646_+	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	1.2e-178
WP_000211280.1|2711650_2711965_+	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	52.9	1.1e-19
WP_001310336.1|2713056_2713587_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	88.0	3.5e-87
WP_000954203.1|2713630_2714203_-	serine acetyltransferase	NA	A0A1L2JYI5	Streptococcus_phage	34.4	1.0e-07
WP_000979955.1|2714359_2714848_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.0e-85
WP_000333495.1|2717650_2717806_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	100.0	8.8e-23
WP_000665314.1|2717814_2718180_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	98.3	1.7e-56
WP_000290456.1|2718234_2718747_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	99.4	2.1e-92
WP_072141434.1|2718746_2718926_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	88.1	9.8e-26
WP_162829202.1|2718982_2720195_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000132765.1|2721401_2721725_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	97.8	2.1e-42
WP_032161583.1|2721675_2722812_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
2722891:2722906	attR	TCAGCCAGAAGCGCAG	NA	NA	NA	NA
>prophage 12
NZ_CP016625	Escherichia coli O157:H7 strain FRIK944 chromosome, complete genome	5770602	2780396	2848808	5770602	integrase,head,tail,holin,portal,capsid,terminase,transposase	Escherichia_phage(33.33%)	67	2803066:2803125	2826320:2827629
WP_001023396.1|2780396_2780666_-|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_000268854.1|2780667_2781837_-|tail	phage tail protein	tail	B6DZB7	Enterobacteria_phage	96.9	1.1e-83
WP_001230509.1|2781901_2782501_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.5	3.3e-110
WP_015994252.1|2782568_2786048_-	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	100.0	0.0e+00
WP_149025381.1|2786308_2786941_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	98.6	2.5e-103
WP_000194760.1|2786886_2787630_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.6	2.4e-150
WP_001302968.1|2787640_2788339_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	2.9e-129
WP_000847298.1|2788338_2788668_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000082473.1|2788664_2791244_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	79.9	0.0e+00
WP_000533402.1|2791224_2791638_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479117.1|2791664_2792096_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_029208397.1|2792109_2792850_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_001301534.1|2792831_2793098_-|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_000256723.1|2793155_2793503_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001254002.1|2793539_2795045_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000831796.1|2795034_2796627_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_000259002.1|2796623_2796830_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000235436.1|2798714_2799224_-|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001299328.1|2799618_2799843_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.7	4.1e-21
WP_001302690.1|2799924_2800239_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208680.1|2800765_2800951_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001280929.1|2801178_2801310_-	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	88.4	9.4e-10
WP_001303555.1|2801322_2801505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000992126.1|2801660_2802194_-	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	97.7	1.4e-99
WP_000731204.1|2802244_2802589_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	99.1	1.7e-58
WP_024165672.1|2802593_2802809_-|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	98.6	7.7e-33
2803066:2803125	attL	TGAACCGCCCCGGAAATCCTGGAGACTAAACTCCCTGAGAAAGAGGTAAACAGGATGACT	NA	NA	NA	NA
WP_162829202.1|2803119_2804332_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000023257.1|2804414_2806265_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.4	0.0e+00
WP_001059369.1|2807804_2808494_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	1.5e-58
WP_000904141.1|2808490_2808850_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.9	1.5e-36
WP_001265075.1|2808862_2809912_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.3e-109
WP_001310296.1|2809913_2810192_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	1.3e-11
WP_000902687.1|2810359_2810572_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	7.6e-25
WP_001278460.1|2810758_2810863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000137954.1|2810972_2811536_-	hypothetical protein	NA	H6WZG0	Escherichia_phage	94.9	4.5e-48
WP_000111243.1|2811662_2811974_-	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	2.4e-51
WP_001414276.1|2811970_2812123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001290006.1|2812155_2812512_-	hypothetical protein	NA	A0A222YY85	Escherichia_phage	65.8	3.1e-15
WP_000702797.1|2812508_2812733_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	42.3	3.6e-09
WP_000450610.1|2812754_2813453_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	59.5	1.6e-71
WP_072143023.1|2813487_2814030_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	96.7	6.4e-84
WP_001262409.1|2813941_2814979_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	68.3	1.1e-87
WP_000693816.1|2815047_2815473_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001261752.1|2815469_2815697_-	cell division protein	NA	NA	NA	NA	NA
WP_000444607.1|2815794_2816439_+	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	24.9	2.8e-06
WP_000367376.1|2816713_2816866_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	8.7e-07
WP_000449168.1|2817346_2817535_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199485.1|2817531_2817720_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000034457.1|2817815_2820287_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000094838.1|2820345_2820549_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000533600.1|2820548_2821571_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.4	2.0e-99
WP_001302302.1|2821806_2822604_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_162829202.1|2825111_2826325_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000480501.1|2832650_2833703_-	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
2826320:2827629	attR	AGTCATCCTGTTTACCTCTTTCTCAGGGAGTTTAGTCTCCAGGATTTCCGGGGCGGTTCAGAGAGATGAAAATGACAAACCTGTTAAGGAGCAAAAACAGCAACTGAATACCGCAGTCAGCATCGACAACGTGAAACCTGGTGTCACTACAGACTGGAAAGAAACCGCAGATGGCGTCTATAAGGCAACCTATACCGCCTATACCAAAGGCAGTGGGCTTACTGCGAAGCTGTTAATGCAAAACTGGAATGAAGATTTGCATACCGCTGGATTTATCATCGACGCCAACCCGCAGTCAGCGAAAATTGCGACATTATCTGCCAGCAATAATGGTGTGCTCGCCAATGAGAATGCAGCAAACACCGTCTCGGTCAATGTCGCTGATGAAGGAAGCAACCCAATCAATGATCATACCGTCACGTTTGCGGTATTAAGCGGATCGGCAACTTCCTTTAACAATCAAAACACCGCAAAAACGGATGTTAATGGTCTGGCGACTTTTGATCTGAAAAGTAGTAAGCAGGAAGACAACACGGTTGAAGTCACCCTTGAAAATGGCGTGAAACAAACGTTAATCGTCAGTTTTGTCGGCGACTCGAGTACCGCGCAGGTTGATCTGCAGAAGTCGAAAAATGAAGTGGTCGCTGACGGCAATGACAGTGCCACAATGACCGCGACAGTTCGGGATGCAAAAGGCAACCTGCTCAATGACGTCAAGGTCACCTTCAATGTCAATTCAGCAGCAGCGAAACTGAGCCAAACCGAAGTGAATAGCCACGACGGGATCGCCACAGCTACGCTGACCAGTTTGAAAAATGGTGATTATACGGTTACGGCCTCTGTGAGCTCTGGTTCTCAGGCTAATCAACAGGTGATTTTTATCGGTGATCAAAGTACTGCTGCCCTGACCCTCAGTGTGCCTTCAGGTGATATCACCGTCACCAACACAGCTCCGCTACATATGACTGCAACCTTGCAGGATAAAAATGGCAATCCACTAAAAGATAAAGAAATCACCTTCTCTGTGCCAAACGACGTCGCAAGTCGGTTCTCGATTAGCAACAGCGGAAAAGGCATGACGGATAGCAACGGGACTGCAATCGCCTCCCTGACCGGCACGTTAGCGGGCACGCATATGATCACGGCTCGTCTGGCTAACAGCAATGTCAGCGATACACAGCCAATGACGTTTGTGGCGGATAAAGACAGAGCGGTTGTCGTTCTGCAAACATCGAAAGCGGAAATCATTGGGAATGGCGTGGATGAGACGACTCTGACAGCAACAGTTAAAGATCCTTTTGATAACGTGG	NA	NA	NA	NA
WP_000378596.1|2834016_2835333_+	shikimate transporter	NA	NA	NA	NA	NA
WP_001060244.1|2835434_2836889_+	AMP nucleosidase	NA	NA	NA	NA	NA
WP_000532909.1|2837231_2837948_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_122989775.1|2838573_2840217_-	toxic metabolite efflux MATE transporter YeeO	NA	NA	NA	NA	NA
WP_001011000.1|2840334_2841285_-	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_001011474.1|2841386_2842304_-	nitrogen assimilation transcriptional regulator NAC	NA	NA	NA	NA	NA
WP_000986334.1|2842760_2843696_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001193830.1|2843757_2844837_-	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001295633.1|2844848_2845592_-	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_000973176.1|2845588_2846134_-	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_001171554.1|2846495_2846876_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|2846872_2847220_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|2847269_2848808_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
>prophage 13
NZ_CP016625	Escherichia coli O157:H7 strain FRIK944 chromosome, complete genome	5770602	2852774	2925869	5770602	integrase,head,tail,protease,lysis,holin,portal,capsid,terminase,transposase	Stx2-converting_phage(52.38%)	97	2869082:2869096	2933012:2933026
WP_162829204.1|2852774_2853987_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	97.6	8.2e-164
WP_000638172.1|2853971_2854853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000203545.1|2854849_2855755_+	chemotaxis protein	NA	NA	NA	NA	NA
WP_000102660.1|2855751_2856822_+	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_000775497.1|2856957_2857641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000846711.1|2857656_2858067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001234544.1|2858287_2859109_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.5	3.6e-46
WP_000860079.1|2859190_2859670_+	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.8	6.8e-13
WP_001186192.1|2859684_2860161_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692323.1|2860223_2860445_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
WP_001285587.1|2860518_2860887_+	type IV toxin-antitoxin system toxin CbtA	NA	NA	NA	NA	NA
WP_000988600.1|2861345_2861540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001304123.1|2861552_2861666_+	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_001016346.1|2862154_2862337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000450409.1|2862437_2862767_-	DUF496 family protein	NA	NA	NA	NA	NA
WP_001202488.1|2862938_2863997_-	FUSC family protein	NA	NA	NA	NA	NA
WP_001105393.1|2864195_2864669_-	DNA gyrase inhibitor SbmC	NA	NA	NA	NA	NA
WP_001303036.1|2864787_2865954_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.7	4.5e-228
WP_001121226.1|2867277_2867928_+	type III secretion system effector NleG7	NA	B6ETE1	Enterobacteria_phage	99.5	4.1e-122
WP_000491542.1|2868152_2869028_-	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	100.0	1.5e-162
2869082:2869096	attL	TAAACCTGTCTGAAC	NA	NA	NA	NA
WP_001023452.1|2869168_2869438_-|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	100.0	6.4e-45
WP_000268993.1|2869439_2870753_-|tail	phage tail protein	tail	A0A0P0ZCC1	Stx2-converting_phage	100.0	2.8e-85
WP_001230314.1|2870817_2871417_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZBV0	Stx2-converting_phage	100.0	1.8e-111
WP_065763506.1|2871483_2874963_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	99.7	0.0e+00
WP_149025382.1|2875222_2875855_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	99.0	4.9e-104
WP_000967271.1|2875800_2876538_-|tail	phage tail protein	tail	B6ETG2	Enterobacteria_phage	100.0	8.2e-151
WP_001416667.1|2876591_2877515_-	phage antirepressor Ant	NA	A0A0P0ZBT0	Stx2-converting_phage	100.0	7.6e-178
WP_001154345.1|2877585_2877759_-	Arc family DNA-binding protein	NA	A0A0P0ZC65	Stx2-converting_phage	100.0	3.4e-23
WP_001302649.1|2877866_2878187_+	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	100.0	3.0e-49
WP_065763507.1|2878203_2878902_-|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	99.1	7.3e-133
WP_000807954.1|2878901_2879243_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_000212827.1|2879235_2882478_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	100.0	0.0e+00
WP_001453746.1|2882525_2882735_-	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	100.0	2.6e-33
WP_000710952.1|2882830_2883205_-|tail	phage tail assembly chaperone	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001275464.1|2883219_2883936_-	immunoglobulin domain-containing protein	NA	B6DZA6	Enterobacteria_phage	100.0	1.2e-127
WP_000133388.1|2884001_2884346_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|2884342_2884789_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007905.1|2884785_2885136_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125984.1|2885146_2885473_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_015994249.1|2885469_2888055_-|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	100.0	0.0e+00
WP_001063099.1|2888000_2888222_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000172999.1|2888266_2890204_-|capsid	phage major capsid protein	capsid	B6DZ99	Enterobacteria_phage	100.0	0.0e+00
WP_162829202.1|2891356_2892569_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000958396.1|2893238_2893802_-|terminase	terminase small subunit	terminase	A0A0P0ZCQ9	Stx2-converting_phage	100.0	2.8e-90
WP_001303046.1|2894093_2894459_-	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	100.0	2.0e-65
WP_000095749.1|2894500_2894728_+	DUF3950 domain-containing protein	NA	A0A0P0ZCA1	Stx2-converting_phage	100.0	3.9e-35
WP_001283921.1|2895190_2895448_-	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	100.0	5.0e-39
WP_000839224.1|2895444_2895942_-	KilA-N domain-containing protein	NA	A0A0P0ZBU2	Stx2-converting_phage	100.0	3.6e-94
WP_000092318.1|2896144_2896582_-|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	100.0	2.0e-72
WP_000075132.1|2896578_2897076_-	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_000284515.1|2897075_2897291_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.0e-33
WP_001290231.1|2897367_2897640_-	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000143458.1|2897680_2897860_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_000143113.1|2897996_2899934_-	SASA family carbohydrate esterase	NA	A0A0P0ZBP4	Stx2-converting_phage	100.0	0.0e+00
WP_001303568.1|2900177_2900501_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	100.0	6.9e-62
WP_000738080.1|2900797_2901067_-	Shiga toxin Stx2c subunit B	NA	Q5TJL5	Enterobacteria_phage	100.0	2.1e-43
WP_000649751.1|2901078_2902038_-	Shiga toxin Stx2c subunit A	NA	Q5TJL6	Enterobacteria_phage	100.0	4.3e-176
WP_000512807.1|2902687_2903176_-	late gene antiterminator protein	NA	Q5TJL7	Enterobacteria_phage	100.0	7.0e-90
WP_001028858.1|2903166_2903838_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	100.0	2.4e-133
WP_001108004.1|2903834_2904440_-	recombination protein NinG	NA	Q5TJL9	Enterobacteria_phage	100.0	3.3e-97
WP_001004016.1|2904439_2905162_-	phage antirepressor KilAC domain-containing protein	NA	A0A0P0ZCB2	Stx2-converting_phage	100.0	6.0e-130
WP_000208500.1|2905236_2906001_-	phage antirepressor Ant	NA	A0A0P0ZB11	Stx2-converting_phage	100.0	1.4e-121
WP_001254256.1|2906275_2906458_-	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
WP_000153268.1|2906454_2906982_-	phage N-6-adenine-methyltransferase	NA	Q9EYC2	Enterobacteria_phage	100.0	1.6e-100
WP_001303571.1|2906978_2907425_-	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	100.0	2.4e-81
WP_001449504.1|2907381_2907618_-	restriction alleviation protein, Lar family	NA	Q687G3	Enterobacteria_phage	100.0	9.3e-40
WP_000103678.1|2907628_2907844_-	hypothetical protein	NA	A0A0N7KZ98	Stx2-converting_phage	100.0	7.7e-33
WP_000344569.1|2907976_2908309_-	hypothetical protein	NA	A0A0P0ZCF4	Stx2-converting_phage	100.0	3.3e-59
WP_001220560.1|2908772_2909384_-	HNH endonuclease	NA	A0A0P0ZBS0	Stx2-converting_phage	100.0	5.6e-113
WP_000998048.1|2909472_2911011_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|2911060_2911408_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|2911404_2911785_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_001248388.1|2911912_2913289_-	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	100.0	5.7e-254
WP_000539354.1|2913285_2914107_-	replication protein	NA	A0A0N7KZ97	Stx2-converting_phage	100.0	2.0e-153
WP_000166961.1|2914093_2914255_-	hypothetical protein	NA	Q76H53	Enterobacteria_phage	100.0	1.3e-21
WP_000442612.1|2914287_2914584_-	hypothetical protein	NA	A4KWW1	Enterobacteria_phage	100.0	4.0e-48
WP_000067727.1|2914725_2914941_-	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_001302016.1|2915015_2915711_+	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	100.0	8.6e-134
WP_001130059.1|2916212_2916734_+	hypothetical protein	NA	A0A0N7BTU4	Escherichia_phage	100.0	1.8e-88
WP_000438343.1|2917302_2917485_+	hypothetical protein	NA	A0A0N7C057	Escherichia_phage	100.0	2.8e-28
WP_000088203.1|2917462_2917735_+	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	100.0	5.7e-41
WP_000394301.1|2917793_2918054_+	hypothetical protein	NA	A0A0P0ZC97	Stx2-converting_phage	100.0	1.1e-44
WP_000065362.1|2918236_2918605_+	DUF2528 family protein	NA	A0A0N7C1W2	Escherichia_phage	100.0	2.0e-65
WP_001198861.1|2918677_2918842_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000372937.1|2918810_2918954_+	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_000995486.1|2919028_2919325_+	host-nuclease inhibitor protein Gam	NA	A0A0N7BTR9	Escherichia_phage	100.0	3.3e-50
WP_001302855.1|2919330_2920116_+	phage recombination protein Bet	NA	A0A0N7BTT9	Escherichia_phage	100.0	6.3e-149
WP_000186848.1|2920112_2920793_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	100.0	1.6e-132
WP_000682306.1|2920789_2920972_+	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	100.0	4.3e-29
WP_000548528.1|2920944_2921136_+	DUF1382 family protein	NA	A0A0P0ZC60	Stx2-converting_phage	100.0	5.6e-27
WP_000188870.1|2921212_2921428_+	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	100.0	1.0e-32
WP_000763383.1|2921526_2921748_+	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001289930.1|2921744_2922692_+	ead/Ea22-like family protein	NA	A0A0P0ZBW7	Stx2-converting_phage	100.0	4.7e-183
WP_000610373.1|2923558_2923909_+	DUF551 domain-containing protein	NA	A0A0N7KZ94	Stx2-converting_phage	100.0	7.8e-67
WP_001281188.1|2924096_2924441_+	hypothetical protein	NA	A0A0P0ZB93	Stx2-converting_phage	100.0	9.0e-60
WP_000132739.1|2924518_2924710_+	AlpA family phage regulatory protein	NA	A0A0P0ZBL0	Stx2-converting_phage	100.0	1.7e-31
WP_001007946.1|2924690_2925869_-|integrase	site-specific integrase	integrase	A0A0P0ZCE7	Stx2-converting_phage	100.0	1.1e-232
2933012:2933026	attR	GTTCAGACAGGTTTA	NA	NA	NA	NA
>prophage 14
NZ_CP016625	Escherichia coli O157:H7 strain FRIK944 chromosome, complete genome	5770602	3009093	3046344	5770602	plate,integrase,head,tRNA,tail,lysis,holin,portal,capsid,terminase	Escherichia_phage(40.82%)	52	3013393:3013420	3044537:3044564
WP_000675144.1|3009093_3010497_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.4	1.2e-33
WP_000137884.1|3010493_3011216_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	2.9e-31
WP_001301848.1|3011406_3011739_+	YegP family protein	NA	NA	NA	NA	NA
WP_000476014.1|3011886_3013248_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
3013393:3013420	attL	AATCTCCCTTACACGGGCTTATTTTTTA	NA	NA	NA	NA
WP_000468308.1|3013522_3013741_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000882987.1|3013822_3014986_-	phage late control D family protein	NA	A0A0F7LDZ2	Escherichia_phage	98.7	3.5e-204
WP_000978915.1|3014985_3015465_-|tail	phage tail protein	tail	Q7Y4C7	Escherichia_virus	99.4	1.5e-84
WP_000069920.1|3015479_3017927_-|tail	phage tail tape measure protein	tail	Q7Y4C8	Escherichia_virus	95.7	0.0e+00
WP_000785970.1|3017919_3018039_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001031307.1|3018071_3018347_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	98.9	2.2e-40
WP_001251408.1|3018403_3018922_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001286714.1|3018934_3020125_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.0	1.5e-223
WP_000905091.1|3020184_3020778_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	97.0	1.3e-103
WP_001145598.1|3020808_3021297_+|tail	tail fiber protein	tail	M1TAS6	Escherichia_phage	99.3	3.7e-83
WP_000368070.1|3021296_3021899_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	98.5	5.9e-107
WP_001008242.1|3021870_3022314_-|tail	tail fiber assembly protein	tail	M1SNQ2	Escherichia_phage	97.3	1.6e-80
WP_000216996.1|3022334_3023756_-|tail	phage tail protein	tail	A0A0F7LBW5	Escherichia_phage	80.1	1.5e-196
WP_001285344.1|3023752_3024364_-|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.5	4.9e-117
WP_001121492.1|3024356_3025265_-|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.0	8.3e-161
WP_000127172.1|3025269_3025617_-	GPW/gp25 family protein	NA	A0A0F7L9X3	Escherichia_phage	99.1	8.5e-58
WP_001093756.1|3025613_3026249_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.6	4.5e-113
WP_001001774.1|3026315_3026768_-	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	99.3	1.4e-76
WP_000917172.1|3026760_3027228_-|tail	phage tail protein	tail	U5N0S7	Enterobacteria_phage	97.4	7.4e-81
WP_001300730.1|3027190_3027364_-	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	94.7	5.2e-24
WP_000040660.1|3027335_3027761_-|lysis	LysB family phage lysis regulatory protein	lysis	Q858W0	Yersinia_virus	97.2	1.8e-65
WP_000736588.1|3027748_3028174_-	hypothetical protein	NA	A0A0F7LBP4	Escherichia_phage	94.3	2.1e-58
WP_001144113.1|3028188_3028686_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	99.4	2.6e-92
WP_000123125.1|3028685_3028967_-|holin	phage holin family protein	holin	A0A0F7LA12	Escherichia_phage	98.9	6.3e-43
WP_000846399.1|3028970_3029174_-|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
WP_000988633.1|3029173_3029683_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_000203439.1|3029782_3030526_-|terminase	terminase endonuclease subunit	terminase	Q94MK6	Enterobacteria_phage	98.4	8.6e-124
WP_001248573.1|3030529_3031603_-|capsid	phage major capsid protein, P2 family	capsid	Q778Y7	Enterobacteria_phage	99.7	6.7e-202
WP_001085969.1|3031657_3032512_-|capsid	GPO family capsid scaffolding protein	capsid	Q94MI4	Enterobacteria_phage	95.8	5.8e-132
WP_000156861.1|3032685_3034458_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.8	0.0e+00
WP_000038195.1|3034457_3035492_+|portal	phage portal protein	portal	Q858W8	Yersinia_virus	96.2	4.5e-195
WP_001177885.1|3035704_3035974_+	hypothetical protein	NA	Q2P9X2	Enterobacteria_phage	89.9	3.8e-29
WP_000042038.1|3036197_3036635_+	hypothetical protein	NA	S4TUD6	Salmonella_phage	92.3	1.6e-69
WP_000746343.1|3036759_3037710_-	RNA-directed DNA polymerase	NA	E5E3S8	Burkholderia_phage	40.0	3.8e-39
WP_001310277.1|3037687_3037996_-	helix-turn-helix transcriptional regulator	NA	E5E3S9	Burkholderia_phage	40.2	1.7e-12
WP_001302990.1|3038032_3038188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000268557.1|3038596_3040885_-	replication endonuclease	NA	Q858T4	Yersinia_virus	97.6	0.0e+00
WP_000027665.1|3040874_3041150_-	DUF5405 family protein	NA	M1TAP2	Escherichia_phage	98.9	6.6e-45
WP_001113260.1|3041146_3041371_-	TraR/DksA C4-type zinc finger protein	NA	S4TRY6	Salmonella_phage	98.6	5.5e-34
WP_001277943.1|3041370_3041673_-	DUF5405 family protein	NA	U5N0U2	Enterobacteria_phage	95.0	1.9e-45
WP_000557701.1|3041672_3041897_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	98.6	3.0e-32
WP_000217679.1|3041960_3042461_-	hypothetical protein	NA	S4TTB7	Salmonella_phage	100.0	1.0e-91
WP_001005166.1|3042457_3042628_-	hypothetical protein	NA	S4TNZ7	Salmonella_phage	98.2	6.7e-24
WP_000043869.1|3042638_3042914_-	regulatory phage cox family protein	NA	Q1JS62	Enterobacteria_phage	100.0	1.3e-48
WP_001306384.1|3043028_3043328_+	helix-turn-helix transcriptional regulator	NA	Q1JS63	Enterobacteria_phage	100.0	2.5e-50
WP_000985261.1|3043443_3044457_+|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.1	4.1e-193
WP_001303579.1|3044721_3045039_-	hypothetical protein	NA	NA	NA	NA	NA
3044537:3044564	attR	AATCTCCCTTACACGGGCTTATTTTTTA	NA	NA	NA	NA
WP_000807362.1|3045444_3046344_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
>prophage 15
NZ_CP016625	Escherichia coli O157:H7 strain FRIK944 chromosome, complete genome	5770602	3071975	3212645	5770602	integrase,head,tRNA,tail,protease,holin,capsid,terminase,transposase	Enterobacteria_phage(37.68%)	157	3137975:3137990	3203670:3203685
WP_001301615.1|3071975_3074009_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.4e-54
WP_000356841.1|3080965_3084595_+	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_000636932.1|3084656_3084974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302026.1|3086214_3087303_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_001294377.1|3087313_3088843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000528951.1|3088861_3089593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302810.1|3089585_3090722_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	100.0	1.9e-167
WP_001087225.1|3090718_3092722_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	100.0	0.0e+00
WP_001171554.1|3093105_3093486_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|3093482_3093830_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|3093879_3095418_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_001295430.1|3095799_3096270_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|3096316_3097036_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001301761.1|3097032_3098718_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	100.0	1.7e-305
WP_001261939.1|3099232_3099481_+	DinI-like family protein	NA	B6DZC1	Enterobacteria_phage	100.0	1.4e-38
WP_001143784.1|3099642_3100284_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
WP_072142879.1|3100365_3100782_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	100.0	2.2e-76
WP_001023396.1|3100942_3101212_-|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_000268879.1|3101213_3102383_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	B6DZB7	Enterobacteria_phage	100.0	4.3e-85
WP_001230508.1|3102447_3103047_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_015994252.1|3103114_3106594_-	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	100.0	0.0e+00
WP_149025382.1|3106853_3107486_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	99.0	4.9e-104
WP_000967271.1|3107431_3108169_-|tail	phage tail protein	tail	B6ETG2	Enterobacteria_phage	100.0	8.2e-151
WP_001416667.1|3108222_3109146_-	phage antirepressor Ant	NA	A0A0P0ZBT0	Stx2-converting_phage	100.0	7.6e-178
WP_001154345.1|3109216_3109390_-	Arc family DNA-binding protein	NA	A0A0P0ZC65	Stx2-converting_phage	100.0	3.4e-23
WP_001302649.1|3109497_3109818_+	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	100.0	3.0e-49
WP_001152183.1|3109834_3110533_-|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	100.0	6.6e-134
WP_000807954.1|3110532_3110874_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_000212827.1|3110866_3114109_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	100.0	0.0e+00
WP_001453746.1|3114156_3114366_-	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	100.0	2.6e-33
WP_000710952.1|3114461_3114836_-|tail	phage tail assembly chaperone	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001275464.1|3114850_3115567_-	immunoglobulin domain-containing protein	NA	B6DZA6	Enterobacteria_phage	100.0	1.2e-127
WP_000133388.1|3115632_3115977_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|3115973_3116420_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007905.1|3116416_3116767_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125984.1|3116777_3117104_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001063099.1|3119625_3119847_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000172999.1|3119891_3121829_-|capsid	phage major capsid protein	capsid	B6DZ99	Enterobacteria_phage	100.0	0.0e+00
WP_001301491.1|3121892_3123554_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000958387.1|3123550_3124114_-|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
WP_001303046.1|3124402_3124768_-	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	100.0	2.0e-65
WP_000074669.1|3124809_3125034_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.5	2.7e-20
WP_001303878.1|3125115_3125430_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208680.1|3125956_3126142_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_000075112.1|3126358_3126856_-	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	99.4	9.9e-92
WP_024164617.1|3126855_3127071_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	7.7e-33
WP_024748518.1|3127509_3129360_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	99.2	0.0e+00
WP_000483497.1|3129851_3130910_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	99.1	2.3e-207
WP_000917735.1|3131060_3131258_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.8e-28
WP_000762904.1|3131484_3132306_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.2	1.2e-81
WP_000904137.1|3132302_3132677_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.4e-34
WP_001304183.1|3133740_3134019_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.1e-10
WP_000998188.1|3134084_3134252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000967408.1|3134548_3134761_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	94.3	1.1e-26
WP_001278450.1|3134949_3135054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000610379.1|3135169_3135532_-	DUF551 domain-containing protein	NA	A0A0P0ZCX1	Stx2-converting_phage	98.3	8.6e-69
WP_000137941.1|3135528_3135900_-	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	78.0	1.3e-48
WP_000063625.1|3135935_3136148_-	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	87.1	1.4e-31
WP_001302146.1|3136196_3136553_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	94.9	3.7e-56
WP_001118161.1|3136609_3137005_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	1.0e-30
WP_000450888.1|3137020_3137791_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	66.0	3.8e-82
WP_000790456.1|3137820_3138561_-	ATP-binding protein	NA	V5UQI5	Shigella_phage	85.6	7.8e-117
3137975:3137990	attL	AACGATGCCGTTCTGC	NA	NA	NA	NA
WP_000095667.1|3138567_3139521_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	51.7	5.2e-73
WP_000693888.1|3139543_3139969_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_024213789.1|3139952_3140228_-	helix-turn-helix domain-containing protein	NA	A0A0M4QX15	Salmonella_phage	54.8	1.1e-15
WP_000367559.1|3140330_3140720_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000380314.1|3140889_3141042_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	2.5e-06
WP_000450222.1|3141529_3141718_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000092782.1|3141714_3141903_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000102181.1|3141995_3144440_+	exonuclease	NA	V5UQJ3	Shigella_phage	58.5	2.2e-176
WP_000113189.1|3144504_3144753_+	excisionase	NA	NA	NA	NA	NA
WP_001500821.1|3144730_3145861_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	50.9	4.9e-102
WP_001144877.1|3149316_3149907_-	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_001303944.1|3150090_3150738_+	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001414184.1|3150874_3151021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303943.1|3151448_3151727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171554.1|3152066_3152447_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|3152443_3152791_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|3152840_3154379_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_001025672.1|3157043_3158369_+	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	81.2	1.9e-214
WP_001023474.1|3159395_3159665_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1U9AJC2	Stx1_converting_phage	98.9	3.2e-44
WP_024748516.1|3159666_3160980_-|tail	phage tail protein	tail	A0A0P0ZE15	Stx2-converting_phage	98.2	7.2e-81
WP_001228304.1|3161131_3161731_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	96.5	1.6e-107
WP_129137390.1|3161798_3164144_-	host specificity protein J	NA	Q9EYE7	Enterobacteria_phage	99.7	0.0e+00
WP_001304109.1|3164095_3165271_-	host specificity protein J	NA	Q9EYE6	Enterobacteria_phage	96.9	1.2e-228
WP_050439450.1|3165613_3166246_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.1	3.9e-101
WP_046671488.1|3166191_3166935_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	98.4	7.7e-149
WP_001179515.1|3166945_3167644_-|tail	phage minor tail protein L	tail	A0A0P0ZD77	Stx2-converting_phage	100.0	6.6e-134
WP_000807954.1|3167643_3167985_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_065763508.1|3167977_3171220_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	99.7	0.0e+00
WP_001453746.1|3171267_3171477_-	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	100.0	2.6e-33
WP_000710952.1|3171572_3171947_-|tail	phage tail assembly chaperone	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001275464.1|3171961_3172678_-	immunoglobulin domain-containing protein	NA	B6DZA6	Enterobacteria_phage	100.0	1.2e-127
WP_000133388.1|3172743_3173088_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|3173084_3173531_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007905.1|3173527_3173878_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125984.1|3173888_3174215_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_149025379.1|3176741_3176891_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	9.1e-17
WP_000172999.1|3177006_3178944_-|capsid	phage major capsid protein	capsid	B6DZ99	Enterobacteria_phage	100.0	0.0e+00
WP_001303049.1|3179007_3180669_-|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	99.8	0.0e+00
WP_001303051.1|3180665_3181229_-|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	99.5	2.8e-90
WP_015994246.1|3181518_3181884_-	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	100.0	1.5e-65
WP_000095736.1|3181925_3182153_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_012816791.1|3182577_3182763_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|3182990_3183137_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|3183136_3183706_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992137.1|3183976_3184510_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_000731259.1|3184560_3184905_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_024164617.1|3184909_3185125_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	7.7e-33
WP_064261944.1|3185563_3187414_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	99.8	0.0e+00
WP_000752026.1|3187913_3188183_-	Shiga toxin Stx1a subunit B	NA	Q7AYI7	Enterobacteria_phage	100.0	1.6e-43
WP_000691354.1|3188192_3189140_-	Shiga toxin Stx1 subunit A	NA	Q777W4	Enterobacteria_phage	100.0	3.2e-171
WP_001204852.1|3189646_3190081_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	100.0	3.6e-82
WP_000144759.1|3190073_3190268_-	phage NinH family protein	NA	Q6H9W6	Enterobacteria_phage	100.0	8.4e-31
WP_001107998.1|3190264_3190870_-	recombination protein NinG	NA	B6DZ84	Enterobacteria_phage	100.0	6.6e-98
WP_001004018.1|3190869_3191592_-	phage antirepressor KilAC domain-containing protein	NA	B6DZ83	Enterobacteria_phage	100.0	3.5e-130
WP_000290551.1|3191666_3192344_-	phage antirepressor Ant	NA	Q4A1A4	Enterobacteria_phage	97.8	2.2e-126
WP_001254256.1|3192619_3192802_-	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
WP_000153268.1|3192798_3193326_-	phage N-6-adenine-methyltransferase	NA	Q9EYC2	Enterobacteria_phage	100.0	1.6e-100
WP_001310475.1|3193322_3193769_-	recombination protein NinB	NA	A0A1U9AJ79	Stx1_converting_phage	100.0	2.4e-81
WP_001281772.1|3193725_3193962_-	restriction alleviation protein, Lar family	NA	Q8HA09	Enterobacteria_phage	100.0	1.2e-39
WP_000103679.1|3193972_3194188_-	hypothetical protein	NA	A0A1I9LJP7	Stx_converting_phage	100.0	1.3e-32
WP_001000130.1|3194320_3194599_-	hypothetical protein	NA	Q9EYB9	Enterobacteria_phage	100.0	4.4e-49
WP_001248388.1|3194669_3196046_-	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	100.0	5.7e-254
WP_000539349.1|3196042_3196864_-	replication protein	NA	B6DZ75	Enterobacteria_phage	100.0	1.5e-153
WP_000166961.1|3196850_3197012_-	hypothetical protein	NA	Q76H53	Enterobacteria_phage	100.0	1.3e-21
WP_000438524.1|3197044_3197341_-	hypothetical protein	NA	A4KWW1	Enterobacteria_phage	98.0	4.4e-47
WP_001180318.1|3197479_3197707_-	helix-turn-helix domain-containing protein	NA	G9L677	Escherichia_phage	100.0	7.8e-36
WP_000250473.1|3197785_3198493_+	helix-turn-helix transcriptional regulator	NA	G9L676	Escherichia_phage	100.0	1.5e-133
WP_000885203.1|3198553_3198895_+	DUF3024 domain-containing protein	NA	A0A1I9LJN9	Stx_converting_phage	100.0	3.9e-63
WP_001221211.1|3198962_3199424_+	hypothetical protein	NA	G9L674	Escherichia_phage	100.0	1.3e-77
WP_000957426.1|3199417_3200464_+	serine/threonine protein kinase	NA	G9L673	Escherichia_phage	100.0	5.2e-207
WP_000745483.1|3200466_3200631_+	hypothetical protein	NA	G9L672	Escherichia_phage	100.0	5.1e-21
WP_000198445.1|3201119_3201503_+	hypothetical protein	NA	Q08J47	Stx2-converting_phage	100.0	3.9e-64
WP_000095081.1|3201564_3202188_+	hypothetical protein	NA	A0A2D1GLY1	Escherichia_phage	96.6	2.8e-107
WP_000065373.1|3202368_3202737_+	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	99.2	7.6e-65
WP_001198858.1|3202809_3202950_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	3.3e-21
WP_000361826.1|3202942_3203086_+	host cell division inhibitory peptide Kil	NA	A0A0P0ZC96	Stx2-converting_phage	97.9	3.5e-18
WP_000995407.1|3203161_3203458_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	98.0	5.2e-48
WP_000100847.1|3203463_3204249_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
3203670:3203685	attR	GCAGAACGGCATCGTT	NA	NA	NA	NA
WP_000186785.1|3204245_3204923_+	YqaJ viral recombinase family protein	NA	A0A1I9LJM9	Stx_converting_phage	99.1	2.3e-131
WP_001303590.1|3204922_3205105_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	100.0	7.4e-29
WP_000548547.1|3205077_3205269_+	DUF1382 family protein	NA	A0A1I9LJM8	Stx_converting_phage	100.0	1.9e-27
WP_000188870.1|3205345_3205561_+	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	100.0	1.0e-32
WP_000763383.1|3205659_3205881_+	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001289954.1|3205877_3206825_+	ead/Ea22-like family protein	NA	A0A0P0ZE96	Stx2-converting_phage	100.0	3.6e-183
WP_001356547.1|3206826_3207003_+	hypothetical protein	NA	B6DZ55	Enterobacteria_phage	100.0	4.6e-28
WP_000207903.1|3207336_3207693_+	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	100.0	3.1e-63
WP_000610375.1|3207689_3208052_+	DUF551 domain-containing protein	NA	Q9EY98	Enterobacteria_phage	100.0	1.8e-71
WP_000457728.1|3208139_3208382_+	DUF4222 domain-containing protein	NA	B6DZ51	Enterobacteria_phage	100.0	1.5e-37
WP_000556583.1|3208385_3208520_+	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	100.0	4.9e-22
WP_001193437.1|3208538_3208793_+	excisionase family protein	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_000063643.1|3208826_3210113_+	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	100.0	7.6e-253
WP_027868261.1|3210133_3210835_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	100.0	4.6e-103
WP_001216963.1|3210894_3211002_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|3210982_3211714_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569336.1|3211718_3212645_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
>prophage 16
NZ_CP016625	Escherichia coli O157:H7 strain FRIK944 chromosome, complete genome	5770602	3456926	3462352	5770602	integrase	Enterobacteria_phage(50.0%)	6	3447377:3447393	3459341:3459357
3447377:3447393	attL	TTCTTATAAAAAAGAAA	NA	NA	NA	NA
WP_000368131.1|3456926_3457859_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
WP_000958700.1|3458170_3459328_+|integrase	prophage integrase IntS	integrase	E7DYQ6	Enterobacteria_phage	100.0	2.2e-222
WP_000257010.1|3459502_3460639_-	phage DNA ejection protein	NA	Q716G3	Shigella_phage	72.8	1.4e-80
3459341:3459357	attR	TTCTTATAAAAAAGAAA	NA	NA	NA	NA
WP_000960724.1|3460648_3461329_-	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	71.0	1.8e-59
WP_000403517.1|3461315_3461783_-	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	74.7	1.7e-64
WP_000950857.1|3461782_3462352_-	hypothetical protein	NA	Q716G6	Shigella_phage	99.3	4.6e-69
>prophage 17
NZ_CP016625	Escherichia coli O157:H7 strain FRIK944 chromosome, complete genome	5770602	3741128	3756950	5770602	transposase,tail,holin	Enterobacteria_phage(33.33%)	19	NA	NA
WP_000162574.1|3741128_3741611_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_001217542.1|3742456_3742705_+	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_001132157.1|3743206_3743797_-	T3SS effector guanine nucleotide exchange factor EspM2	NA	NA	NA	NA	NA
WP_001144077.1|3743979_3744630_+	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001301665.1|3744708_3745767_+	T3SS effector EspW	NA	NA	NA	NA	NA
WP_000442132.1|3745896_3746319_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	97.0	5.7e-72
WP_001023396.1|3746479_3746749_-|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_000612591.1|3747366_3747714_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|3747710_3748091_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000731241.1|3748447_3748792_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000284517.1|3748796_3749012_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000143068.1|3749161_3751015_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.7	0.0e+00
WP_000499458.1|3751422_3751590_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|3751675_3752419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001235472.1|3752671_3753295_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.1	2.2e-112
WP_001028854.1|3753291_3753957_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001223948.1|3753953_3754565_-	recombination protein NinG	NA	A0A1U9AJF8	Stx1_converting_phage	95.6	2.5e-92
WP_001108081.1|3754539_3755106_-	HNH endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	100.0	2.3e-108
WP_162829202.1|3755736_3756950_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
>prophage 18
NZ_CP016625	Escherichia coli O157:H7 strain FRIK944 chromosome, complete genome	5770602	4847555	4859839	5770602	integrase	Enterobacteria_phage(90.0%)	13	4835971:4835984	4860652:4860665
4835971:4835984	attL	TATGGTGCGGAGAT	NA	NA	NA	NA
WP_001218978.1|4847555_4848743_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	92.0	5.3e-208
WP_000021256.1|4848787_4848961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000704989.1|4848962_4850483_-	cytidine deaminase	NA	A0A0N9QQ67	Chrysochromulina_ericina_virus	46.2	2.7e-07
WP_000446145.1|4851123_4851696_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	96.2	1.4e-94
WP_000638631.1|4851769_4852270_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_001283041.1|4852266_4853001_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	97.5	2.2e-127
WP_001149160.1|4853551_4853818_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_000980235.1|4853814_4854414_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	82.5	3.5e-51
WP_001244670.1|4854406_4854694_+	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	96.8	2.5e-47
WP_000459294.1|4854686_4855142_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	99.1	1.6e-64
WP_000856729.1|4855277_4855598_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_000783661.1|4855612_4857946_+	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	99.1	0.0e+00
WP_001219063.1|4858657_4859839_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	68.9	1.4e-160
4860652:4860665	attR	TATGGTGCGGAGAT	NA	NA	NA	NA
>prophage 19
NZ_CP016625	Escherichia coli O157:H7 strain FRIK944 chromosome, complete genome	5770602	5353953	5366090	5770602	tail,transposase	Enterobacteria_phage(41.18%)	17	NA	NA
WP_000956557.1|5353953_5354487_+	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	100.0	1.1e-99
WP_000654815.1|5354683_5354857_+	hypothetical protein	NA	K7PJQ2	Enterobacteria_phage	100.0	4.4e-23
WP_001093918.1|5354904_5355186_-	pyocin activator PrtN family protein	NA	K7PGU0	Enterobacteria_phage	98.9	8.7e-45
WP_000829415.1|5355530_5355728_-	hypothetical protein	NA	K7PH57	Enterobacteria_phage	68.6	7.5e-11
WP_000145668.1|5356063_5356348_-	hypothetical protein	NA	I6S1S6	Salmonella_phage	83.9	1.3e-40
WP_001242740.1|5356344_5356695_-	hypothetical protein	NA	A0A0P0ZBF8	Stx2-converting_phage	94.8	1.6e-56
WP_000008211.1|5356685_5357222_-	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	3.1e-99
WP_001230514.1|5358543_5359143_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	5.7e-110
WP_000268945.1|5359207_5360521_+|tail	phage tail protein	tail	A0A0P0ZE15	Stx2-converting_phage	98.2	2.5e-81
WP_001023355.1|5360522_5360792_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZEF0	Stx2-converting_phage	96.6	2.7e-43
WP_001118000.1|5360903_5361476_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	53.2	2.5e-46
WP_072140863.1|5361548_5362178_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	93.5	1.4e-79
WP_001143816.1|5362259_5362901_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	99.1	1.1e-106
WP_001217541.1|5363061_5363310_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_000998048.1|5363777_5365316_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|5365365_5365713_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|5365709_5366090_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
>prophage 20
NZ_CP016625	Escherichia coli O157:H7 strain FRIK944 chromosome, complete genome	5770602	5507948	5566976	5770602	protease,transposase	Pectobacterium_phage(11.11%)	60	NA	NA
WP_000312488.1|5507948_5509208_+|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_001232412.1|5509210_5510215_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_001089295.1|5510296_5510494_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_000527955.1|5510597_5511896_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001177639.1|5512100_5512526_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000076303.1|5512564_5515006_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.9	2.4e-66
WP_001293282.1|5515186_5515918_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000220128.1|5516044_5516446_+	DUF2170 family protein	NA	NA	NA	NA	NA
WP_000511966.1|5516464_5517163_+	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000012572.1|5517213_5517873_+	YjfK family protein	NA	NA	NA	NA	NA
WP_000547760.1|5517890_5518289_+	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000101670.1|5518298_5518937_+	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000943960.1|5518939_5520103_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	8.3e-81
WP_001301849.1|5520186_5521812_+	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000811566.1|5521928_5522204_-|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_000254636.1|5522352_5522682_-	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_000569696.1|5522863_5523613_+	esterase	NA	NA	NA	NA	NA
WP_000133631.1|5523609_5524365_-	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
WP_001301921.1|5525891_5527289_+	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_000218362.1|5527304_5527610_+	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
WP_000776517.1|5527619_5528084_+	PTS ascorbate transporter subunit IIA	NA	NA	NA	NA	NA
WP_000056760.1|5528097_5528748_+	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_000949511.1|5528757_5529612_+	L-ribulose-5-phosphate 3-epimerase UlaE	NA	NA	NA	NA	NA
WP_001170812.1|5529611_5530298_+	L-ribulose-5-phosphate 4-epimerase UlaF	NA	NA	NA	NA	NA
WP_000492914.1|5530426_5530702_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001216676.1|5531028_5531424_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_001296681.1|5531430_5531745_+	primosomal replication protein N	NA	NA	NA	NA	NA
WP_000135199.1|5531749_5531977_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_001196062.1|5532018_5532468_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_001301745.1|5532538_5533333_-	DUF2686 family protein	NA	NA	NA	NA	NA
WP_000604943.1|5533955_5534387_-|transposase	IS200/IS605-like element IS609 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	59.9	5.7e-43
WP_000826431.1|5534394_5535603_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	5.4e-208
WP_001119481.1|5535737_5536376_-	cell division protein YtfB	NA	NA	NA	NA	NA
WP_000211225.1|5536593_5537214_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_000228346.1|5537522_5538935_+	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_000331454.1|5538979_5539642_-	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
WP_001301505.1|5539749_5540715_-	DMT family transporter	NA	NA	NA	NA	NA
WP_000560631.1|5540822_5541683_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_001302935.1|5541771_5542152_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000589488.1|5542269_5544213_-	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	NA	NA	NA	NA
WP_000886884.1|5544402_5545143_+	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_000937658.1|5545354_5546293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000175296.1|5546355_5546910_-	YtfJ family protein	NA	NA	NA	NA	NA
WP_000689228.1|5547234_5547441_+	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_000935036.1|5547536_5548880_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001301936.1|5549202_5549841_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_001269327.1|5550046_5551780_+	autotransporter assembly complex protein TamA	NA	NA	NA	NA	NA
WP_000060930.1|5551776_5555556_+	autotransporter assembly complex protein TamB	NA	NA	NA	NA	NA
WP_001219160.1|5555558_5555900_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_001223210.1|5556111_5556363_+	type II toxin-antitoxin system antitoxin ChpS	NA	NA	NA	NA	NA
WP_000239579.1|5556356_5556707_+	endoribonuclease toxin ChpB	NA	NA	NA	NA	NA
WP_000055075.1|5556786_5557317_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	1.2e-55
WP_000265942.1|5557626_5558583_+	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000205805.1|5558722_5560225_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.8e-11
WP_001301928.1|5560238_5561261_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000596020.1|5561247_5562243_+	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_000853749.1|5562275_5563274_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.6	2.1e-69
WP_001219792.1|5563449_5564823_+	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_000166264.1|5564978_5565530_-	ribosome-associated protein	NA	NA	NA	NA	NA
WP_001162171.1|5565623_5566976_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
>prophage 21
NZ_CP016625	Escherichia coli O157:H7 strain FRIK944 chromosome, complete genome	5770602	5599396	5611972	5770602	integrase	Enterobacteria_phage(81.82%)	15	5594429:5594444	5612924:5612939
5594429:5594444	attL	GTGCTGTTCATCGAAA	NA	NA	NA	NA
WP_000772662.1|5599396_5600671_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	41.0	4.1e-73
WP_000936844.1|5600838_5601144_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001453880.1|5601220_5601955_+	type II restriction endonuclease	NA	NA	NA	NA	NA
WP_000095622.1|5601992_5603237_-	DNA cytosine methyltransferase	NA	F2Y148	Organic_Lake_phycodnavirus	31.1	9.3e-46
WP_000446132.1|5603562_5604135_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	97.3	2.2e-95
WP_000638634.1|5604208_5604709_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_001283021.1|5604705_5605440_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	98.8	2.3e-129
WP_001149160.1|5605991_5606258_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_000980224.1|5606254_5606845_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	90.3	5.3e-60
WP_001244670.1|5606837_5607125_+	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	96.8	2.5e-47
WP_000459287.1|5607117_5607573_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	98.2	4.7e-64
WP_000856729.1|5607708_5608029_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_000783684.1|5608043_5610377_+	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	99.1	0.0e+00
WP_044815386.1|5610732_5610927_+	hypothetical protein	NA	Q38404	Enterobacteria_phage	100.0	1.5e-24
WP_001301682.1|5611144_5611972_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	40.4	4.3e-55
5612924:5612939	attR	GTGCTGTTCATCGAAA	NA	NA	NA	NA
>prophage 22
NZ_CP016625	Escherichia coli O157:H7 strain FRIK944 chromosome, complete genome	5770602	5721356	5755847	5770602	integrase,tail,protease,lysis,holin,portal,terminase	Enterobacteria_phage(35.56%)	46	5719525:5719539	5756730:5756744
5719525:5719539	attL	TGCAGGGGGAGATTG	NA	NA	NA	NA
WP_001218280.1|5721356_5722580_+|integrase	site-specific integrase	integrase	A0A291AWU1	Escherichia_phage	97.8	1.5e-234
WP_000566662.1|5722951_5724178_-	dNTP triphosphohydrolase	NA	NA	NA	NA	NA
WP_001061360.1|5724408_5724624_-	helix-turn-helix domain-containing protein	NA	A5LH59	Enterobacteria_phage	98.4	1.1e-31
WP_001426278.1|5724623_5724986_-	DUF551 domain-containing protein	NA	Q9EY98	Enterobacteria_phage	95.8	1.6e-67
WP_001426280.1|5724982_5725354_-	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	78.2	8.0e-46
WP_000797279.1|5725867_5726056_-	hypothetical protein	NA	A0A1I9LJM4	Stx_converting_phage	98.4	1.4e-30
WP_000207968.1|5726228_5726591_-	hypothetical protein	NA	A0A1B0V865	Salmonella_phage	97.4	8.9e-58
WP_000951712.1|5726587_5726797_-	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	92.8	2.0e-33
WP_001289896.1|5726798_5727431_-	ead/Ea22-like family protein	NA	A0A2D1GLY5	Escherichia_phage	77.1	2.7e-78
WP_000672528.1|5727427_5728162_-	hypothetical protein	NA	A0A2I6TCG8	Escherichia_phage	55.2	1.7e-39
WP_001018057.1|5728158_5728449_-	DUF4752 family protein	NA	A0A2I6TCB0	Escherichia_phage	82.3	1.2e-36
WP_001242736.1|5728445_5728796_-	hypothetical protein	NA	A0A0P0ZBF8	Stx2-converting_phage	95.7	2.8e-56
WP_065763509.1|5728786_5729323_-	5'-deoxynucleotidase	NA	K7PKJ9	Enterobacteria_phage	97.8	1.2e-98
WP_000981537.1|5729856_5730510_-	helix-turn-helix domain-containing protein	NA	K7PLZ5	Enterobacterial_phage	60.8	5.7e-71
WP_001231956.1|5730605_5730803_+	Cro/Cl family transcriptional regulator	NA	K7PHB1	Enterobacterial_phage	56.9	1.1e-14
WP_000514174.1|5730830_5731415_+	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	60.9	5.5e-57
WP_001250270.1|5731590_5731803_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	5.4e-15
WP_000054955.1|5731759_5732752_+	hypothetical protein	NA	U5P0A0	Shigella_phage	95.8	4.0e-92
WP_001444393.1|5732748_5733243_+	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	98.8	3.3e-87
WP_001426462.1|5733242_5733896_+	phage N-6-adenine-methyltransferase	NA	A0A0P0ZCC0	Stx2-converting_phage	99.1	9.6e-127
WP_000210151.1|5733892_5734219_+	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	99.1	2.0e-53
WP_000767110.1|5734215_5734611_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	98.4	5.7e-66
WP_001072673.1|5734762_5735578_+	KilA-N domain-containing protein	NA	U5P4K5	Shigella_phage	99.6	2.9e-149
WP_001426460.1|5735585_5736575_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.1	1.1e-193
WP_001047089.1|5736588_5737341_+	antitermination protein	NA	Q8SBE4	Shigella_phage	98.4	2.6e-136
WP_000115362.1|5737621_5738047_+	hypothetical protein	NA	A0A291AWZ9	Escherichia_phage	98.6	1.0e-73
WP_065763510.1|5738742_5740689_+	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	99.2	0.0e+00
WP_000143458.1|5740826_5741006_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290230.1|5741046_5741292_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_001072901.1|5741369_5741585_+|holin	class II holin family protein	holin	A0A2R2Z340	Escherichia_phage	100.0	1.2e-33
WP_000087709.1|5741589_5742123_+	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	98.9	2.5e-101
WP_000459342.1|5742281_5742419_+	hypothetical protein	NA	Q687G2	Enterobacteria_phage	95.6	3.7e-17
WP_021351726.1|5742420_5742888_+|lysis	lysis protein	lysis	Q7AYI6	Enterobacteria_phage	96.1	1.8e-74
WP_000373407.1|5743300_5743777_+	DUF1441 family protein	NA	Q8VNN8	Enterobacteria_phage	100.0	3.3e-84
WP_001077625.1|5743773_5745897_+|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	0.0e+00
WP_000102415.1|5745893_5746106_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_000974564.1|5746105_5747608_+|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
WP_001114427.1|5747552_5749577_+|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.7	0.0e+00
WP_001097065.1|5749664_5749991_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001281350.1|5749983_5750265_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_000974966.1|5750267_5750891_+|tail	phage tail protein	tail	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_000682708.1|5750903_5751302_+|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	99.2	1.0e-70
WP_000235090.1|5751309_5752062_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000479062.1|5752075_5752498_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.2e-71
WP_000532073.1|5752524_5752833_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
WP_000847298.1|5755517_5755847_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
5756730:5756744	attR	TGCAGGGGGAGATTG	NA	NA	NA	NA
>prophage 23
NZ_CP016625	Escherichia coli O157:H7 strain FRIK944 chromosome, complete genome	5770602	5761668	5767499	5770602	tail	Enterobacteria_phage(50.0%)	6	NA	NA
WP_001230509.1|5761668_5762268_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.5	3.3e-110
WP_065763498.1|5762332_5763646_+|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.4	1.7e-77
WP_001101699.1|5763647_5763917_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q6H9S8	Enterobacteria_phage	98.9	1.9e-44
WP_001121225.1|5764201_5764852_-	type III secretion system effector NleG7	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_001217539.1|5765444_5765693_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	100.0	1.1e-38
WP_000202563.1|5765912_5767499_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.2	2.4e-30
>prophage 1
NZ_CP016626	Escherichia coli O157:H7 strain FRIK944 plasmid p0157, complete sequence	95598	10463	73212	95598	transposase,protease,integrase	Macacine_betaherpesvirus(26.32%)	56	2674:2688	23959:23973
2674:2688	attL	AAATATTCAGGCAAT	NA	NA	NA	NA
WP_001066920.1|10463_11204_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
WP_000361615.1|11488_12466_-	replication initiation protein	NA	J9Q7H0	Salmonella_phage	58.9	5.1e-100
WP_000708307.1|12873_13074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001248529.1|13070_13691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010891291.1|13687_14371_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_000813634.1|14829_15048_+	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_001159868.1|15049_15355_+	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000016989.1|15355_16162_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	99.1	3.7e-56
WP_162829202.1|16884_18098_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000852148.1|18173_18929_+	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	99.6	1.1e-142
WP_000772446.1|19516_20683_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	100.0	7.0e-229
WP_000817031.1|20682_21654_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	100.0	4.8e-175
WP_000273919.1|22262_23165_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_010891292.1|23168_23474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000085945.1|23550_24234_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.9	8.7e-30
23959:23973	attR	AAATATTCAGGCAAT	NA	NA	NA	NA
WP_001104869.1|24234_24456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001358893.1|24349_24904_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001005037.1|24949_25726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010891293.1|26266_26569_+	antirestriction protein	NA	NA	NA	NA	NA
WP_000271685.1|26615_27038_+	DUF1380 family protein	NA	NA	NA	NA	NA
WP_001027495.1|27034_27226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032245379.1|27195_27705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000218642.1|28221_28452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000199442.1|28503_29865_+	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
WP_001302171.1|29911_30475_+	class I SAM-dependent methyltransferase	NA	A8HNV9	Thalassomonas_phage	36.7	1.0e-20
WP_001310283.1|30560_30998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000547965.1|31067_31274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000290823.1|31299_31752_+	single-stranded DNA-binding protein	NA	A0A1B0VAF5	Salmonella_phage	59.3	4.4e-46
WP_000005995.1|31808_32042_+	DUF905 family protein	NA	NA	NA	NA	NA
WP_000117168.1|32107_34066_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	26.7	1.8e-19
WP_000845908.1|34120_34555_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_001276250.1|34551_35313_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_001302184.1|35544_35703_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_001453090.1|37925_38357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000581718.1|40115_49625_+	toxin B	NA	NA	NA	NA	NA
WP_001171554.1|50619_51000_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|50996_51344_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|51393_52932_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000205762.1|54333_55080_+	conjugal transfer pilus acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.8	6.4e-10
WP_000704522.1|55138_55999_+	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	23.0	2.3e-11
WP_000840472.1|56101_56662_+	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_001302189.1|56794_57007_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001233853.1|57251_57713_+	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	37.1	5.5e-20
WP_001302200.1|57758_57968_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_000766796.1|58005_58344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000083831.1|58583_58838_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_001370046.1|59073_59148_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_000130945.1|59140_59998_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_001178089.1|60909_61194_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_000421248.1|61193_61469_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001105064.1|61563_61770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302179.1|63110_63296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000592771.1|63472_65683_+	catalase/peroxidase KatP	NA	NA	NA	NA	NA
WP_001172748.1|65726_66116_+	cytochrome b562 family protein	NA	NA	NA	NA	NA
WP_001034097.1|67341_71244_+|protease	serine protease autotransporter EspP	protease	Q9LA58	Enterobacterial_phage	40.4	5.5e-238
WP_000998048.1|71673_73212_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
