The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP016586	Salmonella enterica subsp. enterica serovar Heidelberg strain SH13-004 chromosome, complete genome	4750331	371625	415221	4750331	protease,coat,integrase,terminase,lysis,holin,portal	Enterobacteria_phage(44.44%)	64	375472:375517	414737:414782
WP_001043660.1|371625_372678_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.5	2.2e-112
WP_001285275.1|372960_374064_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.8	6.9e-61
WP_000893221.1|374075_375326_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	48.2	2.1e-98
375472:375517	attL	ATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCA	NA	NA	NA	NA
WP_000051900.1|375531_376695_-|integrase	site-specific integrase	integrase	A0A075B8E2	Enterobacteria_phage	99.7	2.4e-229
WP_000016640.1|376924_377560_-	hypothetical protein	NA	A0A075B8I7	Enterobacteria_phage	99.5	1.3e-120
WP_001277769.1|377660_377840_-	Eag protein	NA	A0A075B8F7	Enterobacteria_phage	98.3	1.6e-28
WP_031613308.1|377936_378623_-	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	52.8	1.3e-52
WP_000224223.1|378633_378897_-	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	2.0e-30
WP_001289978.1|378898_379384_-	ead/Ea22-like family protein	NA	A5VWB3	Enterobacteria_phage	86.1	1.3e-43
WP_000812182.1|379380_380007_-	hypothetical protein	NA	A5VWB1	Enterobacteria_phage	71.2	7.1e-71
WP_001682200.1|380003_380168_-	DUF2737 family protein	NA	A0A2I6PID4	Escherichia_phage	98.1	1.6e-22
WP_001111313.1|380178_380475_-	DUF2856 family protein	NA	Q76H42	Enterobacteria_phage	90.8	3.9e-43
WP_000031375.1|380805_381423_-	ERF family protein	NA	A0A0N7CFJ3	Salmonella_phage	100.0	3.3e-105
WP_001163402.1|381419_381563_-	hypothetical protein	NA	A0A075B8I9	Enterobacteria_phage	100.0	3.2e-19
WP_000158027.1|381552_381741_-	DUF5444 family protein	NA	A0A075B8F9	Enterobacteria_phage	100.0	1.4e-30
WP_000582314.1|381721_381880_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A0A075B8H4	Enterobacteria_phage	100.0	4.0e-23
WP_000776964.1|381965_382277_-	superinfection exclusion protein	NA	A0A075B8E5	Enterobacteria_phage	100.0	1.1e-48
WP_001737461.1|382424_382628_-	DUF551 domain-containing protein	NA	A0A0N7CAQ5	Salmonella_phage	100.0	1.7e-34
WP_000651935.1|382627_382864_-	hypothetical protein	NA	A0A075B8J0	Enterobacteria_phage	100.0	4.3e-37
WP_000213983.1|382900_383095_-	hypothetical protein	NA	A0A075B8G0	Enterobacteria_phage	100.0	2.5e-30
WP_001682202.1|383309_383888_+	superinfection exclusion B family protein	NA	A0A075B8E6	Enterobacteria_phage	100.0	8.8e-92
WP_000216175.1|383908_384211_-	hypothetical protein	NA	B8K1E6	Salmonella_phage	98.0	1.1e-48
WP_001095984.1|384564_385215_-	LexA family transcriptional regulator	NA	B1B6L9	Salmonella_phage	100.0	5.4e-122
WP_000276884.1|385295_385481_+	Cro/Cl family transcriptional regulator	NA	Q5G8T3	Enterobacteria_phage	100.0	5.4e-27
WP_000424167.1|385587_385866_+	lambda phage CII family protein	NA	Q5G8T2	Enterobacteria_phage	100.0	2.5e-44
WP_001125981.1|385900_386047_+	DUF2740 family protein	NA	A0A075B8K7	Enterobacteria_phage	100.0	1.5e-19
WP_000067075.1|386039_386855_+	replication protein	NA	A0A075B8J2	Enterobacteria_phage	100.0	9.4e-148
WP_001248406.1|386851_388228_+	DNA helicase	NA	A0A075B8G2	Enterobacteria_phage	100.0	3.3e-254
WP_000736921.1|388301_388739_+	recombination protein NinB	NA	A8CGE3	Salmonella_phage	100.0	1.3e-79
WP_000679702.1|388735_388909_+	hypothetical protein	NA	C6ZR56	Salmonella_phage	100.0	5.2e-32
WP_000113772.1|388875_389052_+	NinE family protein	NA	I6RSQ2	Salmonella_phage	100.0	4.6e-28
WP_001531428.1|389054_389387_+	DUF2591 domain-containing protein	NA	A0A075B8G3	Enterobacteria_phage	100.0	3.5e-61
WP_000950959.1|389379_389556_+	protein ninF	NA	I6S668	Salmonella_phage	100.0	2.5e-26
WP_001129733.1|389548_390160_+	recombination protein NinG	NA	A0A075B8E9	Enterobacteria_phage	100.0	1.3e-98
WP_000036317.1|390156_390381_+	hypothetical protein	NA	Q5G8R9	Enterobacteria_phage	100.0	2.2e-38
WP_000149925.1|390377_390581_+	phage NinH family protein	NA	A0A075B8J4	Enterobacteria_phage	100.0	7.2e-33
WP_000219131.1|390561_390741_+	hypothetical protein	NA	A0A1U8QR34	Salmonella_phage	100.0	1.4e-24
WP_001235453.1|390737_391361_+	antitermination protein	NA	A0A075B8H9	Enterobacteria_phage	100.0	2.3e-114
WP_000286100.1|391799_392003_+|holin	phage holin family protein	holin	I6R0S9	Salmonella_phage	100.0	1.1e-33
WP_000074137.1|391980_392478_+	lysozyme	NA	A0A1R3Y5W5	Salmonella_virus	97.0	6.0e-89
WP_001531485.1|392566_393004_+|lysis	lysis protein	lysis	O80289	Bacteriophage	99.3	9.1e-73
WP_001177703.1|393216_393903_+	Rha family transcriptional regulator	NA	A0A192Y918	Salmonella_phage	99.6	4.7e-124
WP_000807785.1|394205_394448_+	DUF2560 family protein	NA	A0A0M4R322	Salmonella_phage	100.0	7.5e-37
WP_001278047.1|394449_394629_+	hypothetical protein	NA	Q9AZ02	Salmonella_phage	91.5	3.0e-22
WP_000729925.1|394652_395141_+	DNA-packaging protein	NA	O80290	Bacteriophage	100.0	2.9e-88
WP_000417849.1|395118_396618_+|terminase	terminase large subunit	terminase	A0A192Y824	Salmonella_phage	99.8	1.4e-306
WP_000774656.1|396617_398795_+|portal	portal protein	portal	A0A2H4FNE2	Salmonella_phage	99.9	0.0e+00
WP_000433852.1|398808_399720_+	scaffold protein	NA	A0A192Y6T4	Salmonella_phage	100.0	4.9e-161
WP_001196938.1|399719_401012_+|coat	coat protein	coat	A0A192Y6V4	Salmonella_phage	100.0	3.2e-243
WP_000684729.1|401050_401260_+	hypothetical protein	NA	A0A192Y697	Salmonella_phage	100.0	1.3e-32
WP_001166098.1|401243_401744_+	packaged DNA stabilization gp4 family protein	NA	I1TEJ0	Salmonella_phage	99.4	5.5e-90
WP_001122424.1|401703_403122_+	packaged DNA stabilization protein gp10	NA	A0A075B8I2	Enterobacteria_phage	100.0	7.6e-278
WP_000774927.1|403125_403827_+	hypothetical protein	NA	A0A192Y6T9	Salmonella_phage	100.0	8.8e-78
WP_000627697.1|403826_404282_+	DUF2824 family protein	NA	A0A192Y6V9	Salmonella_phage	100.0	5.2e-87
WP_000964902.1|404284_404977_+	hypothetical protein	NA	G5DA80	Enterobacteria_phage	98.7	1.2e-108
WP_000246945.1|404986_406282_+	phage DNA ejection protein	NA	Q716G3	Shigella_phage	84.5	2.1e-181
WP_001029838.1|406281_408279_+	hypothetical protein	NA	Q716G2	Shigella_phage	94.9	0.0e+00
WP_000749288.1|408369_408855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023602519.1|409257_409545_-	Arc family DNA-binding protein	NA	A0A088CPT2	Enterobacteria_phage	67.8	1.9e-26
WP_000129930.1|409647_411651_+	endorhamnosidase	NA	A0A2H4FWI0	Salmonella_phage	99.9	0.0e+00
WP_000671495.1|411709_413167_-	glucosyltransferase domain-containing protein	NA	A0A192Y7W8	Salmonella_phage	100.0	4.5e-241
WP_000703640.1|413156_414089_-	glycosyltransferase family 2 protein	NA	A0A192Y8W7	Salmonella_phage	100.0	5.5e-176
WP_000915528.1|414085_414448_-	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	100.0	5.0e-61
WP_001683918.1|414945_415221_+	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	64.1	1.9e-23
414737:414782	attR	ATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCA	NA	NA	NA	NA
>prophage 2
NZ_CP016586	Salmonella enterica subsp. enterica serovar Heidelberg strain SH13-004 chromosome, complete genome	4750331	1019447	1027470	4750331	transposase,protease	Dickeya_phage(14.29%)	8	NA	NA
WP_001201751.1|1019447_1020566_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
WP_000125890.1|1020562_1022509_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	42.3	9.1e-40
WP_000447499.1|1022638_1022860_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000520789.1|1023183_1023504_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000934063.1|1023534_1025811_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000502119.1|1026001_1026460_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_001117984.1|1026733_1026931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001531374.1|1027092_1027470_-	hypothetical protein	NA	A0A077KET4	Ralstonia_phage	40.2	1.7e-19
>prophage 3
NZ_CP016586	Salmonella enterica subsp. enterica serovar Heidelberg strain SH13-004 chromosome, complete genome	4750331	1078079	1176037	4750331	transposase,protease,tRNA,terminase,lysis,holin,portal,tail	Salmonella_phage(44.64%)	102	NA	NA
WP_001154025.1|1078079_1078883_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_001288828.1|1078875_1080198_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_000060025.1|1080178_1080883_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_000572753.1|1080882_1085349_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_000925883.1|1085693_1087514_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000357052.1|1087773_1088322_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
WP_001109471.1|1088349_1088997_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000462653.1|1089058_1090249_-	aspartate transaminase	NA	NA	NA	NA	NA
WP_000977713.1|1090433_1091525_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	51.7	2.2e-99
WP_000117870.1|1092131_1093532_-|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
WP_000762342.1|1093732_1094194_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000544849.1|1094510_1095725_+	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000893206.1|1095969_1097403_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000191413.1|1097483_1098686_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001262307.1|1098880_1100173_-	DUF3596 domain-containing protein	NA	S4TSP2	Salmonella_phage	100.0	3.4e-253
WP_000065276.1|1100217_1100466_-	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001682304.1|1100506_1100746_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	98.7	3.3e-37
WP_000189634.1|1100751_1101621_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	86.3	7.2e-146
WP_000187054.1|1101617_1102298_-	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	97.8	3.3e-130
WP_000100830.1|1102294_1103080_-	phage recombination protein Bet	NA	A0A0M4RD39	Salmonella_phage	98.8	2.4e-148
WP_000995352.1|1103085_1103382_-	host-nuclease inhibitor protein Gam	NA	A0A0M5M5Z9	Salmonella_phage	100.0	1.1e-48
WP_000186242.1|1103472_1103673_-	cell division protein FtsZ	NA	G8C7T2	Escherichia_phage	48.4	2.4e-12
WP_000373338.1|1103960_1104167_+	hypothetical protein	NA	K7P7I0	Enterobacteria_phage	67.6	1.6e-16
WP_000091280.1|1104193_1104628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000439725.1|1104629_1105055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001230956.1|1105097_1105493_-	helix-turn-helix domain-containing protein	NA	K7PM35	Enterobacteria_phage	72.5	3.5e-47
WP_000992434.1|1105597_1105834_+	helix-turn-helix domain-containing protein	NA	A0A0M4QX15	Salmonella_phage	73.1	9.0e-27
WP_015675517.1|1105799_1106174_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	1.9e-63
WP_000024046.1|1106265_1107171_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	99.7	9.1e-176
WP_000788826.1|1107167_1107869_+	hypothetical protein	NA	A0A0M3ULE2	Salmonella_phage	99.1	1.9e-128
WP_023602525.1|1107913_1108315_+	ParB/RepB/Spo0J family partition protein	NA	S4TTI6	Salmonella_phage	98.5	5.4e-72
WP_000215887.1|1108311_1108845_+	hypothetical protein	NA	A0A192Y7N1	Salmonella_phage	89.8	8.1e-92
WP_000224239.1|1108846_1109104_+	hypothetical protein	NA	A0A192Y5W0	Salmonella_phage	95.3	4.5e-40
WP_000208143.1|1109114_1109516_+	hypothetical protein	NA	I6R0R2	Salmonella_phage	82.0	1.2e-18
WP_000877758.1|1109623_1110268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001217669.1|1110498_1110732_+	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	5.6e-37
WP_014343878.1|1110848_1111097_+	hypothetical protein	NA	A0A0U2C0C8	Salmonella_phage	100.0	1.6e-42
WP_000929790.1|1111131_1111734_+	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.5	7.5e-110
WP_001096547.1|1111942_1112554_+	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.5	4.2e-92
WP_001617856.1|1112550_1112697_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
WP_001047631.1|1112686_1113484_+	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.6	2.3e-151
WP_000508329.1|1113650_1113869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000658038.1|1114149_1114338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001682303.1|1114540_1114843_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_000301013.1|1114820_1115360_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	72.4	2.2e-76
WP_001080030.1|1115667_1116162_+|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.3	2.2e-59
WP_000371784.1|1116372_1116906_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	48.1	1.0e-33
WP_000989238.1|1116862_1119001_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	72.6	6.9e-291
WP_000196190.1|1118997_1119204_+	hypothetical protein	NA	A0A1W6JT66	Pseudomonas_phage	53.3	2.9e-05
WP_001009205.1|1119200_1120748_+|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	63.8	1.1e-176
WP_001107908.1|1122839_1123163_+	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	61.3	7.7e-29
WP_000774239.1|1123155_1123455_+	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	45.1	4.5e-15
WP_065675085.1|1123435_1124002_+|tail	phage tail protein	tail	Q9G063	Phage_Gifsy-2	93.5	8.0e-13
WP_000196703.1|1123998_1124400_+|tail	tail protein	tail	K7PHM6	Enterobacterial_phage	60.9	2.0e-42
WP_000132755.1|1124411_1125161_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	68.6	3.7e-90
WP_000478858.1|1125206_1125605_+|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	56.8	8.6e-30
WP_010989009.1|1125601_1125931_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	50.9	5.0e-23
WP_065305406.1|1126010_1128998_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.0	2.5e-262
WP_000978295.1|1128994_1129327_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	2.6e-35
WP_000410972.1|1129425_1129950_+	outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	35.3	1.8e-19
WP_000877926.1|1130039_1130573_-	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_001152416.1|1130662_1131358_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.0e-89
WP_000606356.1|1131367_1132105_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	75.6	5.2e-113
WP_020867839.1|1132002_1132707_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	62.6	2.0e-66
WP_000033414.1|1132778_1136129_+	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	69.3	0.0e+00
WP_000178849.1|1136167_1136410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001532020.1|1136463_1138839_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	64.9	1.9e-87
WP_031618324.1|1139339_1139660_+	hypothetical protein	NA	A0A0M4QWS3	Salmonella_phage	79.2	4.9e-44
WP_000143158.1|1139649_1140231_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	87.4	1.8e-92
WP_000161705.1|1140427_1141150_-	SPI-1 type III secretion system guanine nucleotide exchange factor SopE	NA	NA	NA	NA	NA
WP_000343758.1|1141800_1143021_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_071531551.1|1143017_1143515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000193784.1|1143949_1146562_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
WP_000291723.1|1146769_1147780_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_001220671.1|1147945_1148488_+	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000224069.1|1148484_1149594_-	YcbX family protein	NA	NA	NA	NA	NA
WP_001086485.1|1149692_1151801_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000053044.1|1151813_1153721_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
WP_000333152.1|1153735_1154989_+	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000433414.1|1154993_1156634_+	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000759136.1|1156630_1157194_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_001537784.1|1157449_1157617_+	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000227928.1|1157716_1158235_-	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_000156454.1|1158303_1160064_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877172.1|1160249_1160702_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_001674965.1|1160773_1161826_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288732.1|1162182_1162692_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001202375.1|1162908_1163514_+	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000950880.1|1163500_1165654_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261222.1|1165672_1166119_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000420505.1|1166242_1168297_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_000424187.1|1168332_1168791_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847716.1|1168885_1169548_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_001537782.1|1169721_1170135_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_000561983.1|1170179_1170497_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000140480.1|1170554_1171766_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000859416.1|1171980_1172529_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000548082.1|1172554_1173334_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000072884.1|1173382_1173664_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904446.1|1173660_1173990_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000374046.1|1174076_1174736_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
WP_000938191.1|1175356_1176037_-|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	70.6	8.3e-81
>prophage 4
NZ_CP016586	Salmonella enterica subsp. enterica serovar Heidelberg strain SH13-004 chromosome, complete genome	4750331	2074341	2081593	4750331		Morganella_phage(33.33%)	8	NA	NA
WP_001157304.1|2074341_2075772_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	7.8e-105
WP_000377037.1|2075845_2076541_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	1.6e-07
WP_000107434.1|2076620_2076932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001080662.1|2077582_2078779_+	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.1	5.1e-110
WP_024131109.1|2079036_2079225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208509.1|2079235_2079448_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_000457664.1|2079902_2081171_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.2	1.2e-226
WP_000394197.1|2081173_2081593_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
>prophage 5
NZ_CP016586	Salmonella enterica subsp. enterica serovar Heidelberg strain SH13-004 chromosome, complete genome	4750331	2170936	2181442	4750331		Enterobacteria_phage(37.5%)	10	NA	NA
WP_000126349.1|2170936_2172250_-	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
WP_000565905.1|2172276_2173356_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	6.6e-16
WP_000648784.1|2173360_2174134_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000018226.1|2174130_2175123_-	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000973708.1|2175128_2175680_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	2.2e-52
WP_000857529.1|2175680_2176559_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	9.3e-109
WP_001023662.1|2176606_2177506_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_031613393.1|2177505_2178591_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
WP_000981469.1|2178967_2179861_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_001111845.1|2180038_2181442_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	6.8e-21
>prophage 6
NZ_CP016586	Salmonella enterica subsp. enterica serovar Heidelberg strain SH13-004 chromosome, complete genome	4750331	2249718	2258889	4750331	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000195330.1|2249718_2251752_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
WP_000703137.1|2251992_2252451_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_001197951.1|2252622_2253153_+	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000950413.1|2253209_2253677_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_000598637.1|2253723_2254443_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000272850.1|2254439_2256125_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
WP_001240417.1|2256347_2257079_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_001261696.1|2257138_2257246_+	protein YohO	NA	NA	NA	NA	NA
WP_000824857.1|2257226_2257958_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569165.1|2257941_2258889_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
>prophage 7
NZ_CP016586	Salmonella enterica subsp. enterica serovar Heidelberg strain SH13-004 chromosome, complete genome	4750331	2278296	2344683	4750331	lysis,holin,tail	Salmonella_phage(25.0%)	58	NA	NA
WP_000989295.1|2278296_2278992_+|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_000553526.1|2279145_2280030_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_000920081.1|2280206_2280926_+	outer membrane permeability protein SanA	NA	NA	NA	NA	NA
WP_000605187.1|2280922_2281168_+	DUF2542 family protein	NA	NA	NA	NA	NA
WP_001136394.1|2281372_2282614_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001275101.1|2283917_2284928_-	galactose/methyl galactoside ABC transporter permease MglC	NA	NA	NA	NA	NA
WP_000535907.1|2284943_2286464_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	31.9	1.0e-09
WP_001036943.1|2286597_2287596_-	galactose/glucose ABC transporter substrate-binding protein MglB	NA	NA	NA	NA	NA
WP_000628631.1|2288094_2289117_-	HTH-type transcriptional regulator GalS	NA	NA	NA	NA	NA
WP_001520237.1|2289266_2290409_-	DUF418 family protein	NA	NA	NA	NA	NA
WP_001139611.1|2290423_2291092_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	4.1e-56
WP_000425488.1|2291421_2292279_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000876817.1|2292267_2292657_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001531764.1|2292661_2294029_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_000022910.1|2294245_2295133_+	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_000023807.1|2295165_2296488_+	MFS transporter	NA	NA	NA	NA	NA
WP_000488244.1|2296531_2298523_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	37.9	6.7e-14
WP_000535000.1|2298868_2300338_-	lysine-specific permease	NA	NA	NA	NA	NA
WP_000548316.1|2300527_2301391_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000137966.1|2301511_2302561_+	YeiH family protein	NA	NA	NA	NA	NA
WP_000873906.1|2302639_2303497_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	28.5	1.3e-22
WP_000854395.1|2303561_2305250_-	PTS fructose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_000091249.1|2305266_2306205_-	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_000487287.1|2306204_2307335_-	fused PTS fructose transporter subunit IIA/HPr protein	NA	NA	NA	NA	NA
WP_000551937.1|2307702_2308884_+	sugar efflux transporter SetB	NA	NA	NA	NA	NA
WP_001213897.1|2308947_2309613_-	membrane protein	NA	NA	NA	NA	NA
WP_001519564.1|2309614_2309737_-	membrane protein	NA	NA	NA	NA	NA
WP_001523448.1|2310124_2310379_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001136822.1|2310702_2311275_+	elongation factor P-like protein YeiP	NA	NA	NA	NA	NA
WP_000169346.1|2311487_2312474_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_000178095.1|2312503_2313223_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_000241015.1|2313636_2314209_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.9	8.1e-13
WP_000957755.1|2314534_2316091_+	cyclic di-GMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000561742.1|2316197_2318003_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000501626.1|2318012_2319107_+	microcin C ABC transporter permease YejB	NA	NA	NA	NA	NA
WP_001137747.1|2319106_2320132_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000222013.1|2320133_2321723_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	32.1	7.2e-19
WP_001094639.1|2321726_2322071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000213347.1|2322461_2323652_-	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	22.2	2.4e-19
WP_001234834.1|2323679_2324375_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000578130.1|2324526_2326287_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.8	1.4e-100
WP_000494192.1|2326411_2326696_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000033443.1|2326804_2327425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000050806.1|2327452_2328460_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	4.5e-83
WP_001135904.1|2328639_2328867_+	YejL family protein	NA	NA	NA	NA	NA
WP_000256150.1|2328898_2330659_+	cardiolipin transport protein PbgA	NA	NA	NA	NA	NA
WP_000806401.1|2330939_2331443_-	LexA family transcriptional regulator	NA	Q1MVE7	Enterobacteria_phage	71.3	9.5e-50
WP_000884778.1|2331470_2331761_+	DinI family protein	NA	S4TND2	Salmonella_phage	83.3	4.7e-25
WP_000022213.1|2333984_2334428_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	43.9	1.4e-28
WP_001215679.1|2334805_2335333_-|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	31.3	3.1e-11
WP_000554739.1|2335335_2336577_-	hypothetical protein	NA	Q8HAB4	Salmonella_phage	95.3	1.0e-52
WP_001120499.1|2337169_2337499_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	94.6	3.9e-36
WP_000894638.1|2337795_2339127_+	NTPase	NA	R9TRQ8	Vibrio_phage	28.5	4.6e-19
WP_010989045.1|2339155_2339524_-	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	81.7	7.4e-52
WP_001202279.1|2339538_2340528_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.3	6.0e-189
WP_001115840.1|2340856_2343223_-	SPI-2 type III secretion system effector E3 ubiquitin transferase SspH2	NA	Q9MBL9	Phage_Gifsy-2	88.7	2.9e-72
WP_001113462.1|2343391_2343595_-|tail	tail protein	tail	NA	NA	NA	NA
WP_000624225.1|2343891_2344683_-|tail	tail fiber protein	tail	Q1MVL8	Enterobacteria_phage	31.6	1.7e-48
>prophage 8
NZ_CP016586	Salmonella enterica subsp. enterica serovar Heidelberg strain SH13-004 chromosome, complete genome	4750331	4332847	4380368	4750331	holin,tRNA,tail,plate	Burkholderia_phage(40.91%)	50	NA	NA
WP_000587739.1|4332847_4333489_-	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.9	4.6e-33
WP_024132246.1|4334067_4334484_-	serine acetyltransferase	NA	NA	NA	NA	NA
WP_000084336.1|4334864_4335320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001151758.1|4335316_4335931_-	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_000368193.1|4335937_4337596_-|tail	phage tail protein	tail	A0A0M3ULF6	Salmonella_phage	52.7	1.8e-52
WP_000359509.1|4337598_4338231_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	8.6e-24
WP_000951734.1|4338223_4339339_-|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	52.2	3.1e-101
WP_001093501.1|4339329_4339689_-	GPW/gp25 family protein	NA	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_000632053.1|4339852_4341400_-	hypothetical protein	NA	B9UDL6	Salmonella_phage	29.9	3.8e-49
WP_000703633.1|4341399_4342329_-	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	84.1	1.4e-150
WP_000593182.1|4342325_4342688_-	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000679398.1|4343015_4343738_-|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	41.0	3.3e-11
WP_000818154.1|4343747_4344791_-	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	2.5e-76
WP_001269716.1|4344778_4344988_-|tail	tail protein X	tail	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_000271420.1|4344987_4345941_-|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_001262499.1|4345940_4348295_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	9.0e-66
WP_001185654.1|4348391_4348520_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001003642.1|4348479_4348797_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000907497.1|4348848_4349373_-|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.0	2.3e-67
WP_000729852.1|4349372_4350800_-|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.1e-194
WP_000875314.1|4350789_4350987_-	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000449433.1|4350983_4351439_-	Gp37 family protein	NA	NA	NA	NA	NA
WP_000777266.1|4351598_4351913_-	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_001270441.1|4351925_4352531_-	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	2.5e-60
WP_001226442.1|4352533_4352821_-|holin	putative holin	holin	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
WP_000615248.1|4353396_4353744_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
WP_000136400.1|4353876_4355226_-	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_000790037.1|4355570_4357220_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_001541297.1|4357663_4357906_+	outer membrane protein	NA	NA	NA	NA	NA
WP_022742863.1|4357939_4358608_+	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_000977979.1|4358604_4359342_+	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_000750804.1|4359341_4361438_+	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_000982749.1|4361580_4361991_+	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_001252085.1|4362156_4363047_-	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_000382573.1|4363061_4364606_-	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_000695415.1|4364737_4365928_-	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_000179176.1|4366289_4367399_+	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
WP_000973681.1|4367487_4368846_+	maltoporin	NA	NA	NA	NA	NA
WP_000782497.1|4369009_4369927_+	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_000019230.1|4370107_4370605_+	chorismate lyase	NA	NA	NA	NA	NA
WP_000455249.1|4370618_4371491_+	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_000017360.1|4371589_4374010_-	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000002900.1|4374180_4374549_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000646079.1|4374657_4375266_+	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_001128112.1|4375444_4376770_+	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_001575282.1|4376766_4376880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001030592.1|4376901_4377111_+	CsbD family protein	NA	NA	NA	NA	NA
WP_000416271.1|4377209_4377725_-	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_001039342.1|4377971_4379282_+	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_001182224.1|4379369_4380368_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
