The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP016546	Escherichia coli strain O177:H21 chromosome, complete genome	5134536	27304	36613	5134536	holin,lysis,transposase	Enterobacteria_phage(44.44%)	11	NA	NA
WP_029402712.1|27304_27748_-	ParB N-terminal domain-containing protein	NA	A0A2I7RQE2	Vibrio_phage	54.6	3.8e-34
WP_029402711.1|27885_29343_-	Trk system potassium uptake protein TrkG	NA	NA	NA	NA	NA
WP_001228691.1|29539_29725_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	75.4	8.9e-14
WP_000992046.1|29941_30475_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	92.7	5.5e-96
WP_000369847.1|30580_30853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000189896.1|30818_31163_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	90.5	1.6e-35
WP_029402785.1|31167_31383_-|holin	class II holin family protein	holin	A5LH82	Enterobacteria_phage	93.0	1.4e-31
WP_029402814.1|32667_33210_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	74.6	2.9e-76
WP_042630990.1|33206_33497_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	88.5	2.1e-46
WP_029402338.1|33496_34096_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	91.5	1.9e-105
WP_001339197.1|35404_36613_-|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
>prophage 2
NZ_CP016546	Escherichia coli strain O177:H21 chromosome, complete genome	5134536	40022	55571	5134536	transposase,tRNA	Escherichia_phage(73.68%)	20	NA	NA
WP_029402335.1|40022_40445_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	93.4	5.7e-64
WP_029402334.1|40460_41174_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	84.2	2.0e-109
WP_029402333.1|41196_41943_-	ATP-binding protein	NA	V5UQI5	Shigella_phage	81.2	1.8e-113
WP_021568026.1|41949_42744_-	hypothetical protein	NA	G9L6A8	Escherichia_phage	64.5	1.7e-40
WP_000693803.1|42822_43245_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	92.9	1.3e-68
WP_001072342.1|43241_43496_-	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	61.6	1.3e-18
WP_001169151.1|44432_44588_+	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_032155212.1|44584_45073_-	super-infection exclusion protein B	NA	NA	NA	NA	NA
WP_000560223.1|45514_45736_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
WP_001352098.1|45735_45906_+	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_001344816.1|45980_46256_+	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	95.6	4.0e-42
WP_021565075.1|46357_48958_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	1.1e-247
WP_000166319.1|48950_49760_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_042631016.1|49816_50011_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	93.8	2.9e-31
WP_001302840.1|50003_50192_+	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	98.4	5.5e-27
WP_000079604.1|50291_50507_+	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_077885631.1|50508_50979_+	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	93.4	1.1e-76
WP_001339197.1|50957_52166_-|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_001157407.1|53133_54069_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000123745.1|54197_55571_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
>prophage 3
NZ_CP016546	Escherichia coli strain O177:H21 chromosome, complete genome	5134536	1493191	1575240	5134536	tail,portal,terminase,integrase,head,capsid,lysis,transposase,tRNA	Enterobacteria_phage(41.67%)	84	1532573:1532587	1577221:1577235
WP_001223177.1|1493191_1493878_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001303782.1|1494277_1494418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001194358.1|1494513_1495230_+	two-component system response regulator ArcA	NA	NA	NA	NA	NA
WP_000920306.1|1495289_1496642_-	cell envelope integrity protein CreD	NA	NA	NA	NA	NA
WP_065749746.1|1496699_1498124_-	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	21.7	2.1e-09
WP_001188656.1|1498123_1498813_-	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	5.2e-30
WP_000875487.1|1498825_1499299_-	protein CreA	NA	NA	NA	NA	NA
WP_000371666.1|1499509_1500379_+	MDR efflux pump AcrAB transcriptional activator RobA	NA	NA	NA	NA	NA
WP_000942344.1|1500375_1501023_-	2,3-diphosphoglycerate-dependent phosphoglycerate mutase GpmB	NA	NA	NA	NA	NA
WP_001378619.1|1501074_1501596_+	inosine/xanthosine triphosphatase	NA	NA	NA	NA	NA
WP_000068679.1|1501680_1502007_-	trp operon repressor	NA	NA	NA	NA	NA
WP_000409465.1|1502096_1504034_-	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
WP_000046749.1|1504244_1505912_+	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	3.7e-42
WP_000093810.1|1506218_1507451_-	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	1.6e-82
WP_001029698.1|1507471_1508854_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_001132955.1|1508902_1509871_-	phosphoserine phosphatase	NA	NA	NA	NA	NA
WP_000124615.1|1509976_1510621_+	YtjB family periplasmic protein	NA	NA	NA	NA	NA
WP_000105865.1|1510648_1511665_+	lipoate--protein ligase LplA	NA	NA	NA	NA	NA
WP_000566138.1|1511696_1511846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000224877.1|1512120_1512840_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_000816471.1|1512919_1514143_-	phosphopentomutase	NA	NA	NA	NA	NA
WP_000477811.1|1514194_1515517_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	2.3e-79
WP_001295412.1|1515643_1516423_-	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_001339197.1|1517647_1518856_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_001088405.1|1519540_1520404_+	YjjW family glycine radical enzyme activase	NA	NA	NA	NA	NA
WP_000563068.1|1520516_1521299_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000531527.1|1521295_1522369_-	patatin family protein	NA	NA	NA	NA	NA
WP_000490275.1|1522490_1522652_-	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
WP_001295748.1|1522778_1523384_-	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000202564.1|1523776_1525363_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	24.9	5.3e-30
WP_001217539.1|1525582_1525831_+	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	100.0	1.1e-38
WP_032178340.1|1526147_1526693_+	serine acetyltransferase	NA	NA	NA	NA	NA
WP_065749747.1|1526703_1527276_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	83.0	4.1e-89
WP_071940983.1|1527275_1530674_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	X2KTY7	Enterobacteria_phage	35.5	1.8e-11
WP_001233093.1|1530738_1531338_-	Ail/Lom family outer membrane beta-barrel protein	NA	A5LH44	Enterobacteria_phage	98.0	2.2e-109
WP_065749749.1|1531408_1534906_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	97.7	0.0e+00
1532573:1532587	attL	ATTGATACTGGCGGC	NA	NA	NA	NA
WP_000090847.1|1534966_1535569_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.1	1.8e-87
WP_065749750.1|1535505_1536249_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	93.5	9.2e-142
WP_001152639.1|1536254_1536953_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	100.0	2.3e-134
WP_000847373.1|1536952_1537282_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	99.1	2.1e-58
WP_001682408.1|1538442_1539120_+|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|1539119_1539467_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|1539486_1541058_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000459457.1|1542557_1542992_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479153.1|1542973_1543396_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	100.0	6.7e-73
WP_001358372.1|1543411_1544152_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.0	1.4e-129
WP_000683105.1|1544159_1544555_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_000975081.1|1544551_1545130_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	5.9e-80
WP_000785282.1|1545141_1545495_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	97.4	6.4e-61
WP_000158875.1|1545506_1545902_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	1.1e-58
WP_000063250.1|1545943_1546969_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.9	1.1e-188
WP_001358225.1|1547024_1547357_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	2.5e-54
WP_000123248.1|1547366_1548686_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.6	1.8e-233
WP_065749751.1|1548666_1550268_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.2	2.5e-309
WP_000198149.1|1550264_1550471_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_065749752.1|1550467_1552393_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.4	0.0e+00
WP_000453611.1|1552367_1552913_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	2.3e-94
WP_000025002.1|1553250_1553571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001356226.1|1553951_1554395_-|lysis	lysis protein	lysis	M1FJ79	Enterobacteria_phage	77.9	7.1e-57
WP_001135250.1|1554391_1554889_-	lysozyme RrrD	NA	A0A291AWW2	Escherichia_phage	100.0	4.5e-92
WP_000839596.1|1554888_1555104_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_065749753.1|1555171_1556224_-	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	99.7	6.1e-208
WP_000917724.1|1556374_1556578_-	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	100.0	6.1e-32
WP_001047110.1|1556831_1557584_-	antitermination protein	NA	K7PGU5	Enterobacteria_phage	99.2	5.3e-137
WP_024185670.1|1557597_1558587_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.7	4.3e-195
WP_029488747.1|1558594_1559404_-	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	99.3	1.2e-150
WP_000767103.1|1559423_1559813_-	RusA family crossover junction endodeoxyribonuclease	NA	A5LH74	Enterobacteria_phage	98.4	1.0e-67
WP_000210169.1|1559809_1560136_-	LexA family transcriptional regulator	NA	K7PLX6	Enterobacteria_phage	100.0	9.2e-54
WP_000066917.1|1560132_1560786_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.5	1.9e-127
WP_001315196.1|1560785_1561280_-	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	97.5	8.1e-86
WP_000061531.1|1561276_1562095_-	helix-turn-helix domain-containing protein	NA	Q8SBF1	Shigella_phage	99.6	5.2e-122
WP_000933947.1|1562091_1562328_-	hypothetical protein	NA	A0A291AX25	Escherichia_phage	96.2	1.9e-37
WP_001087321.1|1562320_1563157_-	ash family protein	NA	Q8SBF3	Shigella_phage	97.8	4.3e-148
WP_000521508.1|1563153_1563705_-	hypothetical protein	NA	A0A291AWW8	Escherichia_phage	100.0	4.5e-101
WP_000649477.1|1563748_1563949_-	helix-turn-helix domain-containing protein	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000848749.1|1564039_1564714_+	LexA family transcriptional regulator	NA	U5P0T5	Shigella_phage	99.6	6.0e-132
WP_000135680.1|1565382_1565745_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000081316.1|1565810_1566635_+	DUF2303 family protein	NA	U5P439	Shigella_phage	99.6	2.3e-149
WP_000008209.1|1566762_1567299_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.9	1.6e-100
WP_001339197.1|1567391_1568600_-|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_065749754.1|1568651_1568990_+	hypothetical protein	NA	U5P092	Shigella_phage	95.7	2.7e-48
WP_000206803.1|1568989_1569610_+	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	91.3	2.2e-112
WP_001159683.1|1570006_1573834_-	SIR2 family protein	NA	NA	NA	NA	NA
WP_001218277.1|1574016_1575240_-|integrase	site-specific integrase	integrase	A5LH57	Enterobacteria_phage	98.5	4.0e-235
1577221:1577235	attR	GCCGCCAGTATCAAT	NA	NA	NA	NA
>prophage 4
NZ_CP016546	Escherichia coli strain O177:H21 chromosome, complete genome	5134536	1682242	1723211	5134536	holin,transposase	Shigella_phage(16.67%)	35	NA	NA
WP_001339197.1|1682242_1683451_-|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_001295727.1|1684650_1685841_-	DNA cytosine methyltransferase	NA	Q02778	Bacillus_phage	31.0	7.3e-16
WP_001332039.1|1685833_1687474_-	Alw26I/Eco31I/Esp3I family type II restriction adenine-specific DNA-methyltransferase	NA	NA	NA	NA	NA
WP_001298859.1|1687925_1689467_-|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
WP_000839286.1|1690858_1691035_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_000761690.1|1691051_1691540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854759.1|1691536_1691914_-	toxin	NA	NA	NA	NA	NA
WP_001295723.1|1692003_1692372_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_000692345.1|1692534_1692756_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
WP_001186775.1|1692818_1693295_-	RadC family protein	NA	NA	NA	NA	NA
WP_000855059.1|1693310_1693784_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	30.3	1.5e-12
WP_042631095.1|1694123_1694942_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.3	4.7e-46
WP_001323397.1|1695096_1695255_-	DUF905 family protein	NA	NA	NA	NA	NA
WP_000813435.1|1697398_1698001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000211308.1|1698096_1698303_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_071526287.1|1699076_1699226_+	hemolysin activation protein	NA	NA	NA	NA	NA
WP_000221530.1|1699955_1700525_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_000555341.1|1702453_1702711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029402667.1|1704460_1704982_+	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
WP_001068910.1|1704978_1705932_+	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_000188262.1|1706018_1708343_+	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
WP_000879164.1|1708387_1709290_+	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_000125187.1|1709286_1710285_+	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_000684856.1|1710281_1711238_+	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
WP_000175457.1|1711238_1712006_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
WP_000177057.1|1712562_1712820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149024892.1|1713753_1714908_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_001293436.1|1715062_1717060_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	25.9	7.4e-21
WP_000625671.1|1717122_1717536_+	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_085948656.1|1717470_1718638_-|transposase	IS3-like element IS911 family transposase	transposase	Q716C2	Shigella_phage	99.3	1.8e-184
WP_000254999.1|1718951_1719209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000594405.1|1719261_1719387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000611568.1|1719429_1720548_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_000179692.1|1720559_1721777_-	MFS transporter	NA	NA	NA	NA	NA
WP_166426901.1|1721982_1723211_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.0	5.9e-170
>prophage 5
NZ_CP016546	Escherichia coli strain O177:H21 chromosome, complete genome	5134536	1767548	1826781	5134536	protease,transposase	Klosneuvirus(12.5%)	60	NA	NA
WP_001162171.1|1767548_1768901_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_000166270.1|1768994_1769546_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_001219792.1|1769701_1771075_-	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_000853753.1|1771250_1772249_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
WP_000595986.1|1772281_1773277_-	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_001296689.1|1773263_1774286_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000205791.1|1774299_1775802_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.1e-11
WP_000265933.1|1776111_1777068_-	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000055072.1|1777377_1777908_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.9	9.4e-56
WP_000239579.1|1777987_1778338_-	endoribonuclease toxin ChpB	NA	NA	NA	NA	NA
WP_001223208.1|1778331_1778583_-	type II toxin-antitoxin system antitoxin ChpS	NA	NA	NA	NA	NA
WP_001219160.1|1778795_1779137_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_000060921.1|1779139_1782919_-	autotransporter assembly complex protein TamB	NA	NA	NA	NA	NA
WP_001269327.1|1782915_1784649_-	autotransporter assembly complex protein TamA	NA	NA	NA	NA	NA
WP_001499246.1|1784854_1785493_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_000399648.1|1785718_1786699_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000935036.1|1787094_1788438_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_000689228.1|1788499_1788706_-	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_000175289.1|1789030_1789588_+	YtfJ family protein	NA	NA	NA	NA	NA
WP_000886909.1|1789577_1790318_-	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_000589416.1|1790507_1792451_+	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	NA	NA	NA	NA
WP_000084622.1|1792579_1792960_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000560563.1|1793048_1793909_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_001296686.1|1794016_1794982_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000331456.1|1795089_1795752_+	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
WP_000228346.1|1795796_1797209_-	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_000211225.1|1797516_1798137_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_001119478.1|1798355_1798994_+	cell division protein YtfB	NA	NA	NA	NA	NA
WP_001296752.1|1799128_1800337_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	94.0	7.5e-210
WP_001350063.1|1801397_1802192_+	DUF2686 family protein	NA	NA	NA	NA	NA
WP_001196062.1|1802262_1802712_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_000135199.1|1802753_1802981_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_001296681.1|1802985_1803300_-	primosomal replication protein N	NA	NA	NA	NA	NA
WP_001216676.1|1803306_1803702_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_000492914.1|1804028_1804304_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001170840.1|1804432_1805119_-	L-ribulose-5-phosphate 4-epimerase UlaF	NA	NA	NA	NA	NA
WP_000949539.1|1805118_1805973_-	L-ribulose-5-phosphate 3-epimerase UlaE	NA	NA	NA	NA	NA
WP_000056760.1|1805982_1806633_-	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_000776520.1|1806646_1807111_-	PTS ascorbate transporter subunit IIA	NA	NA	NA	NA	NA
WP_000218362.1|1807120_1807426_-	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
WP_029402394.1|1807441_1808839_-	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_001295191.1|1809193_1810258_+	L-ascorbate 6-phosphate lactonase	NA	NA	NA	NA	NA
WP_000133631.1|1810365_1811121_+	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
WP_000569708.1|1811117_1811867_-	esterase	NA	NA	NA	NA	NA
WP_000254636.1|1812048_1812378_+	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_000811566.1|1812526_1812802_+|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_001339483.1|1812918_1814544_-	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000943987.1|1814627_1815791_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.5	1.7e-81
WP_000101644.1|1815793_1816432_-	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000547760.1|1816441_1816840_-	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000012553.1|1816857_1817517_-	YjfK family protein	NA	NA	NA	NA	NA
WP_000511955.1|1817567_1818266_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000220137.1|1818284_1818686_-	DUF2170 family protein	NA	NA	NA	NA	NA
WP_001293282.1|1818812_1819544_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000076316.1|1819723_1822165_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	6.4e-67
WP_001177639.1|1822203_1822629_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000527955.1|1822833_1824132_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001089295.1|1824235_1824433_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_001232412.1|1824514_1825519_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312488.1|1825521_1826781_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
>prophage 6
NZ_CP016546	Escherichia coli strain O177:H21 chromosome, complete genome	5134536	1916474	2006855	5134536	tail,protease,portal,terminase,integrase,lysis,transposase,tRNA	Enterobacteria_phage(54.39%)	91	1929890:1929906	2011568:2011584
WP_001339197.1|1916474_1917683_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_001307516.1|1917747_1919733_+	alkyl sulfatase YjcS	NA	A0A2P0VMX1	Tetraselmis_virus	44.5	5.5e-149
WP_001297587.1|1919941_1920217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000446374.1|1920235_1921267_+	multidrug efflux transporter periplasmic adaptor subunit MdtN	NA	NA	NA	NA	NA
WP_001275144.1|1921266_1923318_+	multidrug efflux transporter permease subunit MdtO	NA	NA	NA	NA	NA
WP_000610574.1|1923314_1924781_+	multidrug efflux transporter outer membrane subunit MdtP	NA	NA	NA	NA	NA
WP_077697520.1|1924978_1927126_+	formate dehydrogenase subunit alpha	NA	A0A077SK27	Escherichia_phage	23.9	7.0e-33
WP_065749761.1|1927236_1927908_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_000835799.1|1927985_1929299_-	glutamate/aspartate:proton symporter GltP	NA	NA	NA	NA	NA
WP_000662607.1|1929639_1930236_-	heme lyase NrfEFG subunit NrfG	NA	NA	NA	NA	NA
1929890:1929906	attL	ACCGTCGCCAGCGCCGC	NA	NA	NA	NA
WP_001032546.1|1930232_1930616_-	heme lyase NrfEFG subunit NrfF	NA	NA	NA	NA	NA
WP_071790246.1|1930608_1932327_-	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_000195171.1|1932346_1933303_-	cytochrome c nitrite reductase subunit NrfD	NA	NA	NA	NA	NA
WP_000220281.1|1933299_1933971_-	cytochrome c nitrite reductase Fe-S protein	NA	NA	NA	NA	NA
WP_001295391.1|1933967_1934534_-	cytochrome c nitrite reductase pentaheme subunit	NA	NA	NA	NA	NA
WP_000196875.1|1934578_1936015_-	ammonia-forming nitrite reductase cytochrome c552 subunit	NA	NA	NA	NA	NA
WP_000078239.1|1936406_1938365_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	40.4	1.9e-90
WP_001014565.1|1938564_1938879_+	DUF485 domain-containing protein	NA	NA	NA	NA	NA
WP_000832572.1|1938875_1940525_+	cation/acetate symporter ActP	NA	NA	NA	NA	NA
WP_001270130.1|1940702_1941995_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_000402207.1|1942148_1943798_-	Na+/H+ antiporter	NA	NA	NA	NA	NA
WP_000106882.1|1943948_1945298_-	guanine/hypoxanthine transporter GhxP	NA	A0A0R6PHV4	Moraxella_phage	71.6	1.8e-159
WP_000412428.1|1945843_1946308_-	redox-sensitive transcriptional activator SoxR	NA	NA	NA	NA	NA
WP_000019358.1|1946393_1946717_+	superoxide response transcriptional regulator SoxS	NA	NA	NA	NA	NA
WP_000019539.1|1946719_1948306_-	c-di-GMP phosphodiesterase PdeC	NA	NA	NA	NA	NA
WP_001295689.1|1948735_1949017_+	YjcB family protein	NA	NA	NA	NA	NA
WP_000168305.1|1949115_1949652_-	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	78.7	1.1e-56
WP_000357740.1|1949905_1952728_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.1	0.0e+00
WP_000155657.1|1952762_1953119_-	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_000270375.1|1953122_1953539_-	YjbQ family protein	NA	NA	NA	NA	NA
WP_001307512.1|1953649_1954363_-	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_001027717.1|1954764_1955268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000486994.1|1955489_1956683_-	aromatic amino acid transaminase	NA	NA	NA	NA	NA
WP_001147328.1|1956935_1958015_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.9	5.2e-29
WP_000918363.1|1958067_1959483_-	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	4.8e-200
WP_000235522.1|1959565_1960549_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000891404.1|1960714_1960957_-	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_000543841.1|1961090_1962128_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000332259.1|1962216_1963314_+|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.2	1.8e-210
WP_001217553.1|1963374_1963623_+	DinI-like family protein	NA	K7PLW4	Enterobacteria_phage	100.0	1.8e-38
WP_000543834.1|1963845_1964397_+	SLATT domain-containing protein	NA	NA	NA	NA	NA
WP_039268535.1|1964374_1965745_+	reverse transcriptase	NA	NA	NA	NA	NA
WP_052968952.1|1965857_1966442_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.9	1.2e-104
WP_071940984.1|1966441_1969840_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	X2KTY7	Enterobacteria_phage	35.5	1.8e-11
WP_001233093.1|1969904_1970504_-	Ail/Lom family outer membrane beta-barrel protein	NA	A5LH44	Enterobacteria_phage	98.0	2.2e-109
WP_065749762.1|1970574_1974072_-	host specificity protein J	NA	A5LH43	Enterobacteria_phage	97.2	0.0e+00
WP_052970548.1|1974132_1974780_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	96.7	5.6e-111
WP_032158413.1|1974677_1975421_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.4	3.5e-149
WP_001152341.1|1975426_1976125_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.6	1.7e-134
WP_001596839.1|1976134_1976464_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	99.1	3.9e-60
WP_001596840.1|1976463_1979520_-|tail	phage tail tape measure protein	tail	A5LH38	Enterobacteria_phage	97.5	0.0e+00
WP_001161009.1|1979491_1979821_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001298500.1|1979829_1980216_-|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	100.0	3.3e-66
WP_000211128.1|1980276_1981020_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	98.0	1.6e-130
WP_001079419.1|1981030_1981432_-|tail	tail protein	tail	A5LH34	Enterobacteria_phage	99.2	1.9e-72
WP_000677106.1|1981428_1982007_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	100.0	4.2e-102
WP_021518232.1|1982018_1982294_-	phage protein	NA	K7PH43	Enterobacteria_phage	97.8	2.1e-43
WP_001097050.1|1982286_1982610_-	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001596842.1|1982696_1984724_-|protease	Clp protease ClpP	protease	A5LH30	Enterobacteria_phage	99.4	0.0e+00
WP_001596843.1|1984668_1986177_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.2	3.3e-287
WP_001072975.1|1986176_1986389_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000934105.1|1986385_1988488_-|terminase	phage terminase large subunit family protein	terminase	K7PH40	Enterobacteria_phage	99.7	0.0e+00
WP_000349509.1|1988487_1988979_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
WP_001205135.1|1989336_1989513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001139681.1|1989654_1989807_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	4.7e-21
WP_001300226.1|1989794_1990262_-|lysis	lysis protein	lysis	K7PH77	Enterobacteria_phage	100.0	2.9e-77
WP_000992100.1|1990258_1990792_-	lysozyme	NA	Q08J98	Stx2-converting_phage	94.4	3.6e-100
WP_001545374.1|1990855_1991206_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	95.2	2.2e-37
WP_000839596.1|1991210_1991426_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000799656.1|1991493_1992546_-	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	100.0	2.7e-208
WP_000917724.1|1992696_1992900_-	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	100.0	6.1e-32
WP_001361177.1|1993415_1993616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204819.1|1993700_1994066_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	82.6	1.6e-54
WP_021543098.1|1994083_1995073_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.1	3.6e-194
WP_001061444.1|1995080_1995890_-	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	100.0	1.8e-151
WP_021543097.1|1996294_1996621_-	LexA repressor	NA	A0A291AWY9	Escherichia_phage	98.1	1.7e-52
WP_072166167.1|1996620_1997115_-	PerC family transcriptional regulator	NA	U5P0U0	Shigella_phage	98.8	1.7e-88
WP_021543095.1|1997111_1998104_-	hypothetical protein	NA	U5P0A0	Shigella_phage	98.2	7.3e-94
WP_001250270.1|1998060_1998273_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	5.4e-15
WP_000514174.1|1998448_1999033_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	60.9	5.5e-57
WP_000205494.1|1999070_1999271_-	cell division protein	NA	NA	NA	NA	NA
WP_000450740.1|1999368_1999995_+	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	48.8	3.2e-47
WP_000357060.1|2000362_2000866_-	hypothetical protein	NA	A0A077K9U2	Edwardsiella_phage	47.6	1.2e-31
WP_000135682.1|2001327_2001690_+	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-60
WP_000081307.1|2001756_2002581_+	DUF2303 family protein	NA	U5P439	Shigella_phage	99.6	3.0e-149
WP_000008232.1|2002709_2003246_+	5'-deoxynucleotidase	NA	S5MW55	Escherichia_phage	100.0	7.4e-101
WP_001242725.1|2003236_2003599_+	hypothetical protein	NA	K7PH61	Enterobacteria_phage	97.4	3.4e-65
WP_085959875.1|2004217_2005446_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.0	6.3e-172
WP_001061342.1|2005743_2006316_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	97.9	8.7e-108
WP_001093916.1|2006352_2006634_+	pyocin activator PrtN family protein	NA	K7PGU0	Enterobacteria_phage	96.8	2.8e-43
WP_000390072.1|2006681_2006855_-	hypothetical protein	NA	K7PJQ2	Enterobacteria_phage	98.2	9.8e-23
2011568:2011584	attR	ACCGTCGCCAGCGCCGC	NA	NA	NA	NA
>prophage 7
NZ_CP016546	Escherichia coli strain O177:H21 chromosome, complete genome	5134536	2328913	2342525	5134536	tail,protease,portal,terminase,integrase,head,capsid	uncultured_Caudovirales_phage(91.67%)	21	2325537:2325551	2332720:2332734
2325537:2325551	attL	CCCACCAGCAGGGAA	NA	NA	NA	NA
WP_065749858.1|2328913_2330143_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	54.9	1.9e-131
WP_000953274.1|2330510_2330699_+	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.0	1.5e-13
WP_071940986.1|2330751_2331837_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_065749768.1|2331826_2332087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065749769.1|2332059_2332293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065749770.1|2332285_2332492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065749771.1|2332497_2332797_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
2332720:2332734	attR	CCCACCAGCAGGGAA	NA	NA	NA	NA
WP_065749772.1|2332793_2334200_+	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	54.4	2.0e-105
WP_065749860.1|2334402_2334654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032166737.1|2334650_2335076_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_059275766.1|2335112_2335643_+	ProQ/FinO family protein	NA	Q2A0A1	Sodalis_phage	35.0	2.8e-07
WP_001145404.1|2335633_2335882_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024226530.1|2336157_2337327_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	76.0	7.9e-164
WP_029593910.1|2337381_2337942_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	85.5	1.5e-88
WP_029593911.1|2337943_2339167_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	87.1	1.6e-212
WP_029593912.1|2339163_2339502_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	71.4	9.6e-38
WP_021557926.1|2339498_2339795_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	80.6	1.6e-41
WP_029593913.1|2339794_2340235_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	76.7	2.4e-65
WP_072248979.1|2340218_2340404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001353110.1|2340523_2340880_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	83.8	6.1e-51
WP_065749773.1|2340863_2342525_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	82.5	1.5e-277
>prophage 8
NZ_CP016546	Escherichia coli strain O177:H21 chromosome, complete genome	5134536	3196431	3290282	5134536	integrase,plate,transposase	Bluetongue_virus(13.04%)	78	3205790:3205816	3285987:3286013
WP_001339197.1|3196431_3197640_-|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_000573211.1|3198505_3198754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001075462.1|3198858_3199590_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_001100705.1|3200099_3200552_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_164965929.1|3200994_3202223_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	1.1e-171
WP_000792543.1|3202415_3204464_+	TonB-dependent siderophore receptor IreA	NA	A0A0P0I887	Acinetobacter_phage	33.5	1.1e-11
3205790:3205816	attL	ACTGAACCGCCCCGGAAATCCTGGAGA	NA	NA	NA	NA
WP_001126822.1|3208194_3208761_+	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_000991577.1|3209018_3209591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000958152.1|3209659_3209896_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_154071811.1|3209892_3210048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001167473.1|3210161_3210710_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001349534.1|3210728_3210977_-	osmoprotectant transport activator ProQ	NA	Q2A0A1	Sodalis_phage	39.1	8.3e-07
WP_001323513.1|3211045_3211237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032346664.1|3212829_3212943_+|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	74.3	1.2e-08
WP_001043260.1|3214573_3215389_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_000251875.1|3215475_3215778_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_001445143.1|3215671_3215923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021512463.1|3216543_3216810_-	P fimbrial regulatory protein KS71A	NA	NA	NA	NA	NA
WP_000930062.1|3217253_3217568_+	major pilus subunit operon regulatory protein PapB	NA	NA	NA	NA	NA
WP_001339197.1|3218463_3219672_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_000428546.1|3220185_3220779_+	tetracyline resistance-associated transcriptional repressor TetC	NA	NA	NA	NA	NA
WP_001089068.1|3220891_3222097_-	tetracycline efflux MFS transporter Tet(B)	NA	A0A2H4UVM2	Bodo_saltans_virus	24.4	3.0e-09
WP_000088606.1|3222178_3222802_+	tetracycline resistance transcriptional repressor TetR(B)	NA	NA	NA	NA	NA
WP_001284954.1|3222779_3223466_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000460651.1|3223473_3223860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000562370.1|3223852_3224173_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_000599533.1|3224616_3225822_+	sodium/glutamate symporter	NA	NA	NA	NA	NA
WP_001352368.1|3226187_3227396_-|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
WP_085967404.1|3227465_3228595_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.1	8.7e-51
WP_000904897.1|3228625_3229249_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	48.6	2.3e-37
WP_065749790.1|3229374_3232260_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	39.7	2.7e-189
WP_000018322.1|3232417_3233233_-	APH(3')-I family aminoglycoside O-phosphotransferase	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	99.6	7.9e-163
WP_000480968.1|3233450_3234287_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001082319.1|3234286_3235090_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
WP_000654934.1|3236307_3238818_+	P fimbrial usher protein PapC	NA	NA	NA	NA	NA
WP_000381395.1|3238849_3240421_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|3240440_3240788_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001682408.1|3240787_3241465_-|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000265730.1|3241595_3242330_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000597712.1|3242956_3243493_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_000723802.1|3243519_3244041_+	P fimbrial minor subunit PapE	NA	NA	NA	NA	NA
WP_000758687.1|3244658_3245669_+	P fimbria tip G-adhesin PapG-II	NA	NA	NA	NA	NA
WP_001350744.1|3246028_3246775_+	porin family protein	NA	NA	NA	NA	NA
WP_001026222.1|3246949_3248449_+	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_001339197.1|3251578_3252787_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_001218820.1|3253862_3255125_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	42.8	4.5e-80
WP_000779483.1|3255588_3255915_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001143297.1|3255911_3256175_-	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_001280433.1|3256246_3257113_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_000839291.1|3257197_3257395_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_000761676.1|3257406_3257895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854735.1|3257891_3258269_-	toxin	NA	NA	NA	NA	NA
WP_001285415.1|3258315_3258690_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_000692309.1|3258769_3258991_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	8.5e-11
WP_001366855.1|3259053_3259530_-	RadC family protein	NA	NA	NA	NA	NA
WP_000844100.1|3259545_3260025_-	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.8	8.9e-13
WP_001175148.1|3260106_3260925_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	40.1	2.5e-47
WP_001278287.1|3261014_3261248_-	DUF905 family protein	NA	NA	NA	NA	NA
WP_001097302.1|3261253_3261931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001282919.1|3262078_3262759_-	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_000010402.1|3262961_3263846_-	50S ribosome-binding GTPase	NA	NA	NA	NA	NA
WP_000147745.1|3264030_3265161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001075482.1|3266679_3267411_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_001389195.1|3267834_3268539_-	toll/interleukin-1 receptor domain-containing protein	NA	NA	NA	NA	NA
WP_001126801.1|3270116_3270683_+	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_000991581.1|3270940_3271501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001389194.1|3271569_3271800_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_029791258.1|3271837_3272068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001167446.1|3272067_3272568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001389193.1|3272656_3272842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000439135.1|3274462_3275308_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000950652.1|3276148_3276541_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_000042910.1|3276527_3276857_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_000877066.1|3278058_3283017_+	NERD domain-containing protein	NA	NA	NA	NA	NA
WP_001294844.1|3283016_3284564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001328257.1|3286929_3287859_+	DNA (cytosine-5-)-methyltransferase	NA	A0A1P8DJM9	Virus_Rctr41k	38.1	1.4e-51
3285987:3286013	attR	TCTCCAGGATTTCCGGGGCGGTTCAGT	NA	NA	NA	NA
WP_000301136.1|3287839_3288796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166426901.1|3289054_3290282_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.0	5.9e-170
>prophage 9
NZ_CP016546	Escherichia coli strain O177:H21 chromosome, complete genome	5134536	3590610	3597750	5134536		Escherichia_phage(83.33%)	6	NA	NA
WP_001278994.1|3590610_3591249_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590392.1|3591245_3592508_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_000847985.1|3592504_3593413_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001297141.1|3593608_3594376_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_001141333.1|3594426_3595083_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.7	2.8e-49
WP_001272898.1|3595188_3597750_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.3e-30
>prophage 10
NZ_CP016546	Escherichia coli strain O177:H21 chromosome, complete genome	5134536	3633103	3746349	5134536	tail,portal,terminase,integrase,plate,head,transposase,lysis,capsid,tRNA	Salmonella_phage(63.79%)	111	3676121:3676166	3706541:3706586
WP_000047176.1|3633103_3635734_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
WP_000906486.1|3635968_3636154_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_000273309.1|3637746_3638313_+	fructose-1-phosphate/6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
WP_001287457.1|3638309_3638738_+	DedA family protein	NA	NA	NA	NA	NA
WP_000611804.1|3638810_3640367_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_001130207.1|3640516_3641032_+	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_001295176.1|3641095_3642634_-	multidrug efflux MFS transporter permease subunit EmrB	NA	NA	NA	NA	NA
WP_001295175.1|3642650_3643823_-	multidrug efflux MFS transporter periplasmic adaptor subunit EmrA	NA	NA	NA	NA	NA
WP_000378442.1|3643949_3644480_-	multidrug efflux transporter EmrAB transcriptional repressor EmrR	NA	NA	NA	NA	NA
WP_000119763.1|3644570_3644906_-	L-valine transporter subunit YgaH	NA	NA	NA	NA	NA
WP_000445658.1|3644895_3645633_-	L-valine exporter subunit YgaZ	NA	NA	NA	NA	NA
WP_000165699.1|3645756_3646941_-	MFS transporter	NA	NA	NA	NA	NA
WP_001216527.1|3647231_3648224_-	glycine betaine/L-proline ABC transporter substrate-binding protein ProX	NA	NA	NA	NA	NA
WP_000774996.1|3648280_3649345_-	glycine betaine/L-proline ABC transporter permease ProW	NA	NA	NA	NA	NA
WP_000985494.1|3649337_3650540_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
WP_000777968.1|3650894_3651854_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.5	2.2e-132
WP_029402374.1|3651863_3654008_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.1	5.4e-195
WP_000080944.1|3653980_3654391_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.4	2.7e-18
WP_001223227.1|3654387_3654633_-	glutaredoxin-like protein NrdH	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
WP_001295174.1|3654880_3655210_-	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_000281320.1|3655361_3655706_+	YgaC family protein	NA	NA	NA	NA	NA
WP_000492656.1|3655742_3656192_-	L-alanine exporter AlaE	NA	NA	NA	NA	NA
WP_000115383.1|3656859_3657264_+	DNA-binding protein StpA	NA	NA	NA	NA	NA
WP_001229467.1|3657310_3657835_-	thiosulfate sulfurtransferase YgaP	NA	NA	NA	NA	NA
WP_000137280.1|3657844_3658144_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000508177.1|3658326_3658485_+	YqaE/Pmp3 family membrane protein	NA	NA	NA	NA	NA
WP_000522424.1|3658568_3659018_+	potassium binding protein Kbp	NA	A0A090DBR9	Clostridium_phage	39.5	2.0e-06
WP_000156811.1|3659018_3659681_-	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_029402375.1|3659701_3661102_-	GABA permease	NA	NA	NA	NA	NA
WP_065749800.1|3661412_3662693_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.9	9.3e-33
WP_000772689.1|3662706_3664155_-	NADP-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_029402377.1|3664177_3665446_-	L-2-hydroxyglutarate oxidase	NA	NA	NA	NA	NA
WP_000993087.1|3665465_3666443_-	carbon starvation induced protein CsiD	NA	NA	NA	NA	NA
WP_000340075.1|3672173_3672431_+	hypothetical protein	NA	A0A1S6L009	Salmonella_phage	69.2	1.2e-05
WP_000927517.1|3672516_3672636_+	hypothetical protein	NA	NA	NA	NA	NA
3676121:3676166	attL	TTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_001547641.1|3676283_3677309_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	95.3	1.4e-193
WP_023352525.1|3677310_3677943_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	90.5	6.9e-106
WP_000063849.1|3678062_3678311_+	hypothetical protein	NA	A0A1S6KZZ6	Salmonella_phage	71.6	3.4e-24
WP_065749801.1|3678343_3678853_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	93.5	4.3e-82
WP_000956182.1|3678860_3679061_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	98.5	7.1e-33
WP_001676487.1|3679024_3679366_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	97.3	3.9e-55
WP_001244230.1|3679433_3679667_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	97.4	1.1e-32
WP_000752619.1|3679666_3679894_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	3.5e-36
WP_000104175.1|3679890_3680748_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	92.6	5.4e-154
WP_065749802.1|3680744_3683159_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	96.6	0.0e+00
WP_001154431.1|3683312_3683501_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	96.8	1.6e-26
WP_001555842.1|3683511_3683745_+	DinI family protein	NA	E5G6M1	Salmonella_phage	98.7	4.0e-35
WP_000658059.1|3684127_3685168_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	88.4	7.7e-171
WP_001098431.1|3685167_3686934_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.7	0.0e+00
WP_065749803.1|3687076_3687910_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	92.1	3.1e-122
WP_021570734.1|3687926_3688985_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	92.9	3.8e-181
WP_000059191.1|3688988_3689639_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_000673523.1|3689734_3690199_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.6	6.4e-77
WP_000868175.1|3690198_3690402_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_000171568.1|3690405_3690621_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_001069928.1|3690601_3691114_+	lysozyme	NA	E5G6N1	Salmonella_phage	92.3	2.4e-88
WP_061350329.1|3691115_3691493_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	39.2	3.9e-16
WP_065749804.1|3691489_3691918_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	73.0	2.1e-45
WP_001039935.1|3692013_3692445_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	92.3	6.4e-71
WP_000829141.1|3692437_3692884_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	84.9	1.5e-62
WP_000993775.1|3692952_3693531_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	87.0	4.2e-94
WP_000177590.1|3693527_3693887_+	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	86.6	9.5e-52
WP_021532224.1|3693873_3694782_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.7	1.2e-143
WP_001086824.1|3694774_3695380_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	93.0	1.8e-111
WP_065749805.1|3695376_3697056_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	79.3	2.9e-151
WP_065749806.1|3697199_3697634_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	68.3	7.4e-51
WP_071940989.1|3697655_3698045_-	hypothetical protein	NA	F1BUP1	Erwinia_phage	44.8	1.4e-13
WP_065749807.1|3698075_3698642_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	85.7	6.4e-87
WP_000046120.1|3698784_3699957_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	2.1e-204
WP_053287667.1|3699966_3700482_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	94.7	6.2e-89
WP_001281009.1|3700536_3700839_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
WP_000763311.1|3700853_3700973_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_065749808.1|3700965_3704043_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	63.0	0.0e+00
WP_032141790.1|3704039_3704525_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.6	4.8e-67
WP_001011796.1|3704521_3705622_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	88.5	3.4e-177
WP_000980501.1|3705690_3705909_+	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	77.8	7.5e-28
WP_048231062.1|3705935_3706418_-	hypothetical protein	NA	Q19UP0	Mannheimia_phage	33.7	6.0e-17
WP_000162574.1|3707118_3707601_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
3706541:3706586	attR	TTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_000600190.1|3707732_3708209_+	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_001117838.1|3708198_3708489_+	RnfH family protein	NA	NA	NA	NA	NA
WP_029402457.1|3708550_3708892_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_000880910.1|3709040_3710702_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_029402458.1|3710787_3711666_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_001296310.1|3711788_3712382_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_077221315.1|3712436_3713723_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001338897.1|3713743_3714535_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_000460035.1|3714701_3716063_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000256450.1|3716311_3716560_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000043335.1|3716578_3717127_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000264777.1|3717157_3717925_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000065253.1|3717966_3718314_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000589828.1|3718390_3718873_-	OmpA family protein	NA	NA	NA	NA	NA
WP_000969030.1|3718888_3720115_-	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_001339197.1|3720485_3721694_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_000976004.1|3722110_3722476_-	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001168044.1|3722685_3723756_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
WP_000225221.1|3723766_3724888_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_000200116.1|3724930_3726091_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_001386991.1|3726189_3726237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000178456.1|3726340_3726682_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_000197686.1|3726952_3727690_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000079107.1|3727824_3728805_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_029402462.1|3728801_3729533_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_001235102.1|3729662_3732236_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_000230376.1|3738093_3739392_+	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
WP_001300818.1|3739388_3739712_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000949252.1|3739757_3741113_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_029402226.1|3741226_3743887_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_001307345.1|3743918_3744617_-	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_001098726.1|3744685_3745105_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_000997403.1|3745311_3746349_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
>prophage 11
NZ_CP016546	Escherichia coli strain O177:H21 chromosome, complete genome	5134536	4197026	4206468	5134536		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569325.1|4197026_4197953_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
WP_000783120.1|4197957_4198689_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|4198669_4198777_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|4198836_4199568_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|4199789_4201475_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|4201471_4202191_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|4202237_4202708_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|4202748_4203210_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001317947.1|4203334_4205335_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	96.1	0.0e+00
WP_001292774.1|4205331_4206468_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.1e-162
>prophage 12
NZ_CP016546	Escherichia coli strain O177:H21 chromosome, complete genome	5134536	4219032	4283576	5134536	tail,portal,holin,terminase,integrase,plate,head,lysis,capsid,tRNA	Escherichia_phage(34.69%)	77	4246280:4246307	4278492:4278519
WP_001295427.1|4219032_4221066_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
WP_001005448.1|4221197_4222307_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_001324851.1|4222569_4222851_+	YehE family protein	NA	NA	NA	NA	NA
WP_000830468.1|4223143_4223686_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000677395.1|4223766_4224441_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_029402506.1|4226949_4227984_+	putative fimbrial-like adhesin protein	NA	NA	NA	NA	NA
WP_000153067.1|4228065_4228404_-	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_000134576.1|4228622_4229447_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000019938.1|4229565_4229838_+	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_001195590.1|4230060_4230849_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000822274.1|4230845_4231646_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001315719.1|4231710_4232529_+	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.5	2.3e-24
WP_000434038.1|4232580_4233327_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000011973.1|4233300_4234266_-	sugar kinase	NA	NA	NA	NA	NA
WP_000846219.1|4234262_4235267_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	1.3e-13
WP_000858484.1|4235263_4236541_-	nucleoside permease	NA	NA	NA	NA	NA
WP_000129551.1|4236797_4237850_+	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_000289788.1|4238159_4239014_+	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000853892.1|4239042_4240305_+	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_000182899.1|4240314_4240767_+	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000823272.1|4240797_4241082_+	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_029402425.1|4241085_4242441_+	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_000844219.1|4242489_4243530_+	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000178556.1|4243629_4244409_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000807362.1|4244490_4245390_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_000716757.1|4245804_4246122_+	hypothetical protein	NA	NA	NA	NA	NA
4246280:4246307	attL	TAAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
WP_000985261.1|4246386_4247400_-|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.1	4.1e-193
WP_000020919.1|4247515_4247815_-	helix-turn-helix domain-containing protein	NA	Q1JS61	Enterobacteria_phage	100.0	2.4e-48
WP_001081582.1|4247936_4248212_+	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	100.0	1.3e-48
WP_162852172.1|4248222_4248393_+	hypothetical protein	NA	S4TNZ7	Salmonella_phage	98.2	3.9e-24
WP_029701701.1|4248389_4248890_+	hypothetical protein	NA	S4TTB7	Salmonella_phage	98.8	1.9e-90
WP_000557703.1|4248953_4249178_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_001754915.1|4249177_4249480_+	DUF5405 family protein	NA	A0A0F7LCL4	Escherichia_phage	100.0	3.5e-47
WP_061811594.1|4249479_4249704_+	TraR/DksA family transcriptional regulator	NA	A0A0F7LDG9	Escherichia_phage	97.3	5.5e-34
WP_029701698.1|4249700_4249976_+	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	100.0	1.5e-44
WP_065749814.1|4249965_4252251_+	replication endonuclease	NA	Q858T4	Yersinia_virus	97.5	0.0e+00
WP_053888438.1|4252250_4252703_+	DUF3850 domain-containing protein	NA	Q2P9X4	Enterobacteria_phage	97.3	3.2e-81
WP_053272972.1|4252702_4252909_+	hypothetical protein	NA	Q2P9X3	Enterobacteria_phage	97.0	1.1e-31
WP_042002655.1|4253138_4253870_+	hypothetical protein	NA	A0A218M4H5	Erwinia_phage	78.6	1.0e-108
WP_065749815.1|4253953_4254610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171843242.1|4254727_4254889_+	hypothetical protein	NA	M1TAP7	Escherichia_phage	94.3	4.0e-18
WP_061811597.1|4254927_4255962_-|portal	phage portal protein	portal	Q858W8	Yersinia_virus	99.4	5.5e-201
WP_065749816.1|4255961_4257734_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.7	0.0e+00
WP_001085974.1|4257907_4258762_+|capsid	GPO family capsid scaffolding protein	capsid	Q94MI4	Enterobacteria_phage	98.2	7.8e-137
WP_065749817.1|4258820_4259894_+|capsid	phage major capsid protein, P2 family	capsid	Q94MI3	Enterobacteria_phage	99.2	4.3e-201
WP_065749818.1|4259897_4260635_+|terminase	terminase endonuclease subunit	terminase	Q94MJ2	Enterobacteria_phage	96.7	8.3e-127
WP_000988633.1|4260734_4261244_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_024244865.1|4261243_4261447_+|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	98.5	1.2e-30
WP_000123124.1|4261450_4261732_+|holin	holin	holin	A0A0F7LDF8	Escherichia_phage	100.0	3.7e-43
WP_044694861.1|4261731_4262229_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	99.4	1.5e-92
WP_065749819.1|4262243_4262669_+	protein lysA	NA	A0A0F7LDU9	Escherichia_phage	92.2	1.4e-57
WP_065749820.1|4262656_4263082_+|lysis	LysB family phage lysis regulatory protein	lysis	U5N3W5	Enterobacteria_phage	93.6	4.4e-64
WP_001440152.1|4263053_4263227_+	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	96.5	2.3e-24
WP_065749821.1|4263189_4263657_+|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	98.1	2.5e-81
WP_001001787.1|4263649_4264102_+	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	99.3	2.4e-76
WP_065749822.1|4264173_4264959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065749823.1|4265042_4265678_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	96.7	3.2e-111
WP_000127164.1|4265674_4266022_+	GPW/gp25 family protein	NA	A0A0F7LDQ1	Escherichia_phage	100.0	1.3e-58
WP_001121470.1|4266026_4266935_+|plate	baseplate assembly protein	plate	A0A0F7LCJ3	Escherichia_phage	99.7	3.4e-162
WP_001285325.1|4266927_4267458_+|tail	phage tail protein I	tail	U5N0U8	Enterobacteria_phage	100.0	2.3e-102
WP_040100848.1|4267468_4269787_+|tail	tail fiber protein	tail	U5N099	Enterobacteria_phage	66.7	9.7e-214
WP_065749824.1|4269790_4270318_+|tail	tail fiber assembly protein	tail	U5N0T1	Enterobacteria_phage	94.9	8.9e-91
WP_061811609.1|4270522_4271278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001752380.1|4271788_4272979_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.7	3.7e-225
WP_001251417.1|4272991_4273510_+|tail	phage major tail tube protein	tail	Q858V0	Yersinia_virus	98.8	2.1e-92
WP_001031303.1|4273566_4273842_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_000785970.1|4273874_4273994_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_065749825.1|4273986_4276434_+|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	92.9	0.0e+00
WP_065749826.1|4276448_4276928_+|tail	phage tail protein	tail	Q7Y4C7	Escherichia_virus	98.7	2.5e-84
WP_065749827.1|4276927_4278091_+	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	98.7	1.0e-203
WP_000468308.1|4278172_4278391_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000476011.1|4278663_4280025_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	100.0	1.1e-217
4278492:4278519	attR	TAAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
WP_001220181.1|4280127_4280424_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001307279.1|4280425_4280722_-	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_000929408.1|4280930_4281263_-	YegP family protein	NA	NA	NA	NA	NA
WP_000137873.1|4281453_4282176_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	1.9e-30
WP_000675150.1|4282172_4283576_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.0	3.0e-32
>prophage 13
NZ_CP016546	Escherichia coli strain O177:H21 chromosome, complete genome	5134536	4330359	4337961	5134536		Enterobacteria_phage(33.33%)	7	NA	NA
WP_001116015.1|4330359_4331754_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	2.8e-19
WP_000183032.1|4331928_4332822_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	3.9e-46
WP_000699414.1|4333194_4334280_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.8	2.3e-101
WP_001023642.1|4334279_4335179_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.5	6.3e-28
WP_000857503.1|4335236_4336127_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	63.7	1.1e-104
WP_000956473.1|4336116_4337382_+	O177 family O-antigen flippase	NA	NA	NA	NA	NA
WP_024226092.1|4337394_4337961_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	57.8	1.9e-54
>prophage 14
NZ_CP016546	Escherichia coli strain O177:H21 chromosome, complete genome	5134536	4366058	4430588	5134536	transposase	Escherichia_phage(18.18%)	51	NA	NA
WP_000399648.1|4366058_4367039_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000450409.1|4367823_4368153_+	DUF496 family protein	NA	NA	NA	NA	NA
WP_001016348.1|4368253_4368436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001161660.1|4368924_4369038_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_000988599.1|4369050_4369245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001551305.1|4369703_4370072_-	type IV toxin-antitoxin system toxin CbtA	NA	NA	NA	NA	NA
WP_000692323.1|4370145_4370367_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
WP_001186773.1|4370429_4370906_-	RadC family protein	NA	NA	NA	NA	NA
WP_000860076.1|4370921_4371401_-	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.8	8.9e-13
WP_001234530.1|4371482_4372304_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.5	3.6e-46
WP_000846713.1|4372524_4372935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000775500.1|4372950_4373634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000102643.1|4373769_4374840_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_000203534.1|4374836_4375742_-	chemotaxis protein	NA	NA	NA	NA	NA
WP_000544732.1|4375738_4378135_-	dynamin family protein	NA	NA	NA	NA	NA
WP_001069705.1|4378352_4379225_-	GTPase family protein	NA	NA	NA	NA	NA
WP_000514100.1|4379308_4380460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000255944.1|4382082_4383105_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001323403.1|4383104_4383884_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	100.0	1.5e-139
WP_000349537.1|4383922_4384075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000813432.1|4384812_4385415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023141663.1|4385508_4385787_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_103758541.1|4385968_4387197_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	97.3	3.0e-174
WP_000221515.1|4388579_4389149_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_000270964.1|4389408_4389810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072174381.1|4389797_4390313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065749831.1|4392518_4393553_-	phosphotriesterase	NA	NA	NA	NA	NA
WP_000739816.1|4393555_4394521_-	DMT family transporter	NA	NA	NA	NA	NA
WP_001339197.1|4394663_4395872_-|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_065749832.1|4395975_4396674_-	cytoplasmic protein	NA	NA	NA	NA	NA
WP_000667429.1|4396687_4397902_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_065749833.1|4399445_4400846_-	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_000262197.1|4401068_4402367_-	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
WP_000677248.1|4402425_4403145_-	amino acid racemase	NA	NA	NA	NA	NA
WP_000705006.1|4406179_4407328_-	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	32.8	1.0e-51
WP_001198735.1|4407324_4407942_-	2-dehydro-3-deoxy-6-phosphogalactonate aldolase	NA	NA	NA	NA	NA
WP_000127080.1|4407925_4408804_-	2-dehydro-3-deoxygalactonokinase	NA	NA	NA	NA	NA
WP_065749834.1|4408800_4409490_-	D-galactonate utilization transcriptional regulator DgoR	NA	NA	NA	NA	NA
WP_085967273.1|4410685_4411898_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.8	2.6e-101
WP_000706914.1|4412118_4412253_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001033555.1|4414218_4415250_-	isoaspartyl peptidase/L-asparaginase	NA	NA	NA	NA	NA
WP_001333102.1|4416549_4416996_-	maturase	NA	NA	NA	NA	NA
WP_001333103.1|4417361_4417589_+	hypothetical protein	NA	A0A1W6JP07	Morganella_phage	81.0	5.6e-10
WP_000598813.1|4417641_4419003_-	C4-dicarboxylate transporter DcuC	NA	NA	NA	NA	NA
WP_000355772.1|4418999_4420256_-	peptidase T	NA	NA	NA	NA	NA
WP_000086506.1|4421121_4422522_+	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_000351505.1|4422677_4424012_+	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
WP_001012364.1|4424499_4425546_+	L-asparaginase 2	NA	NA	NA	NA	NA
WP_001067029.1|4426139_4426865_-	two-component system response regulator DcuR	NA	NA	NA	NA	NA
WP_000361270.1|4427843_4428500_-	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001339197.1|4429379_4430588_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
>prophage 15
NZ_CP016546	Escherichia coli strain O177:H21 chromosome, complete genome	5134536	4437554	4525153	5134536	tail,protease,holin,portal,terminase,integrase,head,capsid,transposase	Escherichia_phage(38.71%)	96	4427600:4427616	4520787:4520803
4427600:4427616	attL	GATAATATTTTCCAGAT	NA	NA	NA	NA
WP_001682408.1|4437554_4438232_+|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|4438231_4438579_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|4438598_4440170_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_170872140.1|4440554_4441733_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_001439105.1|4441759_4442701_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_000973159.1|4444372_4444918_+	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_001297350.1|4444914_4445658_+	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_001193786.1|4445669_4446749_+	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_072147500.1|4446810_4447746_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001011462.1|4448203_4449121_+	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_029402749.1|4449222_4450173_+	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_000943916.1|4450290_4451934_+	toxic metabolite efflux MATE transporter YeeO	NA	NA	NA	NA	NA
WP_000532923.1|4452563_4453280_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001060244.1|4453622_4455077_-	AMP nucleosidase	NA	NA	NA	NA	NA
WP_000378575.1|4455178_4456495_-	shikimate transporter	NA	NA	NA	NA	NA
WP_065749835.1|4456809_4457862_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_032288841.1|4458123_4465200_-	inverse autotransporter adhesin YeeJ	NA	NA	NA	NA	NA
WP_001474389.1|4465687_4466485_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000533615.1|4466720_4467746_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.9	3.4e-102
WP_000096344.1|4467745_4467949_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000048518.1|4468007_4470479_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.9	3.8e-59
WP_001090188.1|4470571_4470763_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|4470759_4470948_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001331716.1|4471348_4471513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171942.1|4471516_4471735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379575.1|4471894_4472050_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000362155.1|4472315_4472735_-	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	8.8e-25
WP_000391950.1|4472835_4473117_+	helix-turn-helix domain-containing protein	NA	K7PHA1	Enterobacteria_phage	72.6	6.5e-24
WP_000693835.1|4473100_4473526_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_023154928.1|4473597_4474668_+	phage replisome organizer protein	NA	A0A088CD36	Shigella_phage	65.2	5.5e-63
WP_065749836.1|4474708_4475131_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	93.5	2.3e-65
WP_021575571.1|4475127_4475601_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	75.5	4.0e-66
WP_001224672.1|4475745_4475928_+	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	96.7	2.0e-26
WP_000753060.1|4475920_4476097_+	hypothetical protein	NA	A0A2R2X2A8	Escherichia_phage	94.8	6.7e-27
WP_029402727.1|4476093_4476453_+	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	79.4	3.5e-38
WP_000951710.1|4476454_4476664_+	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	94.2	8.8e-34
WP_029402729.1|4476660_4477341_+	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	53.6	5.0e-54
WP_029402730.1|4477337_4477598_+	hypothetical protein	NA	A0A077SLR0	Escherichia_phage	95.3	6.0e-40
WP_000813267.1|4477892_4478048_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	72.5	5.4e-12
WP_050542959.1|4478287_4478584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024168546.1|4478811_4479090_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	50.0	2.5e-12
WP_061157899.1|4479091_4480147_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.1	1.3e-88
WP_029402772.1|4480147_4480513_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	1.1e-39
WP_021575731.1|4480509_4481199_+	antitermination protein Q	NA	I6PDF8	Cronobacter_phage	50.2	4.5e-58
WP_000839572.1|4482011_4482227_+|holin	class II holin family protein	holin	M1FN85	Enterobacteria_phage	98.6	5.3e-34
WP_021546095.1|4482231_4482582_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	95.2	2.2e-37
WP_000992100.1|4482645_4483179_+	lysozyme	NA	Q08J98	Stx2-converting_phage	94.4	3.6e-100
WP_001228685.1|4483395_4483581_+	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	80.3	6.4e-20
WP_001114684.1|4483821_4484307_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000671993.1|4484551_4484752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001140099.1|4484759_4485110_+	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	98.3	1.2e-64
WP_001317918.1|4485258_4485741_+|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	97.5	5.7e-84
WP_065749837.1|4485740_4488164_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FP96	Escherichia_phage	99.7	5.0e-197
WP_000614825.1|4488141_4488363_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_001168899.1|4488426_4488705_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_001038671.1|4488762_4489341_+	hypothetical protein	NA	A0A1W6JPH8	Morganella_phage	63.6	9.2e-57
WP_000201462.1|4489991_4490171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029402557.1|4490370_4490910_+	host cell division inhibitor Icd-like protein	NA	Q8SBF3	Shigella_phage	54.3	6.2e-15
WP_029402556.1|4490899_4491145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001307906.1|4491119_4491353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029400390.1|4491359_4491674_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_065749838.1|4491670_4493797_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	53.1	2.4e-174
WP_065749839.1|4494033_4494459_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000588636.1|4494474_4494771_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_029593909.1|4494803_4495052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024226530.1|4495325_4496495_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	76.0	7.9e-164
WP_029593910.1|4496549_4497110_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	85.5	1.5e-88
WP_029593911.1|4497111_4498335_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	87.1	1.6e-212
WP_029593912.1|4498331_4498670_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	71.4	9.6e-38
WP_021557926.1|4498666_4498963_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	80.6	1.6e-41
WP_029593913.1|4498962_4499403_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	76.7	2.4e-65
WP_072248979.1|4499386_4499572_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001353110.1|4499691_4500048_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	83.8	6.1e-51
WP_021530531.1|4500031_4501693_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	82.1	2.9e-276
WP_000478564.1|4502957_4503140_+	hypothetical protein	NA	A0A1B5FP99	Escherichia_phage	95.0	2.5e-24
WP_000466255.1|4503139_4504381_+|portal	phage portal protein	portal	U5P411	Shigella_phage	99.8	2.0e-242
WP_001193631.1|4504358_4505009_+|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	100.0	2.5e-119
WP_000257522.1|4505023_4506229_+|capsid	phage major capsid protein	capsid	A0A1B5FPI9	Escherichia_phage	99.3	1.0e-222
WP_000601355.1|4506279_4506468_+	hypothetical protein	NA	A0A1B5FP98	Escherichia_phage	100.0	7.2e-27
WP_000983037.1|4506479_4506785_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1B5FP86	Escherichia_phage	100.0	9.2e-40
WP_001147820.1|4506793_4507132_+|head	phage head closure protein	head	A0A1B5FP90	Escherichia_phage	99.1	1.6e-56
WP_000347790.1|4507131_4507578_+	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	80.4	2.3e-63
WP_001209399.1|4507574_4507919_+	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	100.0	4.2e-57
WP_000097533.1|4507978_4508683_+	hypothetical protein	NA	A0A1B5FP82	Escherichia_phage	96.2	1.5e-117
WP_000164661.1|4508697_4509069_+|tail	tail assembly protein	tail	A0A1B5FP91	Escherichia_phage	100.0	6.5e-64
WP_000978930.1|4509092_4509371_+	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	97.8	3.6e-43
WP_065749840.1|4509417_4512645_+|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	95.1	0.0e+00
WP_001330090.1|4512622_4512979_+|tail	phage tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	66.7	2.8e-40
WP_060565118.1|4512978_4513677_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	97.8	1.2e-132
WP_060565121.1|4513682_4514426_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	9.2e-150
WP_065749841.1|4514362_4514965_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	84.7	8.9e-87
WP_065749842.1|4515025_4518421_+	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	90.5	0.0e+00
WP_001233158.1|4518488_4519088_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	95.5	7.7e-107
WP_065749843.1|4519152_4522551_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	X2KTY7	Enterobacteria_phage	35.5	1.8e-11
4520787:4520803	attR	ATCTGGAAAATATTATC	NA	NA	NA	NA
WP_064261991.1|4522550_4523132_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	92.2	1.4e-100
WP_001079074.1|4524622_4525153_-	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	100.0	1.9e-56
>prophage 16
NZ_CP016546	Escherichia coli strain O177:H21 chromosome, complete genome	5134536	4913578	4986463	5134536	integrase,lysis,tail,transposase	Enterobacteria_phage(18.75%)	74	4963069:4963083	4991419:4991433
WP_001339197.1|4913578_4914787_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_000836079.1|4914981_4916001_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	9.7e-17
WP_001389342.1|4916058_4916187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000876976.1|4916188_4917469_-	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	62.6	1.0e-156
WP_000005552.1|4917503_4917755_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_077249007.1|4917827_4919846_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	57.0	1.5e-58
WP_000693867.1|4919873_4920299_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262357.1|4920370_4921441_+	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.2	4.2e-63
WP_001151216.1|4921481_4921904_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	8.2e-63
WP_014639476.1|4922095_4923058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023277548.1|4923073_4924075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001557860.1|4924483_4924591_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	100.0	3.8e-09
WP_021541900.1|4924635_4924848_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	2.3e-29
WP_001332495.1|4925306_4925585_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.3e-11
WP_023277547.1|4925586_4926636_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	2.9e-109
WP_000904114.1|4926648_4927023_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	1.1e-34
WP_000762863.1|4927019_4927841_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	59.0	1.2e-78
WP_000562553.1|4928742_4928874_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	100.0	3.7e-06
WP_000506936.1|4929240_4929669_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_001348108.1|4929840_4930215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000839561.1|4930466_4930682_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	95.8	5.9e-33
WP_000192451.1|4930686_4931031_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	95.2	2.2e-37
WP_001593363.1|4930996_4931269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001101168.1|4931374_4931917_+	lysozyme	NA	Q08J98	Stx2-converting_phage	87.8	3.0e-94
WP_001611687.1|4932178_4933876_+|tail	tail fiber protein	tail	X2KTY7	Enterobacteria_phage	61.6	1.4e-174
WP_001593356.1|4933875_4934457_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.3	2.5e-102
WP_000348576.1|4935277_4935475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000347482.1|4936191_4937475_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000527797.1|4937563_4939024_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	29.8	1.1e-42
WP_000214712.1|4939059_4939263_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000215549.1|4939440_4940127_-	DNA-binding transcriptional regulator YdfH	NA	NA	NA	NA	NA
WP_000636571.1|4940215_4940962_-	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
WP_001296767.1|4941098_4943144_+	peptidyl-dipeptidase Dcp	NA	NA	NA	NA	NA
WP_001024561.1|4943188_4943707_-	2-oxo-tetronate isomerase	NA	NA	NA	NA	NA
WP_000671730.1|4943982_4944375_+	YdeI family stress tolerance OB fold protein	NA	NA	NA	NA	NA
WP_000592826.1|4944629_4945520_+	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	37.7	1.1e-19
WP_000901367.1|4945738_4945834_-	protein MgtS	NA	NA	NA	NA	NA
WP_001054189.1|4945960_4947148_-	efflux MFS transporter YdeE	NA	NA	NA	NA	NA
WP_000087216.1|4947342_4948242_+	O-acetylserine/cysteine exporter	NA	NA	NA	NA	NA
WP_000577184.1|4948286_4948985_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000722571.1|4949183_4949495_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_001347941.1|4949609_4950932_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_065749852.1|4950959_4951271_+	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_001022770.1|4951326_4953000_+	carbohydrate porin	NA	NA	NA	NA	NA
WP_000012618.1|4953024_4954464_+	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	25.9	1.1e-29
WP_000803659.1|4954520_4954739_-	multiple antibiotic resistance protein MarB	NA	NA	NA	NA	NA
WP_000091199.1|4954770_4955154_-	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
WP_000843419.1|4955173_4955608_-	multiple antibiotic resistance transcriptional regulator MarR	NA	NA	NA	NA	NA
WP_000885033.1|4955819_4956485_+	NAAT family transporter MarC	NA	NA	NA	NA	NA
WP_000210799.1|4956509_4957700_-	L-arabinose MFS transporter	NA	NA	NA	NA	NA
WP_000366496.1|4959041_4959923_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001296740.1|4960023_4961412_+	succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000257428.1|4961475_4962402_+	glutaminase B	NA	NA	NA	NA	NA
WP_001191027.1|4962401_4962761_+	DUF4186 domain-containing protein	NA	NA	NA	NA	NA
WP_000558044.1|4962899_4964318_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.1	1.4e-18
4963069:4963083	attL	TGTTTGCCCGCTATG	NA	NA	NA	NA
WP_000854624.1|4964544_4965996_+	tagaturonate reductase	NA	NA	NA	NA	NA
WP_029402385.1|4966202_4967117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001286565.1|4967120_4967879_-	trans-aconitate 2-methyltransferase	NA	NA	NA	NA	NA
WP_000558520.1|4967935_4968226_-	(4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase	NA	NA	NA	NA	NA
WP_000774189.1|4968249_4969125_-	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase	NA	NA	NA	NA	NA
WP_000172475.1|4969151_4970174_-	autoinducer 2 ABC transporter substrate-binding protein LsrB	NA	NA	NA	NA	NA
WP_001222721.1|4970185_4971178_-	autoinducer 2 ABC transporter permease LsrD	NA	NA	NA	NA	NA
WP_000911143.1|4971177_4972206_-	autoinducer 2 ABC transporter permease LsrC	NA	NA	NA	NA	NA
WP_001194889.1|4972199_4973735_-	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	30.4	1.7e-20
WP_000154340.1|4973983_4974937_+	transcriptional regulator LsrR	NA	NA	NA	NA	NA
WP_000113127.1|4975015_4976608_+	autoinducer-2 kinase	NA	NA	NA	NA	NA
WP_112871921.1|4978327_4979025_-|transposase	IS1 family transposase	transposase	A0A077SLN4	Escherichia_phage	99.1	2.1e-132
WP_000412211.1|4979303_4979963_+	type A-1 chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
WP_000656305.1|4980163_4980541_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_065749854.1|4980607_4983574_-|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.5	0.0e+00
WP_000147567.1|4983576_4984137_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_000454193.1|4984262_4984613_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000845048.1|4984815_4985829_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001389366.1|4985989_4986463_+	trimethoprim-resistant dihydrofolate reductase DfrA17	NA	A0A1B2IBQ4	Erwinia_phage	33.1	7.6e-17
4991419:4991433	attR	TGTTTGCCCGCTATG	NA	NA	NA	NA
>prophage 1
NZ_CP016548	Escherichia coli strain O177:H21 plasmid unnamed2, complete sequence	90835	46492	54143	90835		uncultured_Caudovirales_phage(16.67%)	11	NA	NA
WP_001611950.1|46492_46780_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	48.4	3.8e-19
WP_029391923.1|46883_47474_+	serine acetyltransferase	NA	NA	NA	NA	NA
WP_001245884.1|48384_48687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000587689.1|48683_49310_-	ParA family plasmid-partitioning AAA ATPase	NA	E5FFJ3	Burkholderia_phage	31.1	2.0e-17
WP_000457521.1|49497_50769_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	60.4	1.7e-143
WP_000109062.1|50768_51206_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	48.4	1.1e-25
WP_000618110.1|51202_51451_-	DinI-like family protein	NA	Q2A098	Sodalis_phage	48.0	1.9e-14
WP_041498592.1|51751_52063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000273918.1|52172_53075_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_171843251.1|53144_53297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000086178.1|53459_54143_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.4	1.0e-30
>prophage 2
NZ_CP016548	Escherichia coli strain O177:H21 plasmid unnamed2, complete sequence	90835	58567	66190	90835	transposase	Stx2-converting_phage(50.0%)	8	NA	NA
WP_000381395.1|58567_60139_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|60158_60506_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001682408.1|60505_61183_-|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_029391984.1|61468_63427_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	29.9	5.6e-21
WP_029391985.1|63481_63916_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_001276270.1|63912_64632_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_029391986.1|64628_65225_+	hypothetical protein	NA	A0A0N7KZV3	Escherichia_phage	56.6	3.1e-15
WP_000117633.1|65689_66190_+	antirestriction protein ArdA	NA	G9FHQ1	Rhodococcus_virus	27.6	1.9e-05
>prophage 1
NZ_CP016549	Escherichia coli strain O177:H21 plasmid unnamed3, complete sequence	126046	13762	121322	126046	plate,holin,terminase,integrase,head,tail	Escherichia_phage(67.96%)	105	18441:18500	109194:113497
WP_065749875.1|13762_14128_-	ddrA	NA	Q1MVM8	Enterobacteria_phage	98.3	5.1e-45
WP_000164724.1|16044_16647_-	hypothetical protein	NA	Q1MVM6	Enterobacteria_phage	99.5	1.6e-99
WP_000580776.1|16633_17077_-	hypothetical protein	NA	A0A077SK09	Escherichia_phage	100.0	1.3e-82
WP_000887652.1|17073_17403_-|holin	holin	holin	Q37876	Escherichia_phage	100.0	1.3e-52
WP_015974241.1|17470_17752_-	LydC	NA	Q71TD9	Escherichia_phage	100.0	9.3e-47
WP_001697769.1|17879_18440_+	recombinase family protein	NA	Q71TD8	Escherichia_phage	99.5	8.0e-98
18441:18500	attL	ACCTTGGTTTAAGAGAACTCGGTACCAGCGGTGAAAAGATCCCCCTGTTGAGCACGGCTA	NA	NA	NA	NA
WP_065749893.1|19108_20089_+|tail	phage tail protein	tail	A0A0C4UQV0	Shigella_phage	90.2	1.6e-173
WP_039023050.1|20090_20618_+|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	94.3	1.3e-89
WP_015974242.1|20646_21180_-|tail	tail fiber assembly protein	tail	C9DGR0	Escherichia_phage	95.5	1.6e-92
WP_071941002.1|21182_24101_-|tail	tail fiber protein	tail	Q1MVL8	Enterobacteria_phage	90.4	0.0e+00
WP_001286328.1|24112_24547_-	hypothetical protein	NA	A0A077SLL3	Escherichia_phage	99.3	9.6e-75
WP_001189838.1|24625_25462_-	hypothetical protein	NA	A0A077SLH5	Escherichia_phage	99.3	5.8e-153
WP_000047920.1|25461_26895_-	bleomycin hydrolase	NA	Q71TP2	Escherichia_phage	100.0	6.3e-272
WP_000002800.1|26891_27248_-	hypothetical protein	NA	Q71TP1	Escherichia_phage	100.0	1.0e-61
WP_065749876.1|27247_30670_-	transglycosylase SLT domain-containing protein	NA	A0A077SK38	Escherichia_phage	98.9	0.0e+00
WP_000926346.1|30751_31633_-	hypothetical protein	NA	Q71TC9	Escherichia_phage	99.7	6.3e-174
WP_000523980.1|31647_32259_-	hypothetical protein	NA	Q71TN8	Escherichia_phage	99.5	2.9e-109
WP_000188920.1|32269_32836_-	hypothetical protein	NA	A0A077SK12	Escherichia_phage	99.5	6.6e-100
WP_065749877.1|32916_33456_-	DUF5384 family protein	NA	A0A077SL46	Escherichia_phage	98.9	3.1e-46
WP_000039791.1|33459_33972_-	hypothetical protein	NA	A0A077SK39	Escherichia_phage	100.0	4.5e-55
WP_000245703.1|34593_34815_+	host cell division inhibitor Icd-like protein	NA	Q38557	Escherichia_phage	97.3	3.6e-38
WP_065749878.1|34811_35846_+	phage antirepressor KilAC domain-containing protein	NA	A0A077SLI1	Escherichia_phage	98.3	4.2e-185
WP_001187871.1|36009_36810_+	phage antirepressor KilAC domain-containing protein	NA	Q1MVK4	Enterobacteria_phage	99.6	5.4e-148
WP_001379176.1|36839_37685_+	hypothetical protein	NA	Q1MVK3	Enterobacteria_phage	100.0	5.9e-153
WP_001369095.1|37735_37981_+	hypothetical protein	NA	A0A1B0VDM5	Salmonella_phage	45.0	3.5e-13
WP_001313475.1|38162_38318_+	type I toxin-antitoxin system toxin HokD	NA	A0A1I9LJU7	Stx_converting_phage	92.2	1.0e-15
WP_032192921.1|38434_38944_-	hypothetical protein	NA	Q1MVJ9	Enterobacteria_phage	100.0	8.6e-91
WP_000035301.1|38955_39537_-	hypothetical protein	NA	Q1MVJ8	Enterobacteria_phage	97.4	7.3e-102
WP_065749879.1|39572_40388_-	hypothetical protein	NA	A0A1B0V835	Salmonella_phage	98.2	3.2e-111
WP_065749880.1|40397_41987_-	hypothetical protein	NA	A0A1B0V7E4	Salmonella_phage	99.2	6.2e-305
WP_000067710.1|42047_43754_-	hypothetical protein	NA	Q71TM1	Escherichia_phage	100.0	0.0e+00
WP_000725191.1|44019_44985_-	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	99.4	1.7e-167
WP_000817632.1|44981_46187_-	AAA family ATPase	NA	Q1MVJ3	Enterobacteria_phage	100.0	2.0e-226
WP_001076427.1|46586_47447_-	RepB family plasmid replication initiator protein	NA	Q71TL8	Escherichia_phage	100.0	4.7e-158
WP_001281121.1|47764_48157_-	hypothetical protein	NA	A0A1B0VBK3	Salmonella_phage	99.2	2.6e-71
WP_000007770.1|48334_48757_-	hypothetical protein	NA	Q71TL5	Escherichia_phage	96.4	1.4e-57
WP_000890193.1|48796_49585_-	hypothetical protein	NA	A0A1B0V830	Salmonella_phage	90.1	3.0e-106
WP_065749881.1|50047_50332_+	hypothetical protein	NA	Q71TA2	Escherichia_phage	98.9	1.7e-48
WP_000472525.1|50324_51230_+	recombination-associated protein RdgC	NA	A0A077SK17	Escherichia_phage	98.7	8.5e-158
WP_065749882.1|51226_54514_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A077SL51	Escherichia_phage	98.9	0.0e+00
WP_000467133.1|56071_56506_+	tellurite resistance TerB family protein	NA	Q1MVI3	Enterobacteria_phage	100.0	8.1e-74
WP_000146942.1|56505_56670_+	DUF3927 family protein	NA	Q1MVI2	Enterobacteria_phage	98.1	6.9e-18
WP_065749884.1|57142_58507_+	replicative DNA helicase	NA	O80281	Escherichia_phage	99.3	1.4e-252
WP_065749885.1|58506_59505_+	hypothetical protein	NA	A0A1B0VCH7	Salmonella_phage	99.7	2.5e-195
WP_000535202.1|59551_60184_-|plate	baseplate protein	plate	Q71TK2	Escherichia_phage	100.0	6.9e-90
WP_000212027.1|60176_61193_-	hypothetical protein	NA	A0A077SLQ1	Escherichia_phage	99.1	6.6e-191
WP_000602717.1|61194_61980_-	hypothetical protein	NA	Q71T90	Escherichia_phage	99.6	4.6e-144
WP_000896801.1|61966_62695_-	hypothetical protein	NA	A0A077SK19	Escherichia_phage	100.0	9.3e-139
WP_001615607.1|62698_63916_-	hypothetical protein	NA	A0A077SL53	Escherichia_phage	99.8	3.2e-224
WP_000235786.1|63925_64303_-	hypothetical protein	NA	Q38620	Escherichia_phage	100.0	2.2e-67
WP_000840931.1|64449_64695_+	hypothetical protein	NA	Q71T86	Escherichia_phage	100.0	5.7e-40
WP_000943607.1|64697_65276_+	VRR-NUC domain-containing protein	NA	Q71T85	Escherichia_phage	99.5	5.7e-107
WP_000095380.1|65342_65498_+	hypothetical protein	NA	A0A077SK20	Escherichia_phage	100.0	1.2e-19
WP_012817939.1|65439_66102_+	hypothetical protein	NA	Q71T83	Escherichia_phage	100.0	4.5e-124
WP_000484110.1|65999_66626_+	norphogenetic protein	NA	Q71T82	Escherichia_phage	100.0	6.1e-123
WP_001354545.1|66622_67300_+	metallophosphoesterase	NA	A0A077SLQ6	Escherichia_phage	100.0	7.6e-135
WP_000267620.1|68079_68298_+	hypothetical protein	NA	Q71TI9	Escherichia_phage	100.0	3.4e-36
WP_000107675.1|68299_69562_+	hypothetical protein	NA	A0A1B0V7L1	Salmonella_phage	99.3	7.8e-234
WP_000021753.1|69634_70141_+	hypothetical protein	NA	Q71T77	Escherichia_phage	98.2	1.6e-92
WP_016231376.1|70407_73524_-	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	24.3	4.4e-28
WP_059338147.1|73645_74881_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_016231378.1|74877_76434_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	43.1	2.9e-105
WP_001190712.1|76616_76838_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
WP_016231379.1|76837_77218_+	type II toxin-antitoxin system death-on-curing family toxin	NA	Q71T66	Escherichia_phage	99.2	5.7e-63
WP_000113019.1|77222_77402_+	hypothetical protein	NA	Q71TH5	Escherichia_phage	98.3	2.7e-23
WP_016231380.1|77429_78473_+	DUF968 domain-containing protein	NA	A0A1B0VBU2	Salmonella_phage	98.8	2.0e-206
WP_016231381.1|78561_79014_+	hypothetical protein	NA	Q71T63	Escherichia_phage	99.3	2.0e-78
WP_016231382.1|79099_80293_+	hypothetical protein	NA	Q5QBP3	Enterobacteria_phage	96.5	2.2e-201
WP_000124150.1|80292_81777_+|terminase	terminase	terminase	Q71T61	Escherichia_phage	100.0	1.5e-292
WP_001376634.1|81998_82118_+	ash family protein	NA	NA	NA	NA	NA
WP_001615582.1|82136_82358_+	host cell division inhibitor Icd-like protein	NA	Q38557	Escherichia_phage	80.3	2.1e-25
WP_016231383.1|82354_83470_+	phage antirepressor Ant	NA	A0A077SLR9	Escherichia_phage	99.5	1.6e-206
WP_000611666.1|83502_84354_-	hypothetical protein	NA	A0A077SLM8	Escherichia_phage	99.6	2.8e-158
WP_000874156.1|84464_84674_-	hypothetical protein	NA	A0A077SK26	Escherichia_phage	100.0	1.8e-31
WP_000542338.1|85278_85500_+	hypothetical protein	NA	Q5QBN7	Enterobacteria_phage	97.3	4.2e-34
WP_065749886.1|85507_86539_+|integrase	tyrosine-type recombinase/integrase	integrase	Q71TG5	Escherichia_phage	99.7	2.2e-194
WP_065749872.1|86589_86901_+	lysogeny establishment protein	NA	Q71TG4	Escherichia_phage	99.0	3.6e-47
WP_071941003.1|87897_88539_+	maturation control protein	NA	A0A077SK30	Escherichia_phage	98.6	7.0e-114
WP_000747846.1|89954_90203_-	hypothetical protein	NA	Q71TG0	Escherichia_phage	100.0	1.8e-41
WP_000224043.1|90199_90640_-	hypothetical protein	NA	A0A077SLF0	Escherichia_phage	100.0	1.7e-79
WP_065749888.1|90673_97441_-	N-6 DNA methylase	NA	Q1MVN7	Enterobacteria_phage	98.4	0.0e+00
WP_000774703.1|97516_99226_+	hypothetical protein	NA	Q1MVN6	Enterobacteria_phage	100.0	0.0e+00
WP_065749889.1|99218_100238_+|head	head processing protein	head	Q1MVN5	Enterobacteria_phage	97.9	9.9e-179
WP_065749875.1|100270_100636_-	ddrA	NA	Q1MVM8	Enterobacteria_phage	98.3	5.1e-45
WP_065749890.1|100632_102552_-	hypothetical protein	NA	A0A1B0V7H1	Salmonella_phage	95.0	0.0e+00
WP_000164724.1|102553_103156_-	hypothetical protein	NA	Q1MVM6	Enterobacteria_phage	99.5	1.6e-99
WP_000580776.1|103142_103586_-	hypothetical protein	NA	A0A077SK09	Escherichia_phage	100.0	1.3e-82
WP_000887652.1|103582_103912_-|holin	holin	holin	Q37876	Escherichia_phage	100.0	1.3e-52
WP_015974241.1|103979_104261_-	LydC	NA	Q71TD9	Escherichia_phage	100.0	9.3e-47
WP_001697769.1|104388_104949_+	recombinase family protein	NA	Q71TD8	Escherichia_phage	99.5	8.0e-98
WP_171843254.1|105215_106511_+|tail	phage tail protein	tail	A0A222YYI1	Escherichia_phage	89.6	8.0e-234
WP_015974242.1|106513_107047_+|tail	tail fiber assembly protein	tail	C9DGR0	Escherichia_phage	95.5	1.6e-92
WP_039023050.1|107075_107603_-|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	94.3	1.3e-89
WP_065749891.1|107604_110610_-|tail	tail fiber protein	tail	Q71TD5	Escherichia_phage	88.7	0.0e+00
WP_001286328.1|110621_111056_-	hypothetical protein	NA	A0A077SLL3	Escherichia_phage	99.3	9.6e-75
WP_001189838.1|111134_111971_-	hypothetical protein	NA	A0A077SLH5	Escherichia_phage	99.3	5.8e-153
WP_000047920.1|111970_113404_-	bleomycin hydrolase	NA	Q71TP2	Escherichia_phage	100.0	6.3e-272
WP_000002800.1|113400_113757_-	hypothetical protein	NA	Q71TP1	Escherichia_phage	100.0	1.0e-61
109194:113497	attR	TAGCCGTGCTCAACAGGGGGATCTTTTCACCGCTGGTACCGAGTTCTCTTAAACCAAGGTATTGGATAACAGCAAGAACGCTTGTTTTGGCCAGAATATCGCGACCAACTGACGTTAAGTCAGTCTGAGAAACAGTGTCTGTACCGGTAAAGTACGGCAATTTATTTGCGCCTGTCGCAAGACCAGCAAGCGCGGTTAAAGTTGCATCAAGTGGCTGTTTCCCTGCCAGCGCATTTGTCATTGTTGTCGCAAAGTTCGGGTCATTGCCCAGTGCTGCTGCAAGCTCATTCAGGGTATCAAGAGCTTCAGGTGATGAGCCGACCAATGCAGAGATAGCAGCCCGTACGTAAGCAGTCGTAGCGATCTGCGTATTGTTTGTGCCCTGTGCAGCCGTAGGCGCAGTAGGGACACCCGTTAATGCAGGGCTTGCCAAAGGCGCTTTGAGAGCCAAGGCATTGTTGATAGTTGTGCTGTAATTCGGGTCGTTATTGATCGCAGCCGCTATTTCTTTCAGCGTATCCAGTGTGCCAGGCGCACCGTTGATAAGTGCAGTTATAGCTGCCTTAACAAAGGCTGTATTTGCGATCTGCGTGCTGTTTGTACCTTGCGCTGCCGTCGGCGCGGTTGGCGTTCCTGTCAGACTCGGGCTTTCTATTGGCGCTTTGGTATCAGCCAGATCTTTTATAGACTTAACAGCTTTAGGGGTAGCCGCCATTGTTTCGCTGTCGCTGTTAGTTGCGCTACTGAGCTGAACTAATCCCTTTTGCGTTGTGCTTGCATCCTGCGCCGTATACTTGCTTTTCGCCAGATCGTAGGCTTTTTTAACTGCCAGCGAACTTGCAGCAACATCACTTCTGGTACTGGTTACAGAGTCTGAAATATCAATGCCGATCGTGCGGTTGATACGCTCGGATGTATCAATCATCTCCTGGGTAATGGCAGATACACCAGCAGGGATATTCACCGTACAAACAAGCAGCTCCCCATCTCCTAACTGATATGAATCGGTATAGGTTCTGGCAACAAATTCAGCCGCATGAATATGTGACGCGGTATTCACCTGATAGGTATCTTCTCCAAGGAGGTATCTTCCCTTCAGCACAATTGCATATTTCTTGCCTGCACTAAGTGCAAGAGAAATATCCTTACGTTGCTGAATAGTTACCTGGTAGAATTCACCAATATCCACCGACGCCGCGCCTGCGGTTTTATCACCATCCACTGAGGTGATTAACAGGTTCATCCCACCGCCAGGCTTAGGTAAGAAACCGGCATAAAATCCCGGGTCAACAATCCCCCTGAATTTTCGGTTTAGCGCGGCTGACAGATATGGTTCGTGGTATTGCACATCAGCCACCAGAGCCAACGACTCGGGTGATGGGTAAGTAACTGATGTAACAACTGTAACGTCATTCATCAAGCATATCCTTATGCTGTTGTCGTGTTTATGGCCATAACTGCGGTATATGTTTTGCCCACATACAGCGAGTCTTCCTGGACACAAATAATGGCGATTGGCTTGTTCTCGTTATCCAGAACAACCAGAGTGTTGAATGGGTAGTTTTTCCCTTCCTGCAACTGGCTTTGATCAAGGTCCATTCGGACAGTAATTATCCCGCCTGAGTAGGTTGGGACGAGGTTGATGGTGCAAAATTGACTGGTCAGTTCTGCCAGATCGAAAACCTTTGGCAGTTCTCCAATCTCATAAGTGCCATCTCCTTTCTTAGTAACCAGTGAACTGGTACCGAAAACGGCCTTGCTGATTAAAAATCGAGAGCCTTTGTTAATGGACGATTCAGCGCGCCGCTGATAGTAATAGTCCAACAACTGACTCTTATAGAGGTTTGTTGAGACGTCAGACATGATTTTCCCTAATCAATGTTGTGAAGCCTCATTGTAAGAGAAGTAACTTGTCACCCCGCCCTGCGGACGGGGTGATTGTCAGGCGTCGCTATCCAGCAACAAATCATCTGCGCGTGTGCGATCAAACGTAGGTGTCGCTTTCACAATAGTGCCACCAGGCGTTGCGGTGATCGGGGCGCTAATCGACGTAACTCCAGTAAGCGAAGTTGTATCCGAAGTTTCAAACCAGCAGAATGCTTTTTCGGTATCAGAAATCTCGTTCAAAGTGATCATGTCGGCCTGTTCATTTACAACAACCGACAAATAGAGCGTAAGCCCATCAAACACTATATGCAGTGGCAGTAGAGGCTTTACGAACTGATTAAACTTTCTGAGAATTTCTTCTGTAATTGCGGACTGATCTATCGTGCCAGTAATACCCATTGTCCTGGCCAGGTCGTTTATGGGAATACTGATCATCCCTCTGGAAGTCAGAAACATCTCGCCGAATGTGCCGCCGGTAGTCTCCAGTGTGCTTTCTGGTATTAGAACCGTGCCATAGGGATGACGCTCAAGGTCCACCGGTGCATATATCGGATCCCATAAAACAGAAATACCGTTAAATTCGCGGTAAATTGTCTGGTTTATAGGGCGTTCAGTCCCCTTAAAGTGAATCTCATCAAGACGCTGTTGTAACAACATCGGAACGGAAGATGAGTTCGACGTTCTGATAGTAAAGAACTGGCCAAGTTCATTTGTCCTGGTCTCCAGATCCTCCTTGCTCATGGAAAAAATAGACTTCCGGTTGGTAATTCGCTCCAACCATGGGTCAACAAAGGTATCCATCATTGACTGAACCAAATCAGCCAATGATTTATAGAGCAATGACTTTTGCTTAGCTGATGTAAGCCGGTTATTAAACCAGGAACGCTGCATCACTCCTCCTCATACGAAATATTAAAGGTGGAGTTTTCTGTATCCAGATAAACGAAATCGTAAAAGCCGTTGGACTCATTCCACTCGACAAATTCCAGATAAAAGTCGCGGAAATAACCCAGCGTTTCGATAAATGCCCAAACGTCTTTTTTCTTGATTAGGATGTACTTGCCGACACGGTTCGGATCAAAGAAAGTTGAGTCACGCCCAAATTTTGTTTCCAGTGCCGACTTCAGCTCATCAGTCACGTTCTCAATGGTCAGGCTTGCCGATATCCGCCCGGTGATGGTGATCTTAAAGGGTAGTTTTCTGACCTCTTTATACGAGAATTTCTTGTTCAACTCATTCGGCACCTTCTTAAAGGCAGCCAAGATCATTTCTTCAAGCTCTGACTGGCTTTTGTTTGGATGCCATCCTGAAATAAATATCTTATTGATATTCTGAACATTATAAGCACCATCTAATTTTTCTTGCTGACCCTCTCCCCATGCCTTTACCCAGGACAGTCCCGGGATGTTACGCACCAGAAAATACGTATAGTCCCCGCCCCATACGACCTGATCATCATAGGCAAGGTAATATTGTGCACGGTTACGTGTGATCTCCGTTGTTTCGGCATCGGTACCTGCGGTTATAGGTGTCGTTGTCTTAACTGAAATCAAATTAGCTAAATTAGCCGCAGAATCGACAGGCGTCAGGTTTTGGCCAGCAACCAGGGTTATATCGCCGTTGGTGCACCATACCTTAAGCGTAATTGTCGAGCCTTCTGGCGGTATTTGCCCAATTAGCCCATCGCCGAATCGAACACCCAACTGCTCGGATGGTTTATAAAACTCAACGTAGACCTGGCTTTTACTACCGGCTAACCGGAACATAGTGCTGGAAGACCACTGCGTGGTCTTACCATCGGTCGTCACGAATACTTCCAGCTTATAGCAGACAGCAGTGAGAGCCTTTGATAACACGACTTCCAGAAATTCTTTGGCTGCCGTAACGGTATATGTCACCTCCTGGATTTCCAACTGTGCCACTTCTACCGTACCGGTGCCGTCAACCAACCTGCATACATCCATAGTCATGTAAGGGTACTGGTCGTCAGATATTAAAGGCATGTTTTTGGGGATTACCGCTGGGGCATCTTCACTTGTGGCGGTGATCTCAATCATCCCCGATGACGGTGTTGGCTTGGTACCAACGTAACTATTCGTTTCTGCCGCTGCCAGGATAGAGGAACGCCGCGTCGCGGTCGATATAAAGCCTTCAGCCAGCGCCGCATCGGCATACTGAAAGCACCTGTAGACAATCTGGGTAATAAACAATGTCAGCATCGAGACAAATTGAGAGCCGACAAACTTCGACCAGAATGAATCTTTCTCGACAAGCTCTTCAAACTCTGCACGAATACTGTCTTTAGTCGGTGTTGTTTTACTCATAGCACCACGTCCTGTGTGATAGTTATATCCCTGATACGAATGGATATTTTCAACTTATCAAAAGCATCTCCCTCGGCTACTGACAAGCCAGAA	NA	NA	NA	NA
WP_065749876.1|113756_117179_-	transglycosylase SLT domain-containing protein	NA	A0A077SK38	Escherichia_phage	98.9	0.0e+00
WP_000926346.1|117260_118142_-	hypothetical protein	NA	Q71TC9	Escherichia_phage	99.7	6.3e-174
WP_000523980.1|118156_118768_-	hypothetical protein	NA	Q71TN8	Escherichia_phage	99.5	2.9e-109
WP_000188920.1|118778_119345_-	hypothetical protein	NA	A0A077SK12	Escherichia_phage	99.5	6.6e-100
WP_065749877.1|119425_119965_-	DUF5384 family protein	NA	A0A077SL46	Escherichia_phage	98.9	3.1e-46
WP_000039791.1|119968_120481_-	hypothetical protein	NA	A0A077SK39	Escherichia_phage	100.0	4.5e-55
WP_000245703.1|121100_121322_+	host cell division inhibitor Icd-like protein	NA	Q38557	Escherichia_phage	97.3	3.6e-38
