The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP015401	Bacteroides caecimuris strain I48 chromosome, complete genome	4839927	497162	505858	4839927		Arthrobacter_phage(16.67%)	8	NA	NA
WP_065537738.1|497162_498131_+	M23 family metallopeptidase	NA	V5R8R0	Arthrobacter_phage	53.0	5.8e-19
WP_065537739.1|498157_498502_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_065537740.1|498538_500776_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	37.0	1.2e-11
WP_065537741.1|500848_502144_-	lytic transglycosylase domain-containing protein	NA	A0A0S2SXN2	Bacillus_phage	42.5	5.7e-14
WP_065537742.1|502177_503065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004301392.1|503065_503956_-	ParB/RepB/Spo0J family partition protein	NA	S5VSZ7	Leptospira_phage	36.3	3.3e-13
WP_004310990.1|503971_504736_-	ParA family protein	NA	Q8JL10	Natrialba_phage	34.8	5.7e-22
WP_065537743.1|505090_505858_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	33.5	8.0e-32
>prophage 2
NZ_CP015401	Bacteroides caecimuris strain I48 chromosome, complete genome	4839927	967330	1007200	4839927	integrase	Leptospira_phage(11.11%)	29	962157:962172	1008391:1008406
962157:962172	attL	CAAAACATGCTGCAAG	NA	NA	NA	NA
WP_065538037.1|967330_968437_-|integrase	site-specific integrase	integrase	S5W9T9	Leptospira_phage	33.6	3.1e-29
WP_065540271.1|968562_969174_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_065540273.1|969321_970602_-	DNA methylase	NA	H2DE57	Erwinia_phage	26.8	1.4e-17
WP_065540272.1|970603_972289_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	48.9	2.1e-133
WP_008640397.1|974108_975320_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_008640396.1|975316_976273_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_055256750.1|976256_977270_+|integrase	tyrosine-type recombinase/integrase	integrase	G1D5R6	Mycobacterium_phage	25.1	5.3e-07
WP_065538039.1|977661_979701_+	phosphotransferase	NA	NA	NA	NA	NA
WP_008640392.1|979681_979975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084081109.1|980175_983928_-	N-6 DNA methylase	NA	A0A240F4T3	Ochrobactrum_phage	34.4	4.1e-36
WP_065538040.1|983917_984370_-	DUF1896 domain-containing protein	NA	NA	NA	NA	NA
WP_065538041.1|984534_986625_-	type IA DNA topoisomerase	NA	A0A1X9I6W8	Streptococcus_phage	30.9	3.6e-42
WP_065538042.1|986684_988259_-	DUF4099 domain-containing protein	NA	NA	NA	NA	NA
WP_065538043.1|988289_988640_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_024988120.1|988661_989021_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_065540274.1|989234_989519_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_071807633.1|989515_989812_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_024988123.1|989900_990272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065538044.1|990283_991519_-|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	30.4	1.1e-27
WP_065538045.1|991901_993275_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_065538046.1|993314_995057_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_004308264.1|995577_996042_+	MaoC family dehydratase	NA	NA	NA	NA	NA
WP_065538047.1|996160_996685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065538048.1|996703_998143_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_065538049.1|998219_999101_-	class A beta-lactamase, subclass A2	NA	NA	NA	NA	NA
WP_065538050.1|999388_1000585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065540275.1|1003227_1005318_+	DUF3874 domain-containing protein	NA	I6R9Q6	Nonlabens_phage	28.3	1.8e-25
WP_065538052.1|1005419_1005854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065538053.1|1006273_1007200_-|integrase	site-specific integrase	integrase	A0A0U4JNS1	Bacillus_phage	28.1	1.3e-20
1008391:1008406	attR	CAAAACATGCTGCAAG	NA	NA	NA	NA
>prophage 3
NZ_CP015401	Bacteroides caecimuris strain I48 chromosome, complete genome	4839927	1122502	1244373	4839927	integrase,transposase	unidentified_phage(13.33%)	93	1206405:1206422	1230707:1230724
WP_101602535.1|1122502_1123657_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_065538120.1|1123818_1124046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141243559.1|1124049_1124418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141243558.1|1124458_1124710_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141243557.1|1124796_1125867_-	prolyl oligopeptidase family serine peptidase	NA	NA	NA	NA	NA
WP_065538123.1|1127454_1127880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065540286.1|1128673_1128985_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_024988824.1|1129038_1129344_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_065538124.1|1129692_1130067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065538125.1|1130088_1131309_-|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	27.1	2.4e-14
WP_065538126.1|1131324_1132554_-|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	29.4	5.4e-22
WP_089280703.1|1132656_1133019_+|integrase	tyrosine-type recombinase/integrase	integrase	Q4ZB10	Staphylococcus_virus	43.4	2.3e-05
WP_065538128.1|1133333_1133687_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_065538129.1|1133683_1134283_+	virulence protein E	NA	S0A0F1	Cellulophaga_phage	27.4	2.4e-07
WP_065538130.1|1134233_1136039_+	DUF3987 domain-containing protein	NA	M1PL02	Cellulophaga_phage	44.0	2.7e-14
WP_005816342.1|1136140_1136509_+	MobC family plasmid mobilization relaxosome protein	NA	NA	NA	NA	NA
WP_065538131.1|1136492_1137392_+	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_065538132.1|1137391_1138045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065538133.1|1138072_1138591_-	DNA mismatch endonuclease Vsr	NA	E5E3X5	Burkholderia_phage	47.2	4.6e-31
WP_065538134.1|1138667_1142798_-	hypothetical protein	NA	A0A2H4PQV1	Staphylococcus_phage	31.7	1.4e-34
WP_065538135.1|1142838_1145082_-	DUF2357 domain-containing protein	NA	NA	NA	NA	NA
WP_065538136.1|1146961_1148161_-	DNA cytosine methyltransferase	NA	A7XXH6	Thermus_virus	31.5	2.1e-39
WP_065538137.1|1148175_1148385_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_065538138.1|1148522_1149233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065540287.1|1149249_1150791_-	HTH domain-containing protein	NA	NA	NA	NA	NA
WP_065538139.1|1150972_1152175_+|transposase	IS110 family transposase	transposase	Q9JMN8	Wolbachia_phage	26.5	7.4e-32
WP_024988655.1|1152832_1153009_+	DUF4250 domain-containing protein	NA	NA	NA	NA	NA
WP_157447987.1|1153028_1153169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065538140.1|1153211_1153751_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_024988653.1|1153755_1154112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065540288.1|1154144_1154705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065538141.1|1154941_1155775_-	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	31.8	9.3e-26
WP_065540289.1|1156774_1159390_-	DUF4962 domain-containing protein	NA	NA	NA	NA	NA
WP_065538142.1|1159404_1160376_-	ROK family protein	NA	NA	NA	NA	NA
WP_065538143.1|1160424_1162053_-	Tat pathway signal sequence	NA	NA	NA	NA	NA
WP_065538144.1|1162077_1163688_-	sulfatase	NA	A0A2P0VMN7	Tetraselmis_virus	23.5	2.4e-14
WP_065538145.1|1163852_1165853_-	heparinase	NA	NA	NA	NA	NA
WP_065538146.1|1165912_1167217_-	glucuronyl hydrolase	NA	NA	NA	NA	NA
WP_055235959.1|1167420_1169103_-	RagB/SusD family nutrient uptake outer membrane protein	NA	NA	NA	NA	NA
WP_065538147.1|1169120_1172276_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_065538148.1|1172302_1174498_-	DUF4958 family protein	NA	NA	NA	NA	NA
WP_065538149.1|1174516_1176694_-	heparinase	NA	NA	NA	NA	NA
WP_065538150.1|1177469_1181531_-	response regulator	NA	W8CYF6	Bacillus_phage	31.7	8.0e-22
WP_065540290.1|1181740_1183111_-	TrpB-like pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_065540291.1|1183243_1185073_+	potassium transporter	NA	NA	NA	NA	NA
WP_065538151.1|1185077_1185764_+	TrkA family potassium uptake protein	NA	NA	NA	NA	NA
WP_065540292.1|1185895_1188337_-	glycoside hydrolase family 2 protein	NA	NA	NA	NA	NA
WP_065538152.1|1188455_1189004_+	DUF4738 domain-containing protein	NA	NA	NA	NA	NA
WP_065538153.1|1189126_1190323_+	heparitin sulfate lyase	NA	NA	NA	NA	NA
WP_084081114.1|1191973_1192816_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_065538155.1|1192797_1194351_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_065538156.1|1195177_1195546_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_158213959.1|1195623_1197189_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	30.9	7.5e-53
WP_065538158.1|1197571_1198648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065538159.1|1198652_1199990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065538160.1|1199991_1200954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065538161.1|1200953_1202213_-	methyltransferase	NA	NA	NA	NA	NA
WP_065538162.1|1203932_1205084_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_016272192.1|1205719_1205977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157447988.1|1206224_1206824_-	hypothetical protein	NA	NA	NA	NA	NA
1206405:1206422	attL	TTTTAAAGATGCCTTTAG	NA	NA	NA	NA
WP_065538164.1|1206827_1208159_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_065538166.1|1210902_1211283_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_157447989.1|1211377_1211545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004319494.1|1211690_1211933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004319491.1|1211943_1212246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004319490.1|1212295_1212490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081354200.1|1212793_1213255_+	DUF1273 family protein	NA	NA	NA	NA	NA
WP_084081197.1|1213700_1216817_+	N-6 DNA methylase	NA	NA	NA	NA	NA
WP_008640397.1|1216873_1218085_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_008640396.1|1218081_1219038_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_065538169.1|1219251_1220229_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_065538039.1|1221461_1223501_+	phosphotransferase	NA	NA	NA	NA	NA
WP_008640392.1|1223481_1223775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065540272.1|1225710_1227396_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	48.9	2.1e-133
WP_065540293.1|1227379_1228465_+	DNA methylase	NA	NA	NA	NA	NA
WP_167371349.1|1229222_1230947_+	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	35.6	2.1e-19
1230707:1230724	attR	TTTTAAAGATGCCTTTAG	NA	NA	NA	NA
WP_034523143.1|1231073_1231418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065538172.1|1231603_1231861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004319482.1|1231877_1232162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005836232.1|1232175_1232418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005836231.1|1232414_1232720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065538173.1|1232814_1233402_-	recombinase family protein	NA	NA	NA	NA	NA
WP_065538174.1|1233769_1234885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005836226.1|1234901_1235348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004319471.1|1235348_1235699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005836224.1|1235712_1236228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065538175.1|1236283_1237108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065538176.1|1237333_1238794_+	recombinase	NA	NA	NA	NA	NA
WP_065538177.1|1240458_1241478_-	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_084081115.1|1241455_1242100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065538178.1|1242462_1242987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065538179.1|1243021_1243372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065538169.1|1243395_1244373_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP015401	Bacteroides caecimuris strain I48 chromosome, complete genome	4839927	1269238	1327172	4839927	integrase,transposase	Lactococcus_phage(13.33%)	52	1268343:1268379	1332108:1332144
1268343:1268379	attL	GAATGGAAAATTTAAAGTCGATTGACCCACTATTATA	NA	NA	NA	NA
WP_065538200.1|1269238_1270804_-|transposase	IS21 family transposase	transposase	A0A059NT83	Lactococcus_phage	26.3	6.5e-12
WP_008667781.1|1271326_1272685_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_028728885.1|1273044_1273539_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_032532248.1|1273571_1274522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065540299.1|1274586_1274811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007558978.1|1274934_1275447_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_065538201.1|1275505_1276126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065538202.1|1276199_1276817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065538203.1|1276896_1278657_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	28.6	3.6e-27
WP_065538204.1|1278744_1279089_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_065538205.1|1279090_1279459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065538206.1|1279634_1280354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065540300.1|1280432_1280759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004295476.1|1280837_1281368_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_065538207.1|1281458_1281887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065538208.1|1281978_1282383_-	1,3-beta-glucan synthase regulator	NA	NA	NA	NA	NA
WP_141243568.1|1282445_1282970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065538210.1|1283034_1283337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065538211.1|1283416_1283821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065540301.1|1283902_1285027_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	29.2	7.1e-29
WP_005842515.1|1285289_1285823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005842513.1|1285827_1286523_-	DUF3800 domain-containing protein	NA	I3NLD4	Bifidobacterium_phage	36.7	7.5e-29
WP_065538212.1|1286709_1288230_+	DUF3945 domain-containing protein	NA	NA	NA	NA	NA
WP_065538213.1|1288516_1289746_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_065538214.1|1289738_1290746_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_065538215.1|1290750_1291776_+|integrase	site-specific integrase	integrase	A0A0E3M2X0	Bacillus_phage	22.7	1.8e-07
WP_065538216.1|1293958_1294435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004327332.1|1294667_1295717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004327330.1|1295721_1296108_+	type II toxin-antitoxin system RnlB family antitoxin	NA	NA	NA	NA	NA
WP_158213962.1|1296349_1296688_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065538218.1|1297113_1297722_+	master DNA invertase Mpi family serine-type recombinase	NA	H2A0H0	Bacteroides_phage	70.6	3.6e-67
WP_065538219.1|1297733_1298648_+	type II restriction endonuclease subunit M	NA	NA	NA	NA	NA
WP_065538220.1|1298649_1302462_-	class I SAM-dependent DNA methyltransferase	NA	A0A1B1IUC6	uncultured_Mediterranean_phage	27.0	1.3e-10
WP_065538221.1|1302627_1303830_+|transposase	IS110 family transposase	transposase	Q9JMN8	Wolbachia_phage	26.5	7.4e-32
WP_065538222.1|1304219_1304615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065538223.1|1304648_1305605_-	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_065538224.1|1305594_1305903_-	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_084081198.1|1306062_1306410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065538200.1|1306680_1308246_+|transposase	IS21 family transposase	transposase	A0A059NT83	Lactococcus_phage	26.3	6.5e-12
WP_065538226.1|1308235_1309009_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	37.0	1.3e-37
WP_065538227.1|1309270_1310926_-|transposase	IS1182 family transposase	transposase	A0A146ICT8	Staphylococcus_phage	38.7	7.4e-67
WP_065540302.1|1311573_1312782_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_065538228.1|1312937_1315439_-	endonuclease MutS2	NA	NA	NA	NA	NA
WP_065538229.1|1315857_1316997_-	DNA alkylation repair protein	NA	NA	NA	NA	NA
WP_065538230.1|1317411_1318815_-	mobilization protein	NA	NA	NA	NA	NA
WP_065538231.1|1319025_1319982_-	DNA primase	NA	NA	NA	NA	NA
WP_065540303.1|1320194_1321271_-	AAA family ATPase	NA	Q5ZGH5	Flavobacterium_phage	30.3	2.6e-28
WP_071807639.1|1321285_1321594_-	DUF3853 family protein	NA	NA	NA	NA	NA
WP_065538232.1|1321817_1322843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065538233.1|1322854_1324144_-	DUF1016 family protein	NA	Q9JMP5	Wolbachia_phage	48.0	2.2e-66
WP_065540305.1|1324209_1325493_-|integrase	site-specific integrase	integrase	S0A3I4	Cellulophaga_phage	24.7	1.0e-18
WP_065538234.1|1325936_1327172_+|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	34.6	4.4e-40
1332108:1332144	attR	TATAATAGTGGGTCAATCGACTTTAAATTTTCCATTC	NA	NA	NA	NA
>prophage 5
NZ_CP015401	Bacteroides caecimuris strain I48 chromosome, complete genome	4839927	1772171	1819274	4839927	integrase,transposase	Stx2-converting_phage(25.0%)	41	1806640:1806654	1820832:1820846
WP_065538470.1|1772171_1773953_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	28.6	4.7e-27
WP_065538471.1|1774114_1774483_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065538472.1|1774484_1774832_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_065538473.1|1774914_1776675_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	28.9	3.6e-27
WP_065538474.1|1776986_1779836_-	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	50.2	2.1e-250
WP_065540337.1|1779974_1780613_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_049702941.1|1780656_1781277_-	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_065540338.1|1781390_1782242_-	DUF3298 and DUF4163 domain-containing protein	NA	NA	NA	NA	NA
WP_065538475.1|1782576_1782975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065538476.1|1783099_1785322_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_065538477.1|1785391_1785715_+	cation transporter	NA	NA	NA	NA	NA
WP_065538478.1|1785815_1788026_+	cadmium-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	34.5	3.1e-100
WP_065538479.1|1788205_1789045_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_065538480.1|1789110_1789794_+	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_065540339.1|1789750_1790668_-	PorV/PorQ family protein	NA	NA	NA	NA	NA
WP_065538481.1|1790670_1792227_-	DUF1460 domain-containing protein	NA	NA	NA	NA	NA
WP_065538482.1|1792233_1794222_-	oligopeptide transporter, OPT family	NA	NA	NA	NA	NA
WP_065538483.1|1794327_1794723_-	DUF1573 domain-containing protein	NA	NA	NA	NA	NA
WP_044918143.1|1794820_1795420_-	DUF4923 family protein	NA	NA	NA	NA	NA
WP_065538484.1|1795433_1796039_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_065538485.1|1797309_1797927_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_065538486.1|1797953_1798412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065538487.1|1798408_1798945_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_065540340.1|1798949_1799540_-	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_065538488.1|1799635_1800955_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_065537976.1|1801533_1803225_+|transposase	DDE transposase	transposase	NA	NA	NA	NA
WP_065538489.1|1803524_1804124_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_138291934.1|1804474_1805353_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_065538491.1|1805379_1806504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065538492.1|1806526_1807192_+	hypothetical protein	NA	NA	NA	NA	NA
1806640:1806654	attL	TGTGCCGGAAGAAGA	NA	NA	NA	NA
WP_065538493.1|1807321_1808143_+	RteC domain-containing protein	NA	NA	NA	NA	NA
WP_065538494.1|1808377_1808788_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_065538495.1|1808750_1810853_+	AAA family ATPase	NA	A0A1B0WKT7	Flavobacterium_phage	29.8	1.6e-10
WP_065538496.1|1810827_1811130_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_065540341.1|1811478_1811964_+	deaminase	NA	NA	NA	NA	NA
WP_065538497.1|1812059_1813190_-	DUF1016 family protein	NA	A0A0U2BZN7	Salmonella_phage	38.0	5.3e-24
WP_065538498.1|1813325_1813793_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_065538499.1|1813789_1815844_-	type IA DNA topoisomerase	NA	A0A1X9I6W8	Streptococcus_phage	31.8	3.1e-46
WP_065538213.1|1816014_1817244_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_065538214.1|1817236_1818244_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_065538215.1|1818248_1819274_+|integrase	site-specific integrase	integrase	A0A0E3M2X0	Bacillus_phage	22.7	1.8e-07
1820832:1820846	attR	TCTTCTTCCGGCACA	NA	NA	NA	NA
>prophage 6
NZ_CP015401	Bacteroides caecimuris strain I48 chromosome, complete genome	4839927	1955923	2079437	4839927	integrase,protease,transposase,tRNA	Bacillus_phage(10.34%)	102	1941836:1941851	1993235:1993250
1941836:1941851	attL	CTTTACCGGAATGTAT	NA	NA	NA	NA
WP_065538546.1|1955923_1957132_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_065540350.1|1957594_1958215_+	RNA polymerase sigma-70 factor	NA	NA	NA	NA	NA
WP_065538547.1|1958222_1959215_+	DUF4974 domain-containing protein	NA	NA	NA	NA	NA
WP_065538548.1|1959431_1962932_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_065538549.1|1962958_1964704_+	RagB/SusD family nutrient uptake outer membrane protein	NA	NA	NA	NA	NA
WP_065538550.1|1964733_1965627_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_065540351.1|1965643_1967815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065538551.1|1967838_1968717_+	endonuclease/exonuclease/phosphatase family protein	NA	A0A0G2Y8J2	Acanthamoeba_polyphaga_mimivirus	27.7	4.9e-09
WP_065538552.1|1968929_1969697_+	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_065538553.1|1969698_1970184_+	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_065538554.1|1970195_1970924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065538555.1|1971446_1972955_+	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_065538556.1|1972972_1974376_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_065538557.1|1974384_1974804_+	DUF1893 domain-containing protein	NA	NA	NA	NA	NA
WP_065538558.1|1974951_1978938_-	hybrid sensor histidine kinase/response regulator transcription factor	NA	W8CYM9	Bacillus_phage	31.0	5.0e-08
WP_065537581.1|1979827_1980199_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_065538559.1|1980239_1981175_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_024988208.1|1981565_1983059_+|tRNA	proline--tRNA ligase	tRNA	A0A2K9L3R9	Tupanvirus	37.4	1.5e-95
WP_065538560.1|1983197_1983875_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.4	4.6e-31
WP_065538561.1|1983891_1985166_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_024988206.1|1985380_1985818_+	PepSY-like domain-containing protein	NA	NA	NA	NA	NA
WP_024988205.1|1985839_1986700_+	PepSY-like domain-containing protein	NA	NA	NA	NA	NA
WP_065538562.1|1986922_1991368_-	translocation/assembly module TamB	NA	NA	NA	NA	NA
WP_065538563.1|1991568_1992588_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	42.0	9.5e-65
WP_065538564.1|1992633_1993866_+	competence/damage-inducible protein A	NA	B5TK85	Pseudomonas_phage	48.4	4.3e-19
1993235:1993250	attR	CTTTACCGGAATGTAT	NA	NA	NA	NA
WP_004314359.1|1993988_1994249_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_002560155.1|1994270_1994459_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_004295982.1|1994476_1994635_+	DUF4295 domain-containing protein	NA	NA	NA	NA	NA
WP_065538565.1|1994773_1995733_+	signal recognition particle-docking protein FtsY	NA	D6PHS7	uncultured_phage	40.4	1.7e-18
WP_065538566.1|1995729_1997040_+	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
WP_065538567.1|1997032_1997305_+	HU family DNA-binding protein	NA	A3E2K9	Sodalis_phage	32.2	1.0e-05
WP_065538568.1|1997318_1998653_+	HU family DNA-binding protein	NA	NA	NA	NA	NA
WP_065538569.1|1998891_1999887_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_065538570.1|1999969_2000839_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_065538571.1|2000838_2001927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065538572.1|2001976_2002960_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_065538573.1|2003005_2004034_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_065538574.1|2004036_2004765_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_065538575.1|2004796_2006626_+	protein BatD	NA	NA	NA	NA	NA
WP_065538576.1|2006644_2007478_+	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_004295969.1|2007606_2007897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016272333.1|2008209_2008578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065538204.1|2008579_2008924_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_065538577.1|2009010_2010792_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	27.3	8.1e-27
WP_008022355.1|2011449_2012664_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_065538578.1|2012696_2015273_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	33.1	1.6e-113
WP_065538579.1|2015628_2018160_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	K4FB40	Cronobacter_phage	40.9	3.1e-125
WP_065540352.1|2018293_2020339_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	28.0	1.9e-48
WP_065538580.1|2020510_2022811_+	patatin	NA	A0A1V0SCG0	Catovirus	26.0	1.0e-13
WP_065538559.1|2023270_2024206_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_065537581.1|2024246_2024618_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_065538581.1|2025142_2026798_-|transposase	IS1182 family transposase	transposase	A0A146ICT8	Staphylococcus_phage	38.7	7.4e-67
WP_065538582.1|2026967_2027861_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_065538583.1|2027920_2029921_-	NAD-dependent DNA ligase LigA	NA	A0A0A8J9A9	Ralstonia_phage	35.2	7.0e-104
WP_004312919.1|2029996_2030674_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_065538584.1|2030890_2031802_-	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_004312917.1|2031789_2032566_-	dihydroorotate dehydrogenase electron transfer subunit	NA	NA	NA	NA	NA
WP_065538585.1|2032642_2033113_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_065538586.1|2034333_2035353_-	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_065538587.1|2035377_2036154_-	AMP nucleosidase	NA	NA	NA	NA	NA
WP_065538588.1|2036217_2036667_+	type I restriction enzyme HsdR N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_065538589.1|2036851_2037682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065538590.1|2037687_2038782_-	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_065538591.1|2038890_2039304_+	DUF4891 domain-containing protein	NA	NA	NA	NA	NA
WP_065538227.1|2039558_2041214_-|transposase	IS1182 family transposase	transposase	A0A146ICT8	Staphylococcus_phage	38.7	7.4e-67
WP_065538592.1|2041501_2041783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065538593.1|2041779_2042574_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_065538594.1|2042607_2043228_-	ABC transporter ATP-binding protein	NA	A0A2H4UU96	Bodo_saltans_virus	24.5	2.9e-08
WP_065538595.1|2043393_2044305_+	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_065538596.1|2044329_2044704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065538597.1|2045079_2045568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065538598.1|2045571_2046690_+	DUF4339 domain-containing protein	NA	NA	NA	NA	NA
WP_065538599.1|2046686_2047793_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_065538600.1|2047834_2048197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065538601.1|2048363_2048906_+	ferredoxin	NA	NA	NA	NA	NA
WP_065538602.1|2048995_2050111_+	agmatine deiminase family protein	NA	M1ICB7	Acanthocystis_turfacea_Chlorella_virus	31.0	1.9e-42
WP_065538603.1|2050140_2051025_+	carbon-nitrogen hydrolase	NA	M1I3K9	Paramecium_bursaria_Chlorella_virus	40.8	1.9e-53
WP_065538604.1|2051324_2051714_-	GtrA family protein	NA	NA	NA	NA	NA
WP_065540353.1|2051710_2053474_-|tRNA	aspartate--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	25.2	2.3e-13
WP_065538605.1|2053582_2054608_-	diacylglycerol kinase family lipid kinase	NA	A0A1V0SBJ0	Catovirus	26.7	2.0e-14
WP_065538606.1|2054828_2056013_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	V5LQ39	Emiliania_huxleyi_virus	34.3	1.3e-49
WP_065537976.1|2056298_2057990_-|transposase	DDE transposase	transposase	NA	NA	NA	NA
WP_065538607.1|2058842_2059826_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_024988949.1|2059791_2060178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065540354.1|2060810_2061005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065538608.1|2061120_2061831_-	methyltransferase	NA	M1HKL6	Paramecium_bursaria_Chlorella_virus	29.8	2.0e-05
WP_065538609.1|2062047_2064513_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	41.1	3.4e-156
WP_065538610.1|2064509_2065640_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	43.0	1.2e-79
WP_065538611.1|2065643_2066741_+	YjgP/YjgQ family permease	NA	NA	NA	NA	NA
WP_065538612.1|2066961_2068521_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_065538613.1|2068780_2069284_-	redoxin domain-containing protein	NA	NA	NA	NA	NA
WP_065538615.1|2069553_2070783_+	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_065538616.1|2070829_2072092_+	DEAD/DEAH box helicase	NA	A0A1B1IS59	uncultured_Mediterranean_phage	30.7	1.7e-50
WP_065538617.1|2072173_2072971_-	DUF4738 domain-containing protein	NA	NA	NA	NA	NA
WP_065538618.1|2073006_2074320_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	38.7	1.0e-79
WP_065538619.1|2074346_2074895_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A1D8EQH2	Escherichia_phage	44.2	7.0e-38
WP_065538620.1|2074985_2076077_+	HU-CCDC81 and SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_065538621.1|2076095_2076623_+	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_084081130.1|2076650_2076845_+	DUF3791 domain-containing protein	NA	NA	NA	NA	NA
WP_065538622.1|2076853_2077222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009131421.1|2077223_2077568_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_065538623.1|2077655_2079437_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	29.1	1.2e-27
>prophage 7
NZ_CP015401	Bacteroides caecimuris strain I48 chromosome, complete genome	4839927	2286498	2350980	4839927	transposase,tRNA	Wolbachia_phage(36.36%)	57	NA	NA
WP_065538760.1|2286498_2288259_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	28.6	4.7e-27
WP_084081204.1|2288342_2289206_-	AAA domain-containing protein	NA	A0A2H4PB07	Aphanizomenon_phage	30.3	7.2e-21
WP_065538761.1|2289308_2289512_-	SEL1-like repeat protein	NA	NA	NA	NA	NA
WP_065538763.1|2290384_2290639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065538764.1|2290703_2292200_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_065538766.1|2292873_2293263_-	DUF1232 domain-containing protein	NA	NA	NA	NA	NA
WP_141243586.1|2293268_2293502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065538767.1|2293504_2293729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065538768.1|2293739_2294018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065538769.1|2294022_2295498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065538770.1|2295499_2298142_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_065538771.1|2298155_2300069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065538772.1|2300073_2300868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065538773.1|2300905_2301325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065540367.1|2301360_2301876_-	phospholipase	NA	NA	NA	NA	NA
WP_065538775.1|2302368_2303838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024987244.1|2304243_2305098_+	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_065538776.1|2305097_2306336_+	DNA recombination protein RmuC	NA	NA	NA	NA	NA
WP_065538777.1|2306336_2307656_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	42.3	7.2e-65
WP_065538778.1|2307771_2309553_-	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	40.0	4.2e-23
WP_065538779.1|2309680_2309881_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_065538780.1|2310036_2310495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071807666.1|2310594_2311002_+	YjbQ family protein	NA	NA	NA	NA	NA
WP_065538782.1|2311054_2312308_-	Nramp family divalent metal transporter	NA	NA	NA	NA	NA
WP_065538783.1|2312565_2312811_-	TIGR03905 family TSCPD domain-containing protein	NA	NA	NA	NA	NA
WP_065538784.1|2312820_2313558_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_065538785.1|2313591_2316054_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_065538786.1|2316319_2317879_-	replicative DNA helicase	NA	A0A0F7L6J1	uncultured_marine_virus	44.2	9.1e-99
WP_065538787.1|2318114_2318939_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_065538788.1|2319194_2320229_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	43.2	5.5e-76
WP_004303570.1|2320452_2321025_-	electron transport complex subunit RsxA	NA	NA	NA	NA	NA
WP_065538789.1|2321047_2321632_-	electron transport complex subunit E	NA	NA	NA	NA	NA
WP_065538790.1|2321646_2322378_-	RnfABCDGE type electron transport complex subunit G	NA	NA	NA	NA	NA
WP_065538791.1|2322374_2323382_-	RnfABCDGE type electron transport complex subunit D	NA	NA	NA	NA	NA
WP_065538792.1|2323387_2324725_-	electron transport complex subunit RsxC	NA	NA	NA	NA	NA
WP_065538793.1|2324749_2325616_-	Fe-S cluster domain-containing protein	NA	NA	NA	NA	NA
WP_065538794.1|2325623_2326049_-	SoxR reducing system RseC family protein	NA	NA	NA	NA	NA
WP_065538795.1|2326284_2327838_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_065540368.1|2327876_2329451_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_065538796.1|2329579_2332795_-	DUF4906 domain-containing protein	NA	NA	NA	NA	NA
WP_065538797.1|2332839_2333934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065538798.1|2333930_2334947_-	FimB/Mfa2 family fimbrial subunit	NA	NA	NA	NA	NA
WP_065538799.1|2334957_2336943_-	Mfa1 family fimbria major subunit	NA	NA	NA	NA	NA
WP_065538800.1|2336997_2338431_-	DUF3868 domain-containing protein	NA	NA	NA	NA	NA
WP_065538801.1|2338445_2339033_-	DUF3575 domain-containing protein	NA	NA	NA	NA	NA
WP_167371340.1|2339600_2339741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065538802.1|2339905_2340529_+	virulence protein E	NA	NA	NA	NA	NA
WP_065538803.1|2340549_2342412_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_065538804.1|2342539_2342758_-	DUF4248 domain-containing protein	NA	NA	NA	NA	NA
WP_065538805.1|2342979_2343468_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_157448000.1|2343729_2343837_+	smalltalk protein	NA	NA	NA	NA	NA
WP_065538806.1|2343841_2344255_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A0F7LBB1	uncultured_marine_virus	50.0	1.2e-34
WP_065537976.1|2344523_2346215_+|transposase	DDE transposase	transposase	NA	NA	NA	NA
WP_065538807.1|2346462_2347410_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	A0A1B2LRR6	Wolbachia_phage	29.8	5.4e-22
WP_065538808.1|2347676_2348564_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	A0A1B2LRR6	Wolbachia_phage	29.4	2.5e-21
WP_065538809.1|2348830_2349802_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	A0A1B2LRR6	Wolbachia_phage	29.4	2.8e-21
WP_065538810.1|2350068_2350980_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	A0A1B2LRR6	Wolbachia_phage	29.8	5.2e-22
>prophage 8
NZ_CP015401	Bacteroides caecimuris strain I48 chromosome, complete genome	4839927	2784580	2812291	4839927	integrase,transposase	uncultured_marine_virus(12.5%)	35	2798585:2798599	2814587:2814601
WP_065537581.1|2784580_2784952_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_065539072.1|2784992_2785928_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_065539073.1|2786235_2787561_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_141243592.1|2787720_2788437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065539075.1|2788656_2788956_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_065540406.1|2788958_2789264_+	AbrB family transcriptional regulator	NA	NA	NA	NA	NA
WP_065539076.1|2789256_2789478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065539077.1|2789479_2790199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065539078.1|2790164_2791565_+	replicative DNA helicase	NA	A0A0F7L6J1	uncultured_marine_virus	37.3	2.5e-71
WP_065539079.1|2791609_2792146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065539080.1|2792142_2793363_+	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_024988075.1|2793343_2793586_+	VRR-NUC domain-containing protein	NA	NA	NA	NA	NA
WP_065539081.1|2793777_2794197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024988073.1|2794222_2794456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065539082.1|2794800_2795079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065539083.1|2795334_2795934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065539084.1|2795983_2797042_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0A7RTT7	Clostridium_phage	27.9	2.7e-30
WP_005652458.1|2798310_2798496_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_065539085.1|2798535_2798988_+	pilus assembly protein HicB	NA	NA	NA	NA	NA
2798585:2798599	attL	CAATGGATATGAAAG	NA	NA	NA	NA
WP_141243593.1|2799180_2800119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065539087.1|2800509_2801061_-	cell filamentation protein Fic	NA	NA	NA	NA	NA
WP_065539088.1|2801064_2801826_-	Fic family protein	NA	A0A1V0E025	Clostridioides_phage	31.3	3.6e-08
WP_065539089.1|2801833_2802835_-	cell filamentation protein Fic	NA	Q9JMN3	Wolbachia_phage	47.9	3.4e-75
WP_050428031.1|2802853_2803153_-	helix-turn-helix domain-containing protein	NA	F5A3H2	Riemerella_phage	41.1	8.8e-11
WP_065539090.1|2803291_2803720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065539091.1|2803773_2803968_+	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_065539092.1|2804040_2804289_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_065538200.1|2804746_2806312_+|transposase	IS21 family transposase	transposase	A0A059NT83	Lactococcus_phage	26.3	6.5e-12
WP_065539093.1|2806301_2807075_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	37.8	8.0e-40
WP_065540407.1|2807260_2807569_+	DNA methylase	NA	NA	NA	NA	NA
WP_065540408.1|2807716_2808328_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_084081121.1|2808416_2810018_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_065538284.1|2810096_2810453_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_065538285.1|2810439_2811009_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065539094.1|2811184_2812291_+|integrase	site-specific integrase	integrase	S5W9T9	Leptospira_phage	33.6	4.1e-29
2814587:2814601	attR	CAATGGATATGAAAG	NA	NA	NA	NA
>prophage 9
NZ_CP015401	Bacteroides caecimuris strain I48 chromosome, complete genome	4839927	2822137	2879064	4839927	integrase,transposase,tRNA	Lactococcus_phage(14.29%)	45	2839024:2839040	2885802:2885818
WP_065539103.1|2822137_2823703_-|transposase	IS21 family transposase	transposase	A0A059NT83	Lactococcus_phage	26.3	6.5e-12
WP_065539105.1|2824436_2824652_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065539106.1|2824648_2827135_-	ferrous iron transport protein B	NA	NA	NA	NA	NA
WP_065539107.1|2827280_2828561_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_065539108.1|2828545_2829382_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_065539109.1|2829620_2831840_+	transcription termination factor Rho	NA	NA	NA	NA	NA
WP_065539110.1|2832125_2833592_+	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_065539111.1|2833799_2835122_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_065539112.1|2835226_2836549_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_004312924.1|2836820_2837702_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	31.7	2.1e-28
WP_065539113.1|2837698_2838880_+	CapA family protein	NA	A0A2H4JG01	uncultured_Caudovirales_phage	28.9	2.1e-39
2839024:2839040	attL	GAGGGTTTTCTTTTTGT	NA	NA	NA	NA
WP_065537581.1|2839132_2839504_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_065539072.1|2839544_2840480_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_065540410.1|2841295_2843161_-	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	43.7	3.0e-48
WP_065539114.1|2843321_2843618_+	septum formation initiator family protein	NA	NA	NA	NA	NA
WP_065539115.1|2843621_2843963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008771479.1|2844075_2844678_-	OmpH family outer membrane protein	NA	NA	NA	NA	NA
WP_008026083.1|2844705_2844939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065539116.1|2845072_2846533_+	aminoacyl-histidine dipeptidase	NA	NA	NA	NA	NA
WP_065539117.1|2846513_2847728_+	endonuclease	NA	NA	NA	NA	NA
WP_065539118.1|2847990_2849601_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_065539119.1|2849708_2850884_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_065540411.1|2850950_2851700_-	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_065539120.1|2851735_2853166_-	phosphotransferase	NA	NA	NA	NA	NA
WP_065539123.1|2854158_2855919_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	28.9	3.6e-27
WP_065538204.1|2856006_2856351_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_065538241.1|2856352_2856721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008026044.1|2857086_2857602_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_065539125.1|2857697_2859164_-	ATP-binding cassette domain-containing protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	23.9	1.6e-09
WP_065539126.1|2859294_2861436_-	alpha-glucuronidase	NA	NA	NA	NA	NA
WP_065539127.1|2861479_2862457_-	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_065539128.1|2862681_2863818_-	endo-1,4-beta-xylanase	NA	NA	NA	NA	NA
WP_065539129.1|2863847_2865332_-	MFS transporter	NA	NA	NA	NA	NA
WP_065539130.1|2865365_2867000_-	9-O-acetylesterase	NA	NA	NA	NA	NA
WP_065539131.1|2867386_2869393_-	type I pullulanase	NA	NA	NA	NA	NA
WP_004312686.1|2869447_2870014_-	crossover junction endodeoxyribonuclease RuvC	NA	NA	NA	NA	NA
WP_065539132.1|2870010_2870313_-	DUF4286 family protein	NA	NA	NA	NA	NA
WP_065539133.1|2870555_2871446_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_065539134.1|2872047_2872536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084081121.1|2872640_2874242_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_065538284.1|2874320_2874677_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_065538285.1|2874663_2875233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065540412.1|2875428_2875641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065539135.1|2876451_2877468_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_065539136.1|2877828_2879064_+|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	32.7	2.4e-25
2885802:2885818	attR	GAGGGTTTTCTTTTTGT	NA	NA	NA	NA
>prophage 10
NZ_CP015401	Bacteroides caecimuris strain I48 chromosome, complete genome	4839927	3063347	3092315	4839927	protease,transposase,tRNA	Wolbachia_phage(50.0%)	27	NA	NA
WP_065538162.1|3063347_3064499_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_065539243.1|3064992_3065889_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_065539244.1|3065944_3067009_+	metallophosphoesterase	NA	NA	NA	NA	NA
WP_065539245.1|3067255_3067846_-	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_065539246.1|3067832_3068048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065539247.1|3068057_3068627_-	guanylate kinase	NA	NA	NA	NA	NA
WP_065539248.1|3068813_3069692_-	YicC family protein	NA	NA	NA	NA	NA
WP_065539249.1|3069781_3070471_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_065539250.1|3070501_3071113_+	DUF4290 domain-containing protein	NA	NA	NA	NA	NA
WP_065539251.1|3071206_3072511_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_065539252.1|3072507_3073047_+	16S rRNA processing protein RimM	NA	NA	NA	NA	NA
WP_065539253.1|3073121_3073982_+	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_065539254.1|3074011_3075196_+	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_065539255.1|3075241_3076597_+|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_065539256.1|3076787_3077246_-	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	K4F5U2	Cronobacter_phage	42.8	4.2e-28
WP_065540424.1|3077248_3079642_-	anaerobic ribonucleoside triphosphate reductase	NA	A0A0A8WEK0	Clostridium_phage	46.0	3.3e-185
WP_065539259.1|3081584_3081926_+|transposase	DDE transposase family protein	transposase	NA	NA	NA	NA
WP_065539260.1|3082161_3084453_+	NADP-dependent malic enzyme	NA	NA	NA	NA	NA
WP_089280722.1|3084449_3084626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024987856.1|3084873_3086208_+	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_065539261.1|3086383_3086602_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_065539262.1|3086598_3086925_+	phosphatidylinositol kinase	NA	NA	NA	NA	NA
WP_065540425.1|3086927_3087863_+	HipA domain-containing protein	NA	NA	NA	NA	NA
WP_065539263.1|3088261_3089401_+	PCMD domain-containing protein	NA	NA	NA	NA	NA
WP_065539264.1|3089428_3090223_+	PorT family protein	NA	NA	NA	NA	NA
WP_065539265.1|3090485_3091346_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	A0A1B2LRR6	Wolbachia_phage	32.9	9.6e-26
WP_065539266.1|3091442_3092315_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	A0A1B2LRR6	Wolbachia_phage	31.9	1.1e-24
>prophage 11
NZ_CP015401	Bacteroides caecimuris strain I48 chromosome, complete genome	4839927	3470525	3580260	4839927	integrase,protease,transposase	Bacillus_phage(25.0%)	55	3508855:3508869	3582085:3582099
WP_065539500.1|3470525_3473111_+|protease	zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_065539501.1|3473125_3475669_+	DUF5117 domain-containing protein	NA	NA	NA	NA	NA
WP_065539502.1|3475954_3478738_+	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_065539504.1|3485508_3487503_-	glycoside hydrolase family 97 protein	NA	NA	NA	NA	NA
WP_065540454.1|3487731_3489735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065540455.1|3489768_3490743_-	family 43 glycosylhydrolase	NA	NA	NA	NA	NA
WP_065539505.1|3490766_3493010_-	beta-glucosidase BglX	NA	NA	NA	NA	NA
WP_084081161.1|3493115_3495179_-	DUF5125 domain-containing protein	NA	NA	NA	NA	NA
WP_065539506.1|3495192_3496185_-	family 43 glycosylhydrolase	NA	NA	NA	NA	NA
WP_065540457.1|3496221_3497868_-	RagB/SusD family nutrient uptake outer membrane protein	NA	NA	NA	NA	NA
WP_065539507.1|3497891_3501257_-	SusC/RagA family TonB-linked outer membrane protein	NA	NA	NA	NA	NA
WP_065539509.1|3501529_3502543_-	DUF4974 domain-containing protein	NA	NA	NA	NA	NA
WP_065539510.1|3502614_3503205_-	RNA polymerase sigma-70 factor	NA	NA	NA	NA	NA
WP_065539511.1|3503393_3504908_+	SLC13/DASS family transporter	NA	NA	NA	NA	NA
WP_065539512.1|3504969_3508998_-	hybrid sensor histidine kinase/response regulator transcription factor	NA	W8CYM9	Bacillus_phage	34.5	2.7e-09
3508855:3508869	attL	GTCTTTTTGGATATG	NA	NA	NA	NA
WP_065539513.1|3509363_3511562_-	glycoside hydrolase family 92 protein	NA	NA	NA	NA	NA
WP_065539514.1|3511834_3513613_+	signal peptide peptidase SppA	NA	A0A2I7QTH6	Vibrio_phage	25.3	1.0e-05
WP_065539515.1|3513623_3514754_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_004316831.1|3514710_3515520_+	purine-nucleoside phosphorylase	NA	Q5YBA4	Grouper_iridovirus	41.3	5.4e-55
WP_065539516.1|3515536_3516574_+	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_065537581.1|3516988_3517360_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_065539072.1|3517400_3518336_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_157448005.1|3518692_3518845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089280781.1|3518870_3521156_-	glycosyl hydrolase	NA	NA	NA	NA	NA
WP_065539519.1|3521478_3522930_-	fimbrillin family protein	NA	NA	NA	NA	NA
WP_065539520.1|3522969_3523803_-	fimbrillin family protein	NA	NA	NA	NA	NA
WP_084081162.1|3523950_3525375_-	DUF1735 domain-containing protein	NA	NA	NA	NA	NA
WP_065540458.1|3525393_3527394_-	RagB/SusD family nutrient uptake outer membrane protein	NA	NA	NA	NA	NA
WP_065539522.1|3527422_3530611_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_008026447.1|3530723_3532679_-	glycoside hydrolase family 97 protein	NA	NA	NA	NA	NA
WP_008026451.1|3532961_3534185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158213967.1|3534198_3536259_+	Retaining alpha-galactosidase	NA	NA	NA	NA	NA
WP_065539523.1|3536292_3537816_+	alpha/beta hydrolase fold domain-containing protein	NA	NA	NA	NA	NA
WP_065539524.1|3537832_3540133_+	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_084081164.1|3540374_3541475_-	family 43 glycosylhydrolase	NA	NA	NA	NA	NA
WP_065540461.1|3541699_3543544_+	beta-galactosidase	NA	NA	NA	NA	NA
WP_065539525.1|3543574_3546421_+	family 10 glycosylhydrolase	NA	NA	NA	NA	NA
WP_065539526.1|3546650_3547199_+	RNA polymerase sigma-70 factor	NA	NA	NA	NA	NA
WP_065539527.1|3547378_3548323_+	FecR family protein	NA	NA	NA	NA	NA
WP_158213969.1|3548730_3551727_+	SusC/RagA family TonB-linked outer membrane protein	NA	NA	NA	NA	NA
WP_065539528.1|3551740_3553522_+	RagB/SusD family nutrient uptake outer membrane protein	NA	NA	NA	NA	NA
WP_065539529.1|3553533_3554694_+	PKD domain-containing protein	NA	NA	NA	NA	NA
WP_141243584.1|3554724_3556389_+	BACON domain-containing protein	NA	NA	NA	NA	NA
WP_065539531.1|3556533_3557421_+	fimbrillin family protein	NA	NA	NA	NA	NA
WP_084081166.1|3557446_3559558_+	fimbrillin family protein	NA	NA	NA	NA	NA
WP_065539533.1|3559695_3562203_+	family 20 glycosylhydrolase	NA	NA	NA	NA	NA
WP_065539534.1|3562377_3566340_+	hybrid sensor histidine kinase/response regulator transcription factor	NA	Q6XM27	Feldmannia_irregularis_virus	24.6	8.7e-13
WP_084081167.1|3566693_3567260_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_065539535.1|3567326_3568481_+	FecR family protein	NA	NA	NA	NA	NA
WP_065539536.1|3568488_3572025_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_065539537.1|3572037_3573504_+	RagB/SusD family nutrient uptake outer membrane protein	NA	NA	NA	NA	NA
WP_065539538.1|3573511_3574417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065539539.1|3574434_3576975_+|protease	zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_065538162.1|3577455_3578607_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_065539540.1|3579036_3580260_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
3582085:3582099	attR	GTCTTTTTGGATATG	NA	NA	NA	NA
>prophage 12
NZ_CP015401	Bacteroides caecimuris strain I48 chromosome, complete genome	4839927	3728039	3777395	4839927	integrase,protease,transposase	Klosneuvirus(33.33%)	47	3724315:3724330	3791639:3791654
3724315:3724330	attL	GTTTCACCGTTGCCGG	NA	NA	NA	NA
WP_065539616.1|3728039_3728831_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_008644950.1|3728902_3729325_-	SufE family protein	NA	NA	NA	NA	NA
WP_065539617.1|3729347_3730343_-	M28 family peptidase	NA	NA	NA	NA	NA
WP_065539618.1|3730413_3731322_-	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_065539619.1|3731539_3732499_+	phosphate butyryltransferase	NA	NA	NA	NA	NA
WP_065539620.1|3732524_3733586_+	butyrate kinase	NA	NA	NA	NA	NA
WP_065539621.1|3734180_3736307_-	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_065539622.1|3736503_3737655_+	AhpC/TSA family protein	NA	NA	NA	NA	NA
WP_065540470.1|3737836_3738301_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_008026146.1|3738352_3738745_+	HIT family protein	NA	NA	NA	NA	NA
WP_065539624.1|3741339_3742305_+	glutaminase A	NA	NA	NA	NA	NA
WP_065539625.1|3742517_3743297_-	two pore domain potassium channel family protein	NA	NA	NA	NA	NA
WP_065537582.1|3746254_3747190_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_065537581.1|3747230_3747602_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_065539626.1|3748529_3749852_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_084081212.1|3752145_3753522_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_084081172.1|3753532_3754333_-	META domain-containing protein	NA	NA	NA	NA	NA
WP_084081213.1|3754334_3754679_-	DUF3795 domain-containing protein	NA	NA	NA	NA	NA
WP_065539629.1|3754683_3755088_-	DUF3795 domain-containing protein	NA	NA	NA	NA	NA
WP_065539630.1|3755265_3756606_-	TonB family protein	NA	NA	NA	NA	NA
WP_065540471.1|3756608_3756974_-	BlaI/MecI/CopY family transcriptional regulator	NA	NA	NA	NA	NA
WP_084081173.1|3757139_3757505_-	VOC family protein	NA	NA	NA	NA	NA
WP_065539631.1|3757597_3758404_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_065539632.1|3758400_3759030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065539633.1|3759026_3759629_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_065539634.1|3759711_3760512_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_065540473.1|3760660_3761341_-	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_084081214.1|3761382_3761826_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065539636.1|3761834_3762437_-	uracil-DNA glycosylase	NA	NA	NA	NA	NA
WP_065539637.1|3762460_3763093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065539638.1|3763102_3764887_-	DUF4303 domain-containing protein	NA	NA	NA	NA	NA
WP_065539639.1|3764876_3765665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065540474.1|3765731_3766052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065540475.1|3766375_3766666_-	GTP cyclohydrolase	NA	NA	NA	NA	NA
WP_084081174.1|3766951_3767848_-	class A beta-lactamase	NA	NA	NA	NA	NA
WP_065539640.1|3767867_3768503_-	CatB-related O-acetyltransferase	NA	A0A1V0SJ47	Klosneuvirus	43.3	1.6e-22
WP_065540477.1|3768632_3769004_-	BlaI/MecI/CopY family transcriptional regulator	NA	NA	NA	NA	NA
WP_065539641.1|3769304_3769724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065539642.1|3770003_3770471_-	DUF3408 domain-containing protein	NA	NA	NA	NA	NA
WP_065540478.1|3770880_3771192_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_065539643.1|3771245_3771551_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_065539644.1|3771594_3771906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065539645.1|3771902_3772277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071807732.1|3773625_3774105_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_065539646.1|3774345_3775911_+|transposase	IS21 family transposase	transposase	A0A059NT83	Lactococcus_phage	26.3	6.5e-12
WP_065539093.1|3775900_3776674_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	37.8	8.0e-40
WP_065539647.1|3776780_3777395_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
3791639:3791654	attR	GTTTCACCGTTGCCGG	NA	NA	NA	NA
>prophage 13
NZ_CP015401	Bacteroides caecimuris strain I48 chromosome, complete genome	4839927	3894741	3960582	4839927	integrase,transposase	Staphylococcus_phage(28.57%)	55	3887935:3887957	3898631:3898653
3887935:3887957	attL	AAATTAACACAAGAAGAATATAA	NA	NA	NA	NA
WP_015546403.1|3894741_3895965_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_015546402.1|3895990_3897145_+	DUF1016 family protein	NA	A0A0U2BZN7	Salmonella_phage	43.6	1.9e-29
WP_015546401.1|3897376_3897949_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_065539704.1|3897958_3898522_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_065537559.1|3898954_3899932_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
3898631:3898653	attR	AAATTAACACAAGAAGAATATAA	NA	NA	NA	NA
WP_167371345.1|3900118_3900280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024988423.1|3900301_3900970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_055221615.1|3900999_3903291_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_024988420.1|3903575_3903815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024988419.1|3903768_3904188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024988418.1|3904318_3904651_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_065539705.1|3904706_3905426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_055221611.1|3905430_3906357_-	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_055221609.1|3906322_3906706_-	MobC family plasmid mobilization relaxosome protein	NA	NA	NA	NA	NA
WP_065540485.1|3906852_3907818_-	DNA primase	NA	NA	NA	NA	NA
WP_057098942.1|3907981_3909055_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_005944327.1|3909060_3909348_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_065537559.1|3910326_3911304_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_065539707.1|3911900_3912983_+	mannose-1-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_065539708.1|3913147_3914797_-	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	25.4	3.4e-27
WP_065539709.1|3914860_3915436_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004296393.1|3915621_3915891_-	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_004317549.1|3916046_3917846_+	translational GTPase TypA	NA	A0A1S5SF82	Streptococcus_phage	41.4	6.7e-21
WP_004317547.1|3917936_3918461_-	chromate transporter	NA	NA	NA	NA	NA
WP_065539710.1|3918457_3918655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065539711.1|3918929_3920537_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	50.1	1.1e-126
WP_024987958.1|3920823_3921477_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_065540486.1|3921481_3922357_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_065539712.1|3922395_3924033_-	MFS transporter	NA	NA	NA	NA	NA
WP_065539713.1|3924082_3925174_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_024987955.1|3925196_3926528_-	TolC family protein	NA	NA	NA	NA	NA
WP_065538285.1|3926815_3927385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065538284.1|3927371_3927728_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_084081121.1|3927806_3929408_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_065539714.1|3929542_3932056_-	YfhO family protein	NA	NA	NA	NA	NA
WP_024987950.1|3932224_3933643_-	adenosylhomocysteinase	NA	S4W1G4	Pandoravirus	31.5	2.0e-52
WP_065539715.1|3933806_3935495_-	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	28.7	5.7e-22
WP_065539716.1|3935540_3936530_-	adenosine kinase	NA	NA	NA	NA	NA
WP_065539717.1|3937037_3937745_-	ComF family protein	NA	NA	NA	NA	NA
WP_065539718.1|3937788_3938592_-	inositol monophosphatase	NA	NA	NA	NA	NA
WP_065539719.1|3938832_3940362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065539720.1|3940375_3941155_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065539721.1|3941162_3941936_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_065539722.1|3941967_3942924_-	DUF4974 domain-containing protein	NA	NA	NA	NA	NA
WP_004317492.1|3943032_3943614_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_065539723.1|3943732_3945916_-	alpha-N-acetylglucosaminidase	NA	NA	NA	NA	NA
WP_065539724.1|3945922_3947008_-	DUF5009 domain-containing protein	NA	NA	NA	NA	NA
WP_065539725.1|3947022_3948279_-	GntP family permease	NA	NA	NA	NA	NA
WP_065539726.1|3948285_3949428_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	36.6	3.7e-41
WP_065539727.1|3949436_3951593_-	alpha-N-acetylglucosaminidase	NA	NA	NA	NA	NA
WP_065539728.1|3951621_3952404_-	endonuclease	NA	NA	NA	NA	NA
WP_009038936.1|3952432_3954166_-	RagB/SusD family nutrient uptake outer membrane protein	NA	NA	NA	NA	NA
WP_065539729.1|3954186_3957606_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_065538162.1|3958099_3959251_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_065538162.1|3959430_3960582_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 14
NZ_CP015401	Bacteroides caecimuris strain I48 chromosome, complete genome	4839927	3985187	4034604	4839927	protease,tRNA,transposase,portal,tail	unidentified_phage(15.38%)	50	NA	NA
WP_065538612.1|3985187_3986747_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_065539744.1|3986840_3988658_-|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	29.6	5.9e-49
WP_004296482.1|3988741_3989014_-	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	52.2	1.2e-14
WP_065539745.1|3989232_3989913_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_065539746.1|3989893_3990799_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_065539747.1|3990803_3991889_+	endonuclease	NA	NA	NA	NA	NA
WP_065539748.1|3991917_3994005_+	M3 family metallopeptidase	NA	A0A1V0SD92	Indivirus	25.0	7.2e-43
WP_065539749.1|3994170_3997182_+	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	32.5	3.3e-28
WP_084081216.1|3997658_3998258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005650556.1|3998265_3998862_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1Q1PVL9	Phage_DP-2017a	35.8	9.6e-25
WP_005650557.1|3998858_3999455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005650559.1|3999454_3999835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005650561.1|3999831_4000260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008642534.1|4000222_4001410_-	reverse transcriptase	NA	H7BVW2	unidentified_phage	99.7	3.4e-239
WP_065539751.1|4001742_4003104_-	hypothetical protein	NA	H7BVW1	unidentified_phage	97.1	6.4e-266
WP_065540488.1|4003106_4003391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008642527.1|4008951_4010136_-	hypothetical protein	NA	F5A3A0	Riemerella_phage	36.5	2.4e-19
WP_005655404.1|4010137_4010647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065539752.1|4010649_4016061_-|tail	phage tail tape measure protein	tail	F5A3A4	Riemerella_phage	36.0	2.4e-58
WP_032592241.1|4016293_4016950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024986349.1|4017018_4017528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024986350.1|4017539_4017968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005655410.1|4017964_4018435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005655412.1|4018425_4018758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005655413.1|4018759_4019095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024986351.1|4019100_4019427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065539753.1|4019438_4020674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065539754.1|4020693_4021341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005655418.1|4021349_4021955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065540489.1|4022431_4022683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065539755.1|4022694_4023060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024986355.1|4023103_4023283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162223847.1|4023325_4023466_+	hypothetical protein	NA	H2A0D9	Bacteroides_phage	65.2	5.3e-11
WP_024986356.1|4023477_4023657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008642513.1|4023668_4023881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024986357.1|4024045_4024321_+	DUF3846 domain-containing protein	NA	NA	NA	NA	NA
WP_084081179.1|4024577_4025381_+	DNA cytosine methyltransferase	NA	R9ZYX6	Cellulophaga_phage	51.7	1.5e-73
WP_128824230.1|4025386_4025620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024986359.1|4025616_4025850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024986361.1|4026028_4026283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024986362.1|4026294_4026579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024986363.1|4026584_4026914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024986364.1|4027009_4027261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024986365.1|4027253_4027529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024986366.1|4027530_4028304_+	ADP-ribosylglycohydrolase	NA	NA	NA	NA	NA
WP_024986367.1|4028296_4028620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065539757.1|4028660_4031270_-	hypothetical protein	NA	A0A1B3B0Z8	Gordonia_phage	30.6	9.8e-05
WP_024986368.1|4031404_4031734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005655441.1|4031733_4033158_-|portal	phage portal protein	portal	NA	NA	NA	NA
WP_008642503.1|4033173_4034604_-|portal	phage portal protein	portal	A0A0F7IJY8	Polaribacter_phage	50.2	3.6e-126
