The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP042968	Bradyrhizobium paxllaeri strain LMTR 21 chromosome, complete genome	8377719	1876307	1922554	8377719	protease,bacteriocin,transposase	Bacillus_phage(25.0%)	44	NA	NA
WP_065753774.1|1876307_1876844_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_065753773.1|1876881_1877187_-|protease	ATP-dependent Clp protease adapter ClpS	protease	NA	NA	NA	NA
WP_065753772.1|1877234_1877483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148635944.1|1877433_1877865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065753771.1|1878095_1878953_+	DUF1194 domain-containing protein	NA	NA	NA	NA	NA
WP_084030670.1|1879008_1882347_-	adenylate/guanylate cyclase domain-containing protein	NA	A0A218MLZ2	uncultured_virus	29.5	3.9e-14
WP_065753769.1|1882538_1882841_+	hypothetical protein	NA	F5B3X9	Synechococcus_phage	46.7	3.1e-11
WP_065753768.1|1882884_1883064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065753766.1|1883253_1883718_+	hypothetical protein	NA	A0A0F6WCY1	Sinorhizobium_phage	32.5	8.3e-08
WP_065753765.1|1883736_1884984_-	class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_065753764.1|1884976_1885732_-	TlyA family RNA methyltransferase	NA	NA	NA	NA	NA
WP_065753763.1|1885734_1886298_-	nucleoside 2-deoxyribosyltransferase	NA	NA	NA	NA	NA
WP_065753762.1|1886362_1888288_-	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_065753761.1|1888637_1889936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148635945.1|1890078_1890330_-	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_065753759.1|1890405_1891332_-	histone deacetylase family protein	NA	A0A2K9KZC4	Tupanvirus	32.9	1.3e-44
WP_065753807.1|1891481_1893140_-	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_065753758.1|1893251_1894016_-	crotonase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_065753757.1|1894146_1895100_+	ring-cleaving dioxygenase	NA	NA	NA	NA	NA
WP_065753756.1|1895367_1896216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065748933.1|1896287_1896503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065753755.1|1897297_1898425_+	hypothetical protein	NA	A0A292GC53	Xanthomonas_phage	31.4	3.8e-14
WP_065753806.1|1898560_1899601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065753754.1|1900135_1901917_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_065753753.1|1902871_1903084_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065753752.1|1903179_1903392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141688360.1|1903553_1903934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141688359.1|1904090_1904417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065750743.1|1904503_1905649_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_065751295.1|1907752_1909084_-	caspase family protein	NA	NA	NA	NA	NA
WP_065751294.1|1909097_1910000_-	DUF4399 domain-containing protein	NA	NA	NA	NA	NA
WP_065751293.1|1910248_1911124_+	formylglycine-generating enzyme family protein	NA	A0A075BSL8	Microcystis_phage	38.9	4.2e-37
WP_065751292.1|1911144_1911561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065751291.1|1911830_1912064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141688151.1|1912643_1912856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141688155.1|1912910_1913195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065751288.1|1913423_1913654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065751317.1|1913650_1913842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083519221.1|1913870_1914089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065751287.1|1914617_1914830_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065751286.1|1915559_1915772_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065751285.1|1916170_1919074_-|bacteriocin	NHLP bacteriocin export ABC transporter permease/ATPase subunit	bacteriocin	W8CYL7	Bacillus_phage	26.6	2.8e-24
WP_065751284.1|1919070_1921227_-|bacteriocin	NHLP family bacteriocin export ABC transporter peptidase/permease/ATPase subunit	bacteriocin	W8CYL7	Bacillus_phage	29.4	5.2e-36
WP_057833402.1|1921285_1922554_-|bacteriocin	NHLP bacteriocin system secretion protein	bacteriocin	NA	NA	NA	NA
>prophage 2
NZ_CP042968	Bradyrhizobium paxllaeri strain LMTR 21 chromosome, complete genome	8377719	2273817	2281494	8377719		Escherichia_phage(50.0%)	8	NA	NA
WP_065756533.1|2273817_2274552_+	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	28.6	8.8e-12
WP_065756532.1|2274535_2275240_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.6	3.4e-13
WP_141688650.1|2275146_2275446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065756531.1|2275842_2276505_-	aldolase	NA	A0A077SK32	Escherichia_phage	48.8	2.1e-49
WP_065756530.1|2276625_2277540_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	49.8	1.8e-70
WP_065756529.1|2277566_2278349_+	hydroxypyruvate isomerase family protein	NA	NA	NA	NA	NA
WP_065756528.1|2278345_2279623_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	41.4	1.5e-75
WP_065756527.1|2279802_2281494_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.0	4.5e-11
>prophage 3
NZ_CP042968	Bradyrhizobium paxllaeri strain LMTR 21 chromosome, complete genome	8377719	4520084	4529094	8377719	tRNA	uncultured_Mediterranean_phage(87.5%)	10	NA	NA
WP_065756503.1|4520084_4521467_-	peptidoglycan DD-metalloendopeptidase family protein	NA	Q8SBN9	Clostridium_phage	42.7	1.4e-18
WP_065756505.1|4521576_4522194_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	47.0	3.7e-27
WP_083519162.1|4522466_4522844_+	response regulator	NA	NA	NA	NA	NA
WP_065756502.1|4522877_4523645_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	39.1	1.7e-37
WP_065756500.1|4524221_4525553_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.3	2.9e-98
WP_065756499.1|4525664_4526486_-	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	46.7	5.7e-52
WP_065756498.1|4526482_4527001_-	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
WP_057834624.1|4527105_4527348_-	twin-arginine translocase TatA/TatE family subunit	NA	A0A1B1IVR9	uncultured_Mediterranean_phage	59.6	3.3e-08
WP_148635993.1|4527494_4528223_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	49.7	1.2e-42
WP_065756496.1|4528266_4529094_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	34.3	1.5e-28
>prophage 4
NZ_CP042968	Bradyrhizobium paxllaeri strain LMTR 21 chromosome, complete genome	8377719	4989325	5100010	8377719	transposase	uncultured_virus(16.67%)	82	NA	NA
WP_065750578.1|4989325_4990600_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_148635999.1|4991055_4991262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084030936.1|4991604_4991805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084030937.1|4991959_4993402_-	MFS transporter	NA	NA	NA	NA	NA
WP_065755949.1|4993830_4994745_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_065755950.1|4994819_4994999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065755951.1|4995575_4996640_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_065755954.1|4998871_5000608_+	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_141688597.1|5000823_5001090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065755955.1|5001896_5002712_-	ferredoxin--NADP reductase	NA	NA	NA	NA	NA
WP_065755965.1|5004942_5005467_+	molybdopterin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_141688598.1|5005436_5007920_+	EAL domain-containing protein	NA	A0A127AWB9	Bacillus_phage	41.5	3.4e-15
WP_084030938.1|5008708_5009227_-	hypothetical protein	NA	L7TKZ6	Rhizobium_phage	56.8	1.0e-38
WP_065755958.1|5009253_5009967_-	hypothetical protein	NA	A0A1C3NFQ1	Phage_NCTB	41.0	2.6e-40
WP_141688599.1|5010026_5010227_-	Flp family type IVb pilin	NA	NA	NA	NA	NA
WP_065755959.1|5010897_5012016_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_065755960.1|5012481_5014092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065755961.1|5014073_5014733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065755962.1|5016673_5016889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065755967.1|5016936_5017440_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_065755963.1|5017964_5018270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065755964.1|5018680_5019058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065756977.1|5019620_5021273_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	32.6	1.4e-60
WP_065756978.1|5021319_5021667_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	55.0	5.6e-33
WP_148636000.1|5021663_5022065_-|transposase	transposase	transposase	A0A1B0YZU7	Pseudomonas_phage	48.0	3.9e-06
WP_065756983.1|5022249_5022726_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_065750578.1|5023799_5025074_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_148636001.1|5027685_5028168_+|transposase	transposase	transposase	A0A1B0YZU7	Pseudomonas_phage	48.0	6.2e-06
WP_065756978.1|5028164_5028512_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	55.0	5.6e-33
WP_065756977.1|5028558_5030211_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	32.6	1.4e-60
WP_084031030.1|5031120_5031795_-	4'-phosphopantetheinyl transferase superfamily protein	NA	NA	NA	NA	NA
WP_065745660.1|5032263_5032476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057859050.1|5034697_5035354_-	FkbM family methyltransferase	NA	Q58M88	Prochlorococcus_phage	34.7	5.1e-11
WP_141688669.1|5035829_5036915_+	GDP-mannose 4,6-dehydratase	NA	M1HVG7	Acanthocystis_turfacea_Chlorella_virus	64.1	3.9e-133
WP_065756762.1|5036895_5037849_+	GDP-L-fucose synthase	NA	M1I5W5	Acanthocystis_turfacea_Chlorella_virus	55.3	5.0e-92
WP_084031032.1|5037986_5038109_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_065756763.1|5038813_5040178_-	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_084031034.1|5040174_5040453_-	helix-turn-helix transcriptional regulator	NA	A0A0K1LLP9	Caulobacter_phage	47.2	1.7e-08
WP_148636002.1|5040691_5042356_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	34.7	3.5e-64
WP_028340773.1|5042403_5042751_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	54.7	3.1e-31
WP_148636003.1|5042747_5043149_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_141688635.1|5043753_5044245_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_065756349.1|5044429_5046307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057859058.1|5047054_5047804_+	hypothetical protein	NA	A0A1X9SH03	Bradyrhizobium_phage	43.6	1.2e-43
WP_065756350.1|5047865_5048537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065756351.1|5049613_5050018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065756352.1|5050019_5050709_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_141688636.1|5050743_5052198_+	BON domain-containing protein	NA	NA	NA	NA	NA
WP_065756353.1|5052208_5052868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065756354.1|5052909_5053947_-	EscU/YscU/HrcU family type III secretion system export apparatus switch protein	NA	NA	NA	NA	NA
WP_065745421.1|5053943_5054765_-	EscT/YscT/HrcT family type III secretion system export apparatus protein	NA	NA	NA	NA	NA
WP_028350693.1|5054765_5055050_-	translocation protein	NA	NA	NA	NA	NA
WP_065756355.1|5055052_5055718_-	EscR/YscR/HrcR family type III secretion system export apparatus protein	NA	NA	NA	NA	NA
WP_065756356.1|5055710_5056766_-	YscQ/HrcQ family type III secretion apparatus protein	NA	NA	NA	NA	NA
WP_065756357.1|5056829_5057360_-	YscO family type III secretion system apparatus protein	NA	NA	NA	NA	NA
WP_065756358.1|5057335_5058685_-	EscN/YscN/HrcN family type III secretion system ATPase	NA	NA	NA	NA	NA
WP_065756359.1|5058681_5059305_-	HrpE/YscL family type III secretion apparatus protein	NA	NA	NA	NA	NA
WP_065756360.1|5059294_5059933_-	nodulation protein NolU	NA	NA	NA	NA	NA
WP_141688637.1|5059944_5060754_-	EscJ/YscJ/HrcJ family type III secretion inner membrane ring protein	NA	NA	NA	NA	NA
WP_065756364.1|5060816_5061086_-	nodulation protein	NA	NA	NA	NA	NA
WP_065756361.1|5062551_5065179_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065750578.1|5065779_5067054_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_141688696.1|5067702_5068401_+	nodulation protein NolW	NA	NA	NA	NA	NA
WP_148636004.1|5069694_5070660_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_141688601.1|5072887_5074306_-	insulinase family protein	NA	L7Y3X7	Megavirus	21.8	3.1e-21
WP_065755971.1|5075398_5075614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065755987.1|5076249_5077680_-	DUF1521 domain-containing protein	NA	NA	NA	NA	NA
WP_065755972.1|5078366_5078654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065755973.1|5078706_5078913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065755974.1|5079036_5079924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065755975.1|5079954_5080479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065755976.1|5080480_5080909_+	histidine kinase	NA	NA	NA	NA	NA
WP_065755977.1|5080920_5083038_+	EscV/YscV/HrcV family type III secretion system export apparatus protein	NA	NA	NA	NA	NA
WP_065755988.1|5083071_5083662_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_141688602.1|5084060_5084669_+	effector protein NopP	NA	NA	NA	NA	NA
WP_141688600.1|5085401_5085884_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_084030940.1|5088926_5089376_-	GNAT family N-acetyltransferase	NA	C5MKY6	Human_cytomegalovirus	31.1	4.1e-12
WP_065755981.1|5090658_5091831_-	PLP-dependent cysteine synthase family protein	NA	NA	NA	NA	NA
WP_065755982.1|5092884_5093481_+	methyltransferase	NA	NA	NA	NA	NA
WP_065755984.1|5094466_5094670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065755985.1|5097086_5097824_+	carbonic anhydrase	NA	NA	NA	NA	NA
WP_148636005.1|5099044_5100010_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP042968	Bradyrhizobium paxllaeri strain LMTR 21 chromosome, complete genome	8377719	5140785	5189517	8377719	transposase	Stx2-converting_phage(36.36%)	40	NA	NA
WP_065754572.1|5140785_5142435_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	42.2	4.4e-104
WP_065754573.1|5142505_5142853_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	54.7	4.4e-30
WP_065754574.1|5142852_5143272_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_065754575.1|5144109_5145648_+	long-chain-fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	28.9	7.7e-42
WP_141688435.1|5145613_5145817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084030790.1|5146512_5147133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065754577.1|5147584_5148262_-	2OG-Fe(II) oxygenase	NA	NA	NA	NA	NA
WP_065754586.1|5148299_5149478_-	GFA family protein	NA	NA	NA	NA	NA
WP_065754578.1|5150317_5151619_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_065754579.1|5152098_5152941_-	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
WP_065754580.1|5153686_5155510_-	nif-specific transcriptional activator NifA	NA	NA	NA	NA	NA
WP_084030787.1|5155729_5156566_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_084030788.1|5159173_5160136_+	sulfotransferase	NA	NA	NA	NA	NA
WP_148636006.1|5160279_5161932_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	34.6	1.7e-66
WP_028340773.1|5161980_5162328_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	54.7	3.1e-31
WP_148636007.1|5162324_5162726_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_141688613.1|5163474_5164446_-	nodulation protein NodZ	NA	NA	NA	NA	NA
WP_065756053.1|5164855_5166901_-	carbamoyltransferase	NA	R9TMT6	Synechococcus_phage	31.9	4.0e-54
WP_065756034.1|5166995_5167784_-	nodulation protein NodJ	NA	NA	NA	NA	NA
WP_065756035.1|5167787_5168702_-	nodulation factor ABC transporter ATP-binding protein NodI	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.7	1.2e-23
WP_148636008.1|5168711_5170421_-	nodulation protein NodU	NA	M1ICZ5	Pelagibacter_phage	28.6	2.0e-27
WP_065756037.1|5170430_5171054_-	methyltransferase	NA	NA	NA	NA	NA
WP_065756038.1|5171081_5172434_-	chitooligosaccharide synthase NodC	NA	NA	NA	NA	NA
WP_065756039.1|5172449_5173109_-	chitooligosaccharide deacetylase NodB	NA	NA	NA	NA	NA
WP_148636062.1|5173105_5173699_-	NodA family N-acyltransferase	NA	NA	NA	NA	NA
WP_141688614.1|5173734_5174163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065756042.1|5174563_5175508_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_065756044.1|5176307_5177261_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_141688615.1|5177423_5177621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084030959.1|5177858_5178068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084030956.1|5178213_5178921_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_065756046.1|5180007_5181114_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_065756048.1|5181721_5182831_+	histidinol-phosphate transaminase	NA	A0A1X6WGT4	Pacmanvirus	25.1	1.8e-16
WP_084030957.1|5183084_5184176_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_065756050.1|5184368_5184794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084030958.1|5185967_5186174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141688616.1|5186356_5186656_+	V-type ATPase 116kDa subunit family protein	NA	NA	NA	NA	NA
WP_148636009.1|5186958_5187474_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_065756978.1|5187470_5187818_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	55.0	5.6e-33
WP_065756977.1|5187864_5189517_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	32.6	1.4e-60
>prophage 6
NZ_CP042968	Bradyrhizobium paxllaeri strain LMTR 21 chromosome, complete genome	8377719	5224730	5294047	8377719	transposase	Stx2-converting_phage(16.67%)	40	NA	NA
WP_065754854.1|5224730_5226065_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	45.0	4.0e-47
WP_141688467.1|5226207_5226822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084030822.1|5230356_5230602_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_065750578.1|5234314_5235589_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_065756714.1|5236026_5237805_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_065756715.1|5237826_5238927_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.4	1.1e-26
WP_141688664.1|5239037_5239367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065756717.1|5242148_5242496_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	55.7	1.2e-32
WP_065756718.1|5242492_5242897_-	IS66 family insertion sequence hypothetical protein	NA	A0A1B0YZU7	Pseudomonas_phage	44.0	4.0e-06
WP_141688665.1|5243894_5244086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148636063.1|5244783_5246628_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	28.5	3.1e-29
WP_065756722.1|5247224_5248412_-	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_141688666.1|5250042_5250339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148635933.1|5250819_5252482_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	35.1	5.4e-65
WP_028340773.1|5252529_5252877_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	54.7	3.1e-31
WP_148635932.1|5252873_5253275_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_065754925.1|5254861_5256184_-	C4-dicarboxylate transporter DctA	NA	NA	NA	NA	NA
WP_065754926.1|5256431_5256740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141688479.1|5256736_5257006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141688483.1|5257366_5257561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065754927.1|5257720_5257900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065754950.1|5258609_5259002_-	adenosylmethionine decarboxylase	NA	V5UTX7	Synechococcus_phage	39.3	3.2e-13
WP_065754929.1|5261470_5267938_+	non-ribosomal peptide synthetase	NA	A0A2K9L3I8	Tupanvirus	25.0	1.2e-115
WP_065754930.1|5267930_5269352_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_141688480.1|5269323_5269725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065754932.1|5271909_5273238_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	32.5	7.8e-51
WP_065754933.1|5275318_5275570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141688484.1|5276155_5277904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065754935.1|5279717_5280494_-	acetoacetate decarboxylase family protein	NA	NA	NA	NA	NA
WP_065754936.1|5281770_5282529_+	glucose 1-dehydrogenase	NA	A0A0K0KVL6	Prochlorococcus_phage	44.3	4.4e-06
WP_065754937.1|5282574_5284335_+	oleate hydratase	NA	NA	NA	NA	NA
WP_065754940.1|5285657_5285981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065754941.1|5286125_5286845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065754942.1|5286981_5287707_-	hypothetical protein	NA	V5Q7H2	Xylella_phage	28.2	1.9e-14
WP_141688481.1|5287687_5287981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065754944.1|5288759_5289533_-	porin family protein	NA	NA	NA	NA	NA
WP_065754947.1|5291087_5292800_+	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_065754948.1|5292872_5293100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141688482.1|5293266_5293536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148635932.1|5293645_5294047_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP042968	Bradyrhizobium paxllaeri strain LMTR 21 chromosome, complete genome	8377719	5352844	5418642	8377719	protease,transposase,integrase	Leptospira_phage(25.0%)	51	5339203:5339224	5368714:5368735
5339203:5339224	attL	CCGGCTCTCGCCGCTTTCATCG	NA	NA	NA	NA
WP_084030805.1|5352844_5353081_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_065756975.1|5354385_5355585_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_065756976.1|5355599_5356481_-|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	31.6	9.5e-29
WP_141688543.1|5356895_5357126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065755469.1|5358650_5358917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141688544.1|5359315_5359537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084030884.1|5360407_5360809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065755472.1|5362692_5362923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065755474.1|5363822_5364170_-	(2Fe-2S) ferredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_065755475.1|5365632_5365833_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065755476.1|5366730_5366961_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141688549.1|5367058_5367295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065755477.1|5368374_5368824_-	Rieske 2Fe-2S domain-containing protein	NA	NA	NA	NA	NA
5368714:5368735	attR	CCGGCTCTCGCCGCTTTCATCG	NA	NA	NA	NA
WP_141688545.1|5369235_5369424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065755478.1|5369383_5370586_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	NA	NA	NA	NA
WP_065755503.1|5370582_5370852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065755479.1|5370886_5371246_-	DUF3024 domain-containing protein	NA	NA	NA	NA	NA
WP_065755480.1|5371261_5371501_-	nitrogen fixation protein NifZ	NA	NA	NA	NA	NA
WP_065755481.1|5371497_5371818_-	nitrogen fixation protein NifZ	NA	NA	NA	NA	NA
WP_065755482.1|5371814_5372588_-	LRV FeS4 cluster domain-containing protein	NA	NA	NA	NA	NA
WP_065755483.1|5372577_5373114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141688546.1|5373110_5373452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065755485.1|5373466_5373691_-	ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	53.8	3.3e-10
WP_065755486.1|5373701_5375264_-	nitrogenase cofactor biosynthesis protein NifB	NA	NA	NA	NA	NA
WP_141688547.1|5375537_5376404_-	SIR2 family protein	NA	NA	NA	NA	NA
WP_057861984.1|5376400_5376622_-	putative nitrogen fixation protein NifT	NA	NA	NA	NA	NA
WP_065755488.1|5376638_5377826_-	cysteine desulfurase NifS	NA	H7BUW1	unidentified_phage	38.9	1.9e-40
WP_065755489.1|5377822_5378113_-	NifU family protein	NA	NA	NA	NA	NA
WP_065755504.1|5378129_5378453_-	iron-sulfur cluster assembly accessory protein	NA	NA	NA	NA	NA
WP_065755490.1|5378732_5379323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065755491.1|5379338_5379746_-	Rieske 2Fe-2S domain-containing protein	NA	NA	NA	NA	NA
WP_141688548.1|5379914_5380094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057861979.1|5381047_5381251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065755492.1|5381370_5381661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065755493.1|5381782_5382034_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_065755496.1|5384861_5385647_-|protease	YopT-type cysteine protease domain-containing protein	protease	NA	NA	NA	NA
WP_084030886.1|5385797_5386223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065755497.1|5386567_5388058_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_065755498.1|5388158_5388788_+	FMN-binding negative transcriptional regulator	NA	NA	NA	NA	NA
WP_065755499.1|5388857_5389478_+	LysE family translocator	NA	NA	NA	NA	NA
WP_065755505.1|5390196_5390652_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_065755501.1|5390990_5391266_+	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_065756981.1|5391379_5392789_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_065756982.1|5392790_5393138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065756075.1|5393209_5393725_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_065756077.1|5396292_5397957_+	MFS transporter	NA	NA	NA	NA	NA
WP_065756078.1|5399181_5400126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065756079.1|5400285_5404527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141688619.1|5404523_5414666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141688620.1|5415831_5416302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065756977.1|5416989_5418642_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	32.6	1.4e-60
>prophage 8
NZ_CP042968	Bradyrhizobium paxllaeri strain LMTR 21 chromosome, complete genome	8377719	5540641	5587587	8377719	transposase	Stx2-converting_phage(25.0%)	29	NA	NA
WP_148635932.1|5540641_5541043_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_028340773.1|5541039_5541387_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	54.7	3.1e-31
WP_148635933.1|5541434_5543099_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	35.1	5.4e-65
WP_148636012.1|5543276_5544242_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_065755413.1|5544463_5546791_-	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_084030878.1|5549803_5549989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141688538.1|5550749_5552009_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.2	8.0e-13
WP_065755415.1|5552008_5552641_-	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_065755416.1|5554272_5555268_-	biotin synthase BioB	NA	NA	NA	NA	NA
WP_065755417.1|5555583_5556213_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_065755418.1|5556386_5556698_+	Dabb family protein	NA	NA	NA	NA	NA
WP_084030881.1|5556832_5558242_+	aminodeoxychorismate synthase component I	NA	S4VT78	Pandoravirus	43.5	9.5e-47
WP_057856396.1|5558238_5558823_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	48.2	5.1e-47
WP_065755419.1|5560995_5562252_-	CoA transferase	NA	NA	NA	NA	NA
WP_065755420.1|5563462_5564152_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_065755434.1|5564303_5564573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141688534.1|5565554_5566373_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_141688535.1|5566387_5567740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084030879.1|5570253_5571534_+	N-methyl-L-tryptophan oxidase	NA	NA	NA	NA	NA
WP_065755426.1|5571674_5572028_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	46.9	3.2e-20
WP_141688539.1|5572088_5572484_-|transposase	transposase	transposase	A0A0P0ZBP6	Stx2-converting_phage	60.5	1.3e-06
WP_141688536.1|5573012_5573306_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_148636013.1|5573806_5574499_-	hypothetical protein	NA	A0A2I2MPB4	Mycobacterium_phage	31.1	2.9e-12
WP_065755431.1|5577285_5577900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084030882.1|5579016_5579265_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065754804.1|5581279_5582656_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_065754807.1|5585084_5585456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141688462.1|5586790_5587336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084030812.1|5587332_5587587_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP042968	Bradyrhizobium paxllaeri strain LMTR 21 chromosome, complete genome	8377719	5792655	5799685	8377719	transposase	Stx2-converting_phage(16.67%)	8	NA	NA
WP_028340773.1|5792655_5793003_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	54.7	3.1e-31
WP_148635933.1|5793050_5794715_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	35.1	5.4e-65
WP_065755379.1|5794731_5795016_-	hypothetical protein	NA	A0A1X9SGV7	Bradyrhizobium_phage	46.0	2.5e-07
WP_065755378.1|5795012_5795531_-	hypothetical protein	NA	A0A0F6TJC8	Escherichia_coli_O157_typing_phage	44.3	5.4e-16
WP_065755377.1|5795578_5795848_-	hypothetical protein	NA	K7ZRM7	Xanthomonas_citri_phage	38.5	2.2e-05
WP_065755382.1|5796376_5796898_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_084030876.1|5796917_5797424_-	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_065755375.1|5798599_5799685_+	GDP-mannose 4,6-dehydratase	NA	M1HGM9	Acanthocystis_turfacea_Chlorella_virus	62.9	7.4e-132
>prophage 10
NZ_CP042968	Bradyrhizobium paxllaeri strain LMTR 21 chromosome, complete genome	8377719	6188905	6214352	8377719	protease,transposase,integrase	Salmonella_virus(100.0%)	24	6195391:6195407	6212475:6212491
WP_065750578.1|6188905_6190180_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_141688608.1|6190212_6190431_-	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_141688607.1|6190943_6191561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065756005.1|6191780_6193775_+	acyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	28.4	5.4e-56
WP_065756004.1|6194070_6194745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084030951.1|6195071_6195491_+	VanZ family protein	NA	NA	NA	NA	NA
6195391:6195407	attL	CGTTGATCGATGCGCTG	NA	NA	NA	NA
WP_141688606.1|6195607_6196330_+	PEPxxWA-CTERM sorting domain-containing protein	NA	NA	NA	NA	NA
WP_084030949.1|6196415_6197036_-	prepilin peptidase	NA	NA	NA	NA	NA
WP_065756001.1|6197032_6197644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065756000.1|6197640_6198249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065755999.1|6198245_6199370_-	PilN domain-containing protein	NA	NA	NA	NA	NA
WP_084030948.1|6199775_6200420_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_065755997.1|6200416_6200839_-	type II secretion system protein	NA	NA	NA	NA	NA
WP_065755996.1|6200859_6201300_-	type II secretion system protein GspH	NA	NA	NA	NA	NA
WP_065755995.1|6201296_6202562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084030947.1|6202576_6204358_-	secretion system protein E	NA	NA	NA	NA	NA
WP_141688605.1|6204463_6205420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141688604.1|6205807_6207544_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_065755993.1|6207640_6208135_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_065755992.1|6208530_6209502_-|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_084030945.1|6209498_6210533_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_148636026.1|6210529_6212263_-|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_084030944.1|6212306_6213341_-	hypothetical protein	NA	NA	NA	NA	NA
6212475:6212491	attR	CAGCGCATCGATCAACG	NA	NA	NA	NA
WP_065755990.1|6213374_6214352_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
