The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP016521	Salmonella enterica subsp. enterica serovar Heidelberg strain SA02DT09004001 chromosome, complete genome	4750474	312177	416479	4750474	transposase,coat,holin,protease,plate,lysis,terminase,integrase,portal	Enterobacteria_phage(41.18%)	118	376730:376775	415995:416040
WP_000145239.1|312177_313173_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000371513.1|313169_315053_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000108006.1|315068_315563_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000750533.1|315559_316384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000806687.1|316370_317273_-	type VI secretion system-associated protein TagK	NA	NA	NA	NA	NA
WP_000449783.1|317640_320280_+	type VI secretion system ATPase TssH	NA	A0A2I7SAX5	Vibrio_phage	34.5	1.1e-77
WP_000996815.1|320379_320922_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000013889.1|320945_322454_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_001147175.1|322506_322908_+	BPSL0067 family protein	NA	NA	NA	NA	NA
WP_001171573.1|322879_323305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000312802.1|323541_324027_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_001081551.1|324329_324815_+	type VI secretion system amidase effector protein Tae4	NA	NA	NA	NA	NA
WP_000379146.1|324799_325183_+	type VI secretion system amidase immunity protein Tai4	NA	NA	NA	NA	NA
WP_000119443.1|325325_325811_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_001682196.1|325878_326415_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000118732.1|326418_327762_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_000132479.1|327758_329063_+	type VI secretion system protein TssL	NA	NA	NA	NA	NA
WP_000976547.1|329067_329841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000227044.1|330043_330475_+	Shiga toxin A subunit	NA	NA	NA	NA	NA
WP_001168944.1|330508_334378_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001254127.1|334377_335145_+	DUF2094 domain-containing protein	NA	NA	NA	NA	NA
WP_000528843.1|335187_335658_+	glucosaminidase domain-containing protein	NA	NA	NA	NA	NA
WP_001683005.1|335746_336103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000759642.1|336230_336647_+	DUF2195 family protein	NA	NA	NA	NA	NA
WP_000968384.1|336670_337192_+	DUF2778 domain-containing protein	NA	NA	NA	NA	NA
WP_000011513.1|337588_339820_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_000186513.1|339879_340338_+	DcrB-related protein	NA	NA	NA	NA	NA
WP_000503214.1|340353_345060_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	38.4	1.4e-30
WP_000789494.1|345056_345491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000994215.1|345537_345801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165488057.1|346170_346479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001284951.1|346471_346939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001531381.1|347003_347177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001009508.1|349048_349759_+	fimbrial protein TcfA	NA	NA	NA	NA	NA
WP_000287810.1|349809_350385_+	fimbrial protein TcfB	NA	NA	NA	NA	NA
WP_085949836.1|352046_353260_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	58.4	4.7e-103
WP_000066479.1|354464_355544_+	fimbrial protein TcfD	NA	NA	NA	NA	NA
WP_000141547.1|355676_356132_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000241747.1|356271_356889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031603649.1|357659_357848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000787603.1|357851_358571_-	adhesin/invasin protein PagN	NA	NA	NA	NA	NA
WP_000788200.1|358901_359309_-	Spy/CpxP family protein refolding chaperone	NA	NA	NA	NA	NA
WP_000015789.1|359618_360386_-	amidohydrolase	NA	NA	NA	NA	NA
WP_000973041.1|360494_362939_-	acyl-CoA dehydrogenase FadE	NA	NA	NA	NA	NA
WP_000284051.1|363178_363757_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	30.8	1.3e-13
WP_000333387.1|363969_364737_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_001225658.1|364707_365448_-	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001226196.1|365697_366753_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000528902.1|366971_368111_+	RNA ligase RtcB family protein	NA	A0A222ZM82	Mycobacterium_phage	31.0	2.0e-31
WP_000602087.1|368107_368722_+	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001292977.1|368876_370334_-	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001292018.1|370582_371041_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000189588.1|371129_372374_+	esterase FrsA	NA	NA	NA	NA	NA
WP_000174696.1|372431_372833_+	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_001043660.1|372883_373936_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.5	2.2e-112
WP_001285275.1|374218_375322_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.8	6.9e-61
WP_000893221.1|375333_376584_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	48.2	2.1e-98
376730:376775	attL	ATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCA	NA	NA	NA	NA
WP_000051900.1|376789_377953_-|integrase	site-specific integrase	integrase	A0A075B8E2	Enterobacteria_phage	99.7	2.4e-229
WP_000016640.1|378182_378818_-	hypothetical protein	NA	A0A075B8I7	Enterobacteria_phage	99.5	1.3e-120
WP_001277769.1|378918_379098_-	Eag protein	NA	A0A075B8F7	Enterobacteria_phage	98.3	1.6e-28
WP_000208013.1|379194_379881_-	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	53.2	4.3e-53
WP_000224223.1|379891_380155_-	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	2.0e-30
WP_001289978.1|380156_380642_-	ead/Ea22-like family protein	NA	A5VWB3	Enterobacteria_phage	86.1	1.3e-43
WP_000812182.1|380638_381265_-	hypothetical protein	NA	A5VWB1	Enterobacteria_phage	71.2	7.1e-71
WP_001682200.1|381261_381426_-	DUF2737 family protein	NA	A0A2I6PID4	Escherichia_phage	98.1	1.6e-22
WP_001111313.1|381436_381733_-	DUF2856 family protein	NA	Q76H42	Enterobacteria_phage	90.8	3.9e-43
WP_000031375.1|382063_382681_-	ERF family protein	NA	A0A0N7CFJ3	Salmonella_phage	100.0	3.3e-105
WP_001163402.1|382677_382821_-	hypothetical protein	NA	A0A075B8I9	Enterobacteria_phage	100.0	3.2e-19
WP_000158027.1|382810_382999_-	DUF5444 family protein	NA	A0A075B8F9	Enterobacteria_phage	100.0	1.4e-30
WP_000582314.1|382979_383138_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A0A075B8H4	Enterobacteria_phage	100.0	4.0e-23
WP_000776964.1|383223_383535_-	superinfection exclusion protein	NA	A0A075B8E5	Enterobacteria_phage	100.0	1.1e-48
WP_001737461.1|383682_383886_-	DUF551 domain-containing protein	NA	A0A0N7CAQ5	Salmonella_phage	100.0	1.7e-34
WP_000651935.1|383885_384122_-	hypothetical protein	NA	A0A075B8J0	Enterobacteria_phage	100.0	4.3e-37
WP_000213983.1|384158_384353_-	hypothetical protein	NA	A0A075B8G0	Enterobacteria_phage	100.0	2.5e-30
WP_001682202.1|384567_385146_+	superinfection exclusion B family protein	NA	A0A075B8E6	Enterobacteria_phage	100.0	8.8e-92
WP_000216175.1|385166_385469_-	hypothetical protein	NA	B8K1E6	Salmonella_phage	98.0	1.1e-48
WP_001095984.1|385822_386473_-	LexA family transcriptional regulator	NA	B1B6L9	Salmonella_phage	100.0	5.4e-122
WP_000276884.1|386553_386739_+	Cro/Cl family transcriptional regulator	NA	Q5G8T3	Enterobacteria_phage	100.0	5.4e-27
WP_000424167.1|386845_387124_+	lambda phage CII family protein	NA	Q5G8T2	Enterobacteria_phage	100.0	2.5e-44
WP_001125981.1|387158_387305_+	DUF2740 family protein	NA	A0A075B8K7	Enterobacteria_phage	100.0	1.5e-19
WP_000067075.1|387297_388113_+	replication protein	NA	A0A075B8J2	Enterobacteria_phage	100.0	9.4e-148
WP_001248406.1|388109_389486_+	DNA helicase	NA	A0A075B8G2	Enterobacteria_phage	100.0	3.3e-254
WP_000736921.1|389559_389997_+	recombination protein NinB	NA	A8CGE3	Salmonella_phage	100.0	1.3e-79
WP_000679702.1|389993_390167_+	hypothetical protein	NA	C6ZR56	Salmonella_phage	100.0	5.2e-32
WP_000113772.1|390133_390310_+	NinE family protein	NA	I6RSQ2	Salmonella_phage	100.0	4.6e-28
WP_001531428.1|390312_390645_+	DUF2591 domain-containing protein	NA	A0A075B8G3	Enterobacteria_phage	100.0	3.5e-61
WP_000950959.1|390637_390814_+	protein ninF	NA	I6S668	Salmonella_phage	100.0	2.5e-26
WP_001129733.1|390806_391418_+	recombination protein NinG	NA	A0A075B8E9	Enterobacteria_phage	100.0	1.3e-98
WP_000036317.1|391414_391639_+	hypothetical protein	NA	Q5G8R9	Enterobacteria_phage	100.0	2.2e-38
WP_000149925.1|391635_391839_+	phage NinH family protein	NA	A0A075B8J4	Enterobacteria_phage	100.0	7.2e-33
WP_000219131.1|391819_391999_+	hypothetical protein	NA	A0A1U8QR34	Salmonella_phage	100.0	1.4e-24
WP_001235453.1|391995_392619_+	antitermination protein	NA	A0A075B8H9	Enterobacteria_phage	100.0	2.3e-114
WP_000286100.1|393057_393261_+|holin	phage holin family protein	holin	I6R0S9	Salmonella_phage	100.0	1.1e-33
WP_000074137.1|393238_393736_+	lysozyme	NA	A0A1R3Y5W5	Salmonella_virus	97.0	6.0e-89
WP_001531485.1|393824_394262_+|lysis	lysis protein	lysis	O80289	Bacteriophage	99.3	9.1e-73
WP_001177703.1|394474_395161_+	Rha family transcriptional regulator	NA	A0A192Y918	Salmonella_phage	99.6	4.7e-124
WP_000807785.1|395463_395706_+	DUF2560 family protein	NA	A0A0M4R322	Salmonella_phage	100.0	7.5e-37
WP_001278047.1|395707_395887_+	hypothetical protein	NA	Q9AZ02	Salmonella_phage	91.5	3.0e-22
WP_000729925.1|395910_396399_+	DNA-packaging protein	NA	O80290	Bacteriophage	100.0	2.9e-88
WP_000417849.1|396376_397876_+|terminase	terminase large subunit	terminase	A0A192Y824	Salmonella_phage	99.8	1.4e-306
WP_000774656.1|397875_400053_+|portal	portal protein	portal	A0A2H4FNE2	Salmonella_phage	99.9	0.0e+00
WP_000433852.1|400066_400978_+	scaffold protein	NA	A0A192Y6T4	Salmonella_phage	100.0	4.9e-161
WP_001196938.1|400977_402270_+|coat	coat protein	coat	A0A192Y6V4	Salmonella_phage	100.0	3.2e-243
WP_000684729.1|402308_402518_+	hypothetical protein	NA	A0A192Y697	Salmonella_phage	100.0	1.3e-32
WP_001166098.1|402501_403002_+	packaged DNA stabilization gp4 family protein	NA	I1TEJ0	Salmonella_phage	99.4	5.5e-90
WP_001122424.1|402961_404380_+	packaged DNA stabilization protein gp10	NA	A0A075B8I2	Enterobacteria_phage	100.0	7.6e-278
WP_000774927.1|404383_405085_+	hypothetical protein	NA	A0A192Y6T9	Salmonella_phage	100.0	8.8e-78
WP_000627697.1|405084_405540_+	DUF2824 family protein	NA	A0A192Y6V9	Salmonella_phage	100.0	5.2e-87
WP_000964902.1|405542_406235_+	hypothetical protein	NA	G5DA80	Enterobacteria_phage	98.7	1.2e-108
WP_000246945.1|406244_407540_+	phage DNA ejection protein	NA	Q716G3	Shigella_phage	84.5	2.1e-181
WP_001029838.1|407539_409537_+	hypothetical protein	NA	Q716G2	Shigella_phage	94.9	0.0e+00
WP_000749288.1|409627_410113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023602519.1|410515_410803_-	Arc family DNA-binding protein	NA	A0A088CPT2	Enterobacteria_phage	67.8	1.9e-26
WP_000129930.1|410905_412909_+	endorhamnosidase	NA	A0A2H4FWI0	Salmonella_phage	99.9	0.0e+00
WP_000671495.1|412967_414425_-	glucosyltransferase domain-containing protein	NA	A0A192Y7W8	Salmonella_phage	100.0	4.5e-241
WP_000703640.1|414414_415347_-	glycosyltransferase family 2 protein	NA	A0A192Y8W7	Salmonella_phage	100.0	5.5e-176
WP_000915528.1|415343_415706_-	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	100.0	5.0e-61
WP_001683918.1|416203_416479_+	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	64.1	1.9e-23
415995:416040	attR	ATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCA	NA	NA	NA	NA
>prophage 2
NZ_CP016521	Salmonella enterica subsp. enterica serovar Heidelberg strain SA02DT09004001 chromosome, complete genome	4750474	1020705	1028728	4750474	transposase,protease	Dickeya_phage(14.29%)	8	NA	NA
WP_001201751.1|1020705_1021824_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
WP_000125890.1|1021820_1023767_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	42.3	9.1e-40
WP_000447499.1|1023896_1024118_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000520789.1|1024441_1024762_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000934063.1|1024792_1027069_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000502119.1|1027259_1027718_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_001117984.1|1027991_1028189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001531374.1|1028350_1028728_-	hypothetical protein	NA	A0A077KET4	Ralstonia_phage	40.2	1.7e-19
>prophage 3
NZ_CP016521	Salmonella enterica subsp. enterica serovar Heidelberg strain SA02DT09004001 chromosome, complete genome	4750474	1079337	1177296	4750474	transposase,holin,protease,lysis,terminase,tRNA,portal,tail	Salmonella_phage(43.86%)	103	NA	NA
WP_001154025.1|1079337_1080141_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_001288828.1|1080133_1081456_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_000060025.1|1081436_1082141_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_000572753.1|1082140_1086607_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_000925883.1|1086951_1088772_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000357052.1|1089031_1089580_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
WP_001109471.1|1089607_1090255_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000462653.1|1090316_1091507_-	aspartate transaminase	NA	NA	NA	NA	NA
WP_000977713.1|1091691_1092783_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	51.7	2.2e-99
WP_000117870.1|1093389_1094790_-|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
WP_000762342.1|1094990_1095452_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000544849.1|1095768_1096983_+	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000893206.1|1097227_1098661_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000191413.1|1098741_1099944_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001262307.1|1100138_1101431_-	DUF3596 domain-containing protein	NA	S4TSP2	Salmonella_phage	100.0	3.4e-253
WP_000065276.1|1101475_1101724_-	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001682304.1|1101764_1102004_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	98.7	3.3e-37
WP_000189634.1|1102009_1102879_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	86.3	7.2e-146
WP_000187054.1|1102875_1103556_-	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	97.8	3.3e-130
WP_000100830.1|1103552_1104338_-	phage recombination protein Bet	NA	A0A0M4RD39	Salmonella_phage	98.8	2.4e-148
WP_000995352.1|1104343_1104640_-	host-nuclease inhibitor protein Gam	NA	A0A0M5M5Z9	Salmonella_phage	100.0	1.1e-48
WP_000186242.1|1104730_1104931_-	cell division protein FtsZ	NA	G8C7T2	Escherichia_phage	48.4	2.4e-12
WP_000373338.1|1105218_1105425_+	hypothetical protein	NA	K7P7I0	Enterobacteria_phage	67.6	1.6e-16
WP_000091280.1|1105451_1105886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000439725.1|1105887_1106313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001230956.1|1106355_1106751_-	helix-turn-helix domain-containing protein	NA	K7PM35	Enterobacteria_phage	72.5	3.5e-47
WP_000992434.1|1106855_1107092_+	helix-turn-helix domain-containing protein	NA	A0A0M4QX15	Salmonella_phage	73.1	9.0e-27
WP_015675517.1|1107057_1107432_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	1.9e-63
WP_000024046.1|1107523_1108429_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	99.7	9.1e-176
WP_000788826.1|1108425_1109127_+	hypothetical protein	NA	A0A0M3ULE2	Salmonella_phage	99.1	1.9e-128
WP_023602525.1|1109171_1109573_+	ParB/RepB/Spo0J family partition protein	NA	S4TTI6	Salmonella_phage	98.5	5.4e-72
WP_000215887.1|1109569_1110103_+	hypothetical protein	NA	A0A192Y7N1	Salmonella_phage	89.8	8.1e-92
WP_000224239.1|1110104_1110362_+	hypothetical protein	NA	A0A192Y5W0	Salmonella_phage	95.3	4.5e-40
WP_000208143.1|1110372_1110774_+	hypothetical protein	NA	I6R0R2	Salmonella_phage	82.0	1.2e-18
WP_000877758.1|1110881_1111526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001217669.1|1111756_1111990_+	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	5.6e-37
WP_014343878.1|1112106_1112355_+	hypothetical protein	NA	A0A0U2C0C8	Salmonella_phage	100.0	1.6e-42
WP_000929790.1|1112389_1112992_+	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.5	7.5e-110
WP_001096547.1|1113200_1113812_+	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.5	4.2e-92
WP_001617856.1|1113808_1113955_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
WP_001047631.1|1113944_1114742_+	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.6	2.3e-151
WP_000508329.1|1114908_1115127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000658038.1|1115407_1115596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001682303.1|1115798_1116101_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_000301013.1|1116078_1116618_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	72.4	2.2e-76
WP_001080030.1|1116925_1117420_+|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.3	2.2e-59
WP_000371784.1|1117630_1118164_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	48.1	1.0e-33
WP_000989238.1|1118120_1120259_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	72.6	6.9e-291
WP_000196190.1|1120255_1120462_+	hypothetical protein	NA	A0A1W6JT66	Pseudomonas_phage	53.3	2.9e-05
WP_001009205.1|1120458_1122006_+|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	63.8	1.1e-176
WP_077906133.1|1121929_1124008_+|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	69.3	2.4e-264
WP_001107908.1|1124098_1124422_+	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	61.3	7.7e-29
WP_000774239.1|1124414_1124714_+	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	45.1	4.5e-15
WP_000453192.1|1124694_1125261_+|tail	phage tail protein	tail	Q9G063	Phage_Gifsy-2	95.7	2.1e-13
WP_000196703.1|1125257_1125659_+|tail	tail protein	tail	K7PHM6	Enterobacterial_phage	60.9	2.0e-42
WP_000132755.1|1125670_1126420_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	68.6	3.7e-90
WP_000478858.1|1126465_1126864_+|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	56.8	8.6e-30
WP_010989009.1|1126860_1127190_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	50.9	5.0e-23
WP_065305406.1|1127269_1130257_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.0	2.5e-262
WP_000978295.1|1130253_1130586_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	2.6e-35
WP_000410972.1|1130684_1131209_+	outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	35.3	1.8e-19
WP_000877926.1|1131298_1131832_-	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_001152416.1|1131921_1132617_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.0e-89
WP_000606356.1|1132626_1133364_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	75.6	5.2e-113
WP_020867839.1|1133261_1133966_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	62.6	2.0e-66
WP_000033414.1|1134037_1137388_+	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	69.3	0.0e+00
WP_000178849.1|1137426_1137669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001532020.1|1137722_1140098_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	64.9	1.9e-87
WP_031618324.1|1140598_1140919_+	hypothetical protein	NA	A0A0M4QWS3	Salmonella_phage	79.2	4.9e-44
WP_000143158.1|1140908_1141490_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	87.4	1.8e-92
WP_000161705.1|1141686_1142409_-	SPI-1 type III secretion system guanine nucleotide exchange factor SopE	NA	NA	NA	NA	NA
WP_000343758.1|1143059_1144280_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_071531551.1|1144276_1144774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000193784.1|1145208_1147821_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
WP_000291723.1|1148028_1149039_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_001220671.1|1149204_1149747_+	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000224069.1|1149743_1150853_-	YcbX family protein	NA	NA	NA	NA	NA
WP_001086485.1|1150951_1153060_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000053044.1|1153072_1154980_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
WP_000333152.1|1154994_1156248_+	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000433414.1|1156252_1157893_+	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000759136.1|1157889_1158453_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_001537784.1|1158708_1158876_+	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000227928.1|1158975_1159494_-	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_000156454.1|1159562_1161323_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877172.1|1161508_1161961_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_001674965.1|1162032_1163085_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288732.1|1163441_1163951_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001202375.1|1164167_1164773_+	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000950880.1|1164759_1166913_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261222.1|1166931_1167378_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000420505.1|1167501_1169556_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_000424187.1|1169591_1170050_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847716.1|1170144_1170807_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_001537782.1|1170980_1171394_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_000561983.1|1171438_1171756_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000140480.1|1171813_1173025_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000859416.1|1173239_1173788_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000548082.1|1173813_1174593_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000072884.1|1174641_1174923_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904446.1|1174919_1175249_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000374046.1|1175335_1175995_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
WP_000938191.1|1176615_1177296_-|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	70.6	8.3e-81
>prophage 4
NZ_CP016521	Salmonella enterica subsp. enterica serovar Heidelberg strain SA02DT09004001 chromosome, complete genome	4750474	2071690	2078942	4750474		Morganella_phage(33.33%)	8	NA	NA
WP_001157304.1|2071690_2073121_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	7.8e-105
WP_000377037.1|2073194_2073890_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	1.6e-07
WP_000107434.1|2073969_2074281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001080662.1|2074931_2076128_+	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.1	5.1e-110
WP_024131109.1|2076385_2076574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208509.1|2076584_2076797_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_000457664.1|2077251_2078520_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.2	1.2e-226
WP_000394197.1|2078522_2078942_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
>prophage 5
NZ_CP016521	Salmonella enterica subsp. enterica serovar Heidelberg strain SA02DT09004001 chromosome, complete genome	4750474	2168280	2178786	4750474		Enterobacteria_phage(37.5%)	10	NA	NA
WP_000126349.1|2168280_2169594_-	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
WP_000565905.1|2169620_2170700_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	6.6e-16
WP_000648784.1|2170704_2171478_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000018226.1|2171474_2172467_-	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000973708.1|2172472_2173024_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	2.2e-52
WP_000857529.1|2173024_2173903_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	9.3e-109
WP_001023662.1|2173950_2174850_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_000697840.1|2174849_2175935_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
WP_000981469.1|2176311_2177205_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_001111845.1|2177382_2178786_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	6.8e-21
>prophage 6
NZ_CP016521	Salmonella enterica subsp. enterica serovar Heidelberg strain SA02DT09004001 chromosome, complete genome	4750474	2247062	2256233	4750474	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000195330.1|2247062_2249096_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
WP_000703137.1|2249336_2249795_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_001197951.1|2249966_2250497_+	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000950413.1|2250553_2251021_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_000598637.1|2251067_2251787_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000272850.1|2251783_2253469_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
WP_001240417.1|2253691_2254423_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_001261696.1|2254482_2254590_+	protein YohO	NA	NA	NA	NA	NA
WP_000824857.1|2254570_2255302_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569165.1|2255285_2256233_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
>prophage 7
NZ_CP016521	Salmonella enterica subsp. enterica serovar Heidelberg strain SA02DT09004001 chromosome, complete genome	4750474	2275640	2342027	4750474	lysis,holin,tail	Salmonella_phage(25.0%)	59	NA	NA
WP_000989295.1|2275640_2276336_+|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_000553526.1|2276489_2277374_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_000920081.1|2277550_2278270_+	outer membrane permeability protein SanA	NA	NA	NA	NA	NA
WP_000605187.1|2278266_2278512_+	DUF2542 family protein	NA	NA	NA	NA	NA
WP_001136394.1|2278716_2279958_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000956097.1|2279951_2281187_+	NAD-dependent dihydropyrimidine dehydrogenase subunit PreA	NA	NA	NA	NA	NA
WP_001275101.1|2281261_2282272_-	galactose/methyl galactoside ABC transporter permease MglC	NA	NA	NA	NA	NA
WP_000535907.1|2282287_2283808_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	31.9	1.0e-09
WP_001036943.1|2283941_2284940_-	galactose/glucose ABC transporter substrate-binding protein MglB	NA	NA	NA	NA	NA
WP_000628631.1|2285438_2286461_-	HTH-type transcriptional regulator GalS	NA	NA	NA	NA	NA
WP_001520237.1|2286610_2287753_-	DUF418 family protein	NA	NA	NA	NA	NA
WP_001139611.1|2287767_2288436_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	4.1e-56
WP_000425488.1|2288765_2289623_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000876817.1|2289611_2290001_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001531764.1|2290005_2291373_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_000022910.1|2291589_2292477_+	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_000023807.1|2292509_2293832_+	MFS transporter	NA	NA	NA	NA	NA
WP_000488244.1|2293875_2295867_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	37.9	6.7e-14
WP_000535000.1|2296212_2297682_-	lysine-specific permease	NA	NA	NA	NA	NA
WP_000548316.1|2297871_2298735_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000137966.1|2298855_2299905_+	YeiH family protein	NA	NA	NA	NA	NA
WP_000873906.1|2299983_2300841_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	28.5	1.3e-22
WP_000854395.1|2300905_2302594_-	PTS fructose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_000091249.1|2302610_2303549_-	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_000487287.1|2303548_2304679_-	fused PTS fructose transporter subunit IIA/HPr protein	NA	NA	NA	NA	NA
WP_000551937.1|2305046_2306228_+	sugar efflux transporter SetB	NA	NA	NA	NA	NA
WP_001213897.1|2306291_2306957_-	membrane protein	NA	NA	NA	NA	NA
WP_001519564.1|2306958_2307081_-	membrane protein	NA	NA	NA	NA	NA
WP_001523448.1|2307468_2307723_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001136822.1|2308046_2308619_+	elongation factor P-like protein YeiP	NA	NA	NA	NA	NA
WP_000169346.1|2308831_2309818_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_000178095.1|2309847_2310567_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_000241015.1|2310980_2311553_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.9	8.1e-13
WP_000957755.1|2311878_2313435_+	cyclic di-GMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000561742.1|2313541_2315347_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000501626.1|2315356_2316451_+	microcin C ABC transporter permease YejB	NA	NA	NA	NA	NA
WP_001137747.1|2316450_2317476_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000222013.1|2317477_2319067_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	32.1	7.2e-19
WP_001094639.1|2319070_2319415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000213347.1|2319805_2320996_-	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	22.2	2.4e-19
WP_001234834.1|2321023_2321719_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000578130.1|2321870_2323631_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.8	1.4e-100
WP_000494192.1|2323755_2324040_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000033443.1|2324148_2324769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000050806.1|2324796_2325804_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	4.5e-83
WP_001135904.1|2325983_2326211_+	YejL family protein	NA	NA	NA	NA	NA
WP_000256150.1|2326242_2328003_+	cardiolipin transport protein PbgA	NA	NA	NA	NA	NA
WP_000806401.1|2328283_2328787_-	LexA family transcriptional regulator	NA	Q1MVE7	Enterobacteria_phage	71.3	9.5e-50
WP_000884778.1|2328814_2329105_+	DinI family protein	NA	S4TND2	Salmonella_phage	83.3	4.7e-25
WP_000022213.1|2331328_2331772_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	43.9	1.4e-28
WP_001215679.1|2332149_2332677_-|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	31.3	3.1e-11
WP_000554739.1|2332679_2333921_-	hypothetical protein	NA	Q8HAB4	Salmonella_phage	95.3	1.0e-52
WP_001120499.1|2334513_2334843_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	94.6	3.9e-36
WP_000894638.1|2335139_2336471_+	NTPase	NA	R9TRQ8	Vibrio_phage	28.5	4.6e-19
WP_010989045.1|2336499_2336868_-	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	81.7	7.4e-52
WP_001202279.1|2336882_2337872_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.3	6.0e-189
WP_001115840.1|2338200_2340567_-	SPI-2 type III secretion system effector E3 ubiquitin transferase SspH2	NA	Q9MBL9	Phage_Gifsy-2	88.7	2.9e-72
WP_001113462.1|2340735_2340939_-|tail	tail protein	tail	NA	NA	NA	NA
WP_000624225.1|2341235_2342027_-|tail	tail fiber protein	tail	Q1MVL8	Enterobacteria_phage	31.6	1.7e-48
>prophage 8
NZ_CP016521	Salmonella enterica subsp. enterica serovar Heidelberg strain SA02DT09004001 chromosome, complete genome	4750474	2474967	2524622	4750474	transposase,protease,capsid,tRNA,integrase	Enterobacteria_phage(23.08%)	47	2500386:2500405	2514004:2514023
WP_000016631.1|2474967_2475780_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_001289138.1|2475779_2476793_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000699178.1|2476860_2477997_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	3.8e-22
WP_000553395.1|2478100_2479102_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_000127721.1|2479098_2480277_-	MFS transporter	NA	NA	NA	NA	NA
WP_001051266.1|2480457_2480832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000433427.1|2481004_2481253_+	transcriptional regulator	NA	A0A0M4UV99	Ralstonia_phage	58.6	2.3e-17
WP_000118258.1|2481421_2481790_+	C40 family peptidase	NA	H6SUH4	Campylobacter_virus	37.9	3.9e-08
WP_000847541.1|2481789_2482308_+	YbjP/YqhG family protein	NA	NA	NA	NA	NA
WP_001142897.1|2482374_2483031_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000817161.1|2483128_2484343_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_000816112.1|2484502_2486503_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000559749.1|2486554_2486830_-	YfcL family protein	NA	NA	NA	NA	NA
WP_001066345.1|2486862_2487411_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_000368599.1|2487410_2488220_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_000750431.1|2488219_2489044_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_000918456.1|2489047_2490133_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	5.3e-90
WP_001542329.1|2490168_2491101_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000730794.1|2491266_2491818_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_001195800.1|2491917_2492403_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_000214145.1|2492611_2494759_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_001248122.1|2494758_2496069_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_000030904.1|2496245_2496530_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_001518618.1|2496900_2498208_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_000776787.1|2498268_2499024_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_000377777.1|2499312_2500254_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	87.8	3.5e-146
2500386:2500405	attL	ATTCCTGCAGGGGACACCAT	NA	NA	NA	NA
WP_000926945.1|2500564_2501746_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	63.8	2.8e-145
WP_000543028.1|2501760_2503482_-	AIPR family protein	NA	NA	NA	NA	NA
WP_001197368.1|2503755_2505186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000783295.1|2505633_2505906_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	50.0	3.2e-20
WP_052864007.1|2506188_2506509_-	helicase	NA	NA	NA	NA	NA
WP_085949836.1|2506544_2507757_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	58.4	4.7e-103
WP_001063902.1|2510134_2510545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000836200.1|2510537_2510774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001111087.1|2510770_2511361_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	49.2	2.6e-22
WP_000270793.1|2511449_2512454_-|capsid	P2 family phage major capsid protein	capsid	F1BUM2	Cronobacter_phage	48.3	2.9e-82
WP_000228164.1|2512476_2513337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000055090.1|2513354_2513582_-	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	56.1	2.3e-11
WP_000716006.1|2514178_2515117_-|protease	omptin family outer membrane protease PgtE	protease	NA	NA	NA	NA
2514004:2514023	attR	ATTCCTGCAGGGGACACCAT	NA	NA	NA	NA
WP_000930843.1|2515384_2516632_-	two-component system response regulator PgtA	NA	NA	NA	NA	NA
WP_000678495.1|2516621_2518628_-	two-component system sensor histidine kinase PgtB	NA	NA	NA	NA	NA
WP_000467980.1|2518624_2519818_-	phosphoglycerate transport regulator PgtC	NA	NA	NA	NA	NA
WP_000955744.1|2520253_2521645_+	phosphoglycerate transporter PgtP	NA	NA	NA	NA	NA
WP_000639889.1|2521883_2522126_-	YfdY family protein	NA	NA	NA	NA	NA
WP_000484428.1|2522647_2523568_+	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	53.5	1.1e-75
WP_010723117.1|2523970_2524042_+	membrane protein YpdK	NA	NA	NA	NA	NA
WP_000502119.1|2524163_2524622_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
>prophage 9
NZ_CP016521	Salmonella enterica subsp. enterica serovar Heidelberg strain SA02DT09004001 chromosome, complete genome	4750474	4332991	4380512	4750474	plate,tRNA,holin,tail	Burkholderia_phage(40.91%)	50	NA	NA
WP_000587739.1|4332991_4333633_-	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.9	4.6e-33
WP_024132246.1|4334211_4334628_-	serine acetyltransferase	NA	NA	NA	NA	NA
WP_000084336.1|4335008_4335464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001151758.1|4335460_4336075_-	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_000368193.1|4336081_4337740_-|tail	phage tail protein	tail	A0A0M3ULF6	Salmonella_phage	52.7	1.8e-52
WP_000359509.1|4337742_4338375_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	8.6e-24
WP_000951734.1|4338367_4339483_-|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	52.2	3.1e-101
WP_001093501.1|4339473_4339833_-	GPW/gp25 family protein	NA	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_000632053.1|4339996_4341544_-	hypothetical protein	NA	B9UDL6	Salmonella_phage	29.9	3.8e-49
WP_000703633.1|4341543_4342473_-	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	84.1	1.4e-150
WP_000593182.1|4342469_4342832_-	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000679398.1|4343159_4343882_-|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	41.0	3.3e-11
WP_000818154.1|4343891_4344935_-	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	2.5e-76
WP_001269716.1|4344922_4345132_-|tail	tail protein X	tail	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_000271420.1|4345131_4346085_-|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_001262499.1|4346084_4348439_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	9.0e-66
WP_001185654.1|4348535_4348664_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001003642.1|4348623_4348941_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000907497.1|4348992_4349517_-|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.0	2.3e-67
WP_000729852.1|4349516_4350944_-|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.1e-194
WP_000875314.1|4350933_4351131_-	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000449433.1|4351127_4351583_-	Gp37 family protein	NA	NA	NA	NA	NA
WP_000777266.1|4351742_4352057_-	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_001270441.1|4352069_4352675_-	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	2.5e-60
WP_001226442.1|4352677_4352965_-|holin	putative holin	holin	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
WP_000615248.1|4353540_4353888_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
WP_000136400.1|4354020_4355370_-	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_000790037.1|4355714_4357364_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_001541297.1|4357807_4358050_+	outer membrane protein	NA	NA	NA	NA	NA
WP_022742863.1|4358083_4358752_+	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_000977979.1|4358748_4359486_+	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_000750804.1|4359485_4361582_+	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_000982749.1|4361724_4362135_+	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_001252085.1|4362300_4363191_-	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_000382573.1|4363205_4364750_-	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_000695415.1|4364881_4366072_-	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_000179176.1|4366433_4367543_+	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
WP_000973681.1|4367631_4368990_+	maltoporin	NA	NA	NA	NA	NA
WP_000782497.1|4369153_4370071_+	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_000019230.1|4370251_4370749_+	chorismate lyase	NA	NA	NA	NA	NA
WP_000455249.1|4370762_4371635_+	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_000017360.1|4371733_4374154_-	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000002900.1|4374324_4374693_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000646079.1|4374801_4375410_+	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_001128112.1|4375588_4376914_+	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_001575282.1|4376910_4377024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001030592.1|4377045_4377255_+	CsbD family protein	NA	NA	NA	NA	NA
WP_000416271.1|4377353_4377869_-	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_001039342.1|4378115_4379426_+	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_001182224.1|4379513_4380512_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
>prophage 1
NZ_CP016522	Salmonella enterica subsp. enterica serovar Heidelberg strain SA02DT09004001 plasmid pSA02DT09004001_101, complete sequence	101723	7741	43891	101723	integrase,transposase	Stx2-converting_phage(20.0%)	45	13307:13321	23625:23639
WP_000608644.1|7741_9004_+|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_000976514.1|9327_10473_+	class C beta-lactamase CMY-2	NA	NA	NA	NA	NA
WP_001221666.1|10566_11100_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	54.1	6.1e-47
WP_000118520.1|11096_11414_-	quaternary ammonium compound efflux SMR transporter SugE	NA	NA	NA	NA	NA
WP_001283341.1|12214_14095_+	colicin 1B	NA	NA	NA	NA	NA
13307:13321	attL	ATTTATAATGCTGAA	NA	NA	NA	NA
WP_000762570.1|14112_14460_-	colicin 1B immunity protein	NA	NA	NA	NA	NA
WP_000142436.1|14578_14926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000194550.1|14943_15534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000343103.1|15533_15788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000774875.1|16139_17141_+	DUF4238 domain-containing protein	NA	NA	NA	NA	NA
WP_000793307.1|17316_17661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000678527.1|18159_18414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001290416.1|18458_19385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813630.1|19942_20161_+	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_001159871.1|20162_20468_+	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000016969.1|20468_21275_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	94.7	5.4e-55
WP_001144036.1|21454_22099_+	ParA family protein	NA	NA	NA	NA	NA
WP_000030199.1|22185_22494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000688514.1|22907_23888_+	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	51.4	1.7e-79
23625:23639	attR	ATTTATAATGCTGAA	NA	NA	NA	NA
WP_001278818.1|23880_24297_+	plasmid partitioning/stability family protein	NA	NA	NA	NA	NA
WP_000457493.1|24298_25573_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	60.4	4.4e-144
WP_000109071.1|25572_26010_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	48.4	8.3e-26
WP_000618110.1|26006_26255_-	DinI-like family protein	NA	Q2A098	Sodalis_phage	48.0	1.9e-14
WP_000273918.1|26672_27575_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_010891263.1|27571_27883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000086178.1|27959_28643_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.4	1.0e-30
WP_001104887.1|28643_28865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000274403.1|28876_29311_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_024133193.1|29361_30132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001198928.1|30549_30975_+	antirestriction protein	NA	NA	NA	NA	NA
WP_000271725.1|31021_31444_+	DUF1380 family protein	NA	NA	NA	NA	NA
WP_001027500.1|31440_31632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001276116.1|32401_32929_+	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	74.4	9.3e-48
WP_000006012.1|32986_33220_+	DUF905 family protein	NA	NA	NA	NA	NA
WP_001145458.1|33278_35237_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	28.9	4.7e-20
WP_000845897.1|35291_35726_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_065612309.1|35722_36442_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_000942657.1|36571_37747_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SLN2	Escherichia_phage	81.6	7.1e-173
WP_001682408.1|38342_39020_+|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|39019_39367_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|39386_40958_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_149866796.1|40960_41401_+	antirestriction protein ArdA	NA	NA	NA	NA	NA
WP_000218863.1|42129_42564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001247862.1|42657_42924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000038404.1|42988_43891_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	53.4	5.8e-66
