The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP015400	Hungateiclostridiaceae bacterium KB18 chromosome, complete genome	3802844	240482	288918	3802844	transposase	Streptococcus_phage(15.38%)	42	NA	NA
WP_066533705.1|240482_241790_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_066533707.1|241993_243475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157130558.1|243538_245551_+	DUF87 domain-containing protein	NA	NA	NA	NA	NA
WP_066533709.1|245544_246606_+	DNA cytosine methyltransferase	NA	A0A2K9V3X0	Faecalibacterium_phage	50.5	2.1e-22
WP_066533712.1|246595_247063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157130559.1|248943_249399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066533719.1|249424_249862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066533721.1|249803_250181_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_066533723.1|251103_252795_+	S-layer homology domain-containing protein	NA	NA	NA	NA	NA
WP_066533725.1|253860_254160_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_066533727.1|254458_254767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066533729.1|254849_255698_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_066541554.1|255963_257598_+	recombinase family protein	NA	D7RWL2	Brochothrix_phage	23.6	3.0e-12
WP_066533731.1|257938_258709_+	replication initiator protein A	NA	M1PFC4	Streptococcus_phage	35.7	9.2e-12
WP_066533733.1|258892_260251_+|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	29.6	4.4e-41
WP_084384160.1|260937_261741_-	response regulator	NA	NA	NA	NA	NA
WP_066533737.1|261724_263455_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	31.0	2.3e-18
WP_066533740.1|263455_264853_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_066533742.1|264877_265780_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_066541555.1|265794_266649_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_066533744.1|266771_268520_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_088364400.1|269765_270561_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_066533753.1|270656_271538_-	hypothetical protein	NA	H7BUV7	unidentified_phage	31.6	5.6e-05
WP_088364399.1|271846_273496_-	recombinase family protein	NA	A0A2K5B2B4	Erysipelothrix_phage	45.5	1.9e-94
WP_066533759.1|273422_274349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084384162.1|274345_275953_-	recombinase family protein	NA	A0A2K5B2B2	Erysipelothrix_phage	33.6	1.1e-70
WP_066533761.1|276481_276985_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_066533763.1|277309_277657_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_066533764.1|277653_277845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066533767.1|277916_278555_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	35.1	1.3e-14
WP_066533768.1|278569_279958_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_066533770.1|279969_281133_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_066533772.1|281226_282597_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_066533774.1|282593_283259_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	34.5	3.6e-28
WP_066533776.1|283402_284281_-	radical SAM protein	NA	NA	NA	NA	NA
WP_066533779.1|284293_285193_-	radical SAM protein	NA	NA	NA	NA	NA
WP_066533780.1|285321_285657_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_066533782.1|285672_285993_+	multidrug transporter	NA	NA	NA	NA	NA
WP_157130560.1|286551_287250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084384163.1|287705_287909_-	hypothetical protein	NA	S5VTD3	Leptospira_phage	45.6	3.4e-06
WP_084384164.1|287939_288701_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	31.1	2.9e-18
WP_066533794.1|288594_288918_-|transposase	transposase	transposase	S5VTD3	Leptospira_phage	33.3	3.2e-06
>prophage 2
NZ_CP015400	Hungateiclostridiaceae bacterium KB18 chromosome, complete genome	3802844	350418	357531	3802844		Synechococcus_phage(33.33%)	7	NA	NA
WP_157130564.1|350418_351357_-	FkbM family methyltransferase	NA	A0A0A0V284	uncultured_virus	33.6	6.8e-09
WP_084384173.1|351580_352786_-	HAD-IIIA family hydrolase	NA	A0A291LA53	Escherichia_phage	28.4	1.5e-08
WP_066533906.1|352788_353436_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_066533910.1|353429_354437_-	kinase	NA	A0A222YW25	Synechococcus_phage	29.0	5.6e-33
WP_066533916.1|354459_355398_-	NAD(P)-dependent oxidoreductase	NA	A0A0F7LC08	uncultured_marine_virus	44.2	1.8e-73
WP_066533918.1|355414_356581_-	DegT/DnrJ/EryC1/StrS aminotransferase family protein	NA	A0A0E3G2F3	Synechococcus_phage	38.4	5.6e-69
WP_066533920.1|356583_357531_-	GDP-L-fucose synthase	NA	M1HWW2	Paramecium_bursaria_Chlorella_virus	53.6	1.5e-93
>prophage 3
NZ_CP015400	Hungateiclostridiaceae bacterium KB18 chromosome, complete genome	3802844	371330	404406	3802844	integrase,transposase	Clostridium_phage(50.0%)	35	374437:374451	404423:404437
WP_084384175.1|371330_371438_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_066533947.1|372246_374241_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_066533948.1|374237_375458_-	hypothetical protein	NA	NA	NA	NA	NA
374437:374451	attL	GTCCAGAAGAAATTG	NA	NA	NA	NA
WP_066533951.1|375435_376323_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	34.8	1.1e-29
WP_066533955.1|376324_377491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066533957.1|377493_378522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066533959.1|378671_379193_-	VanZ family protein	NA	NA	NA	NA	NA
WP_157130565.1|379278_379473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066533961.1|379409_379952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066533963.1|380047_381319_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_066533964.1|381306_381981_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_157130566.1|382422_383133_+	DUF3991 domain-containing protein	NA	NA	NA	NA	NA
WP_066533968.1|383140_384106_-	uroporphyrinogen III decarboxylase	NA	NA	NA	NA	NA
WP_084384176.1|384206_385955_+	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_066533972.1|386580_387162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088364387.1|387174_387931_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_084384177.1|387947_388835_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	27.9	2.2e-25
WP_016221926.1|388936_389308_+	FMN-binding protein	NA	NA	NA	NA	NA
WP_084384178.1|389330_390671_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_066533981.1|391191_391554_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_066541580.1|392628_393192_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_088364392.1|393622_394282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066533986.1|394285_394717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084384179.1|394784_395021_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_084384180.1|394944_395529_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_084384182.1|396079_396472_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_066533987.1|396971_398477_-	recombinase family protein	NA	M9Q2G2	Clostridium_phage	27.3	1.3e-46
WP_066533990.1|398563_398752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066533993.1|399374_399794_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_084384183.1|400222_400687_-	PcfB family protein	NA	NA	NA	NA	NA
WP_066533996.1|400731_401448_-	antirestriction protein ArdA	NA	A0A0A8WIV6	Clostridium_phage	34.7	1.6e-18
WP_033118599.1|401449_401797_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066533997.1|402112_403489_-	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_084384184.1|403847_404024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084384185.1|403998_404406_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
404423:404437	attR	CAATTTCTTCTGGAC	NA	NA	NA	NA
>prophage 4
NZ_CP015400	Hungateiclostridiaceae bacterium KB18 chromosome, complete genome	3802844	426317	457958	3802844	tail,transposase,protease	Streptococcus_phage(50.0%)	30	NA	NA
WP_066534030.1|426317_427055_+|tail	phage tail protein	tail	A0A2I4R672	Erysipelothrix_phage	53.7	9.3e-70
WP_084384189.1|427059_429648_+	hypothetical protein	NA	A0A2K5B298	Erysipelothrix_phage	66.5	0.0e+00
WP_157130568.1|429538_430984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084384587.1|431391_435246_+	hypothetical protein	NA	A0A248SL14	Klebsiella_phage	42.0	8.4e-279
WP_066534039.1|435226_435601_+	TnpV protein	NA	A0A1B0RXG6	Streptococcus_phage	86.2	4.6e-57
WP_088364389.1|435827_436418_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_084384190.1|436434_436998_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_084384191.1|437025_437478_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_066534042.1|437534_438452_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_084384192.1|438461_438650_+	conjugal transfer protein	NA	D0R0F6	Streptococcus_phage	68.4	5.1e-17
WP_066534043.1|439140_439656_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_066534046.1|439742_440168_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_066534049.1|440251_440725_+	RNA polymerase	NA	NA	NA	NA	NA
WP_066534051.1|440872_442900_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_084384193.1|442979_443363_+	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_066534055.1|443364_443559_+	S-layer homology domain-containing protein	NA	NA	NA	NA	NA
WP_066534056.1|443555_443903_+	S-layer homology domain-containing protein	NA	NA	NA	NA	NA
WP_088364388.1|443871_444651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066534058.1|444712_445093_+	TnpV protein	NA	A0A1B0RXG6	Streptococcus_phage	50.0	3.1e-29
WP_066534060.1|445223_448541_-	S-layer homology domain-containing protein	NA	NA	NA	NA	NA
WP_088364387.1|448834_449591_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_066534061.1|451840_452161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084384194.1|452589_453816_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_088364386.1|453833_454469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066534064.1|454574_454940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084384190.1|454918_455482_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_084384191.1|455509_455962_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_066534065.1|456042_456288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066541586.1|456297_456522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066534069.1|456779_457958_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP015400	Hungateiclostridiaceae bacterium KB18 chromosome, complete genome	3802844	1057827	1066043	3802844		Streptococcus_phage(16.67%)	10	NA	NA
WP_066535556.1|1057827_1058202_-	PrgI family protein	NA	E4ZFJ8	Streptococcus_phage	40.9	1.5e-15
WP_066535557.1|1058878_1059673_-	site-specific DNA-methyltransferase	NA	W8EBG5	Geobacillus_phage	43.3	1.9e-52
WP_066535558.1|1059662_1060211_-	SpoVG	NA	NA	NA	NA	NA
WP_066535559.1|1060825_1062481_-	DUF4368 domain-containing protein	NA	A0A1L2BY67	Clostridium_phage	21.3	2.2e-18
WP_066535560.1|1062470_1062680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066535563.1|1062706_1063513_-	AAA family ATPase	NA	H7BWC4	unidentified_phage	40.8	1.3e-48
WP_066535566.1|1063509_1064265_-	replication protein	NA	C9WB95	Streptococcus_virus	54.3	1.9e-33
WP_066541653.1|1064378_1064741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066535568.1|1064749_1065091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066535570.1|1065080_1066043_-	hypothetical protein	NA	A0A1B0T6M1	Pelagibaca_phage	35.6	7.2e-14
>prophage 6
NZ_CP015400	Hungateiclostridiaceae bacterium KB18 chromosome, complete genome	3802844	1404262	1413187	3802844		Bacillus_phage(33.33%)	7	NA	NA
WP_066536364.1|1404262_1405570_+	pyrimidine-nucleoside phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	49.9	2.4e-108
WP_066536366.1|1405566_1406091_-	peptidylprolyl isomerase	NA	A0A1V0SCU1	Indivirus	42.6	5.3e-19
WP_066541703.1|1406250_1407018_+	exodeoxyribonuclease III	NA	E3T4M6	Cafeteria_roenbergensis_virus	46.3	5.2e-55
WP_066536369.1|1407010_1407739_+	NAD-dependent protein deacylase	NA	A0A068EPD4	Bacillus_phage	33.5	7.4e-27
WP_066536371.1|1407794_1409564_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	33.1	2.7e-59
WP_066536375.1|1409566_1410937_+	UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase	NA	NA	NA	NA	NA
WP_066536377.1|1410976_1413187_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	36.5	7.6e-75
>prophage 7
NZ_CP015400	Hungateiclostridiaceae bacterium KB18 chromosome, complete genome	3802844	2430161	2494949	3802844	integrase,transposase	Streptococcus_phage(50.0%)	59	2474119:2474164	2496981:2497026
WP_084384190.1|2430161_2430725_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_084384418.1|2431023_2431308_-	MGMT family protein	NA	NA	NA	NA	NA
WP_066538732.1|2431698_2433042_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_157130659.1|2433595_2435260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066538735.1|2435415_2436591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084384419.1|2436909_2437902_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_084384420.1|2438147_2439809_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_066538738.1|2439962_2440907_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_066538739.1|2440928_2441822_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_066538740.1|2441937_2443392_+	sucrose phosphorylase	NA	NA	NA	NA	NA
WP_066538741.1|2443417_2444191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066538743.1|2444217_2445726_+	serine hydrolase	NA	NA	NA	NA	NA
WP_157130660.1|2445722_2446226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066538747.1|2446459_2447317_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_066538749.1|2447344_2448217_-	ROK family protein	NA	NA	NA	NA	NA
WP_066538754.1|2448209_2450057_-	phosphoheptose isomerase	NA	NA	NA	NA	NA
WP_066538760.1|2450140_2451562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066538762.1|2451901_2452867_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_066538763.1|2452883_2453792_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_066538765.1|2453829_2455257_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_066538767.1|2455498_2457601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066538770.1|2457597_2458476_+	aldose 1-epimerase	NA	NA	NA	NA	NA
WP_066538772.1|2458456_2459797_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_066538774.1|2460067_2460394_-	MGMT family protein	NA	NA	NA	NA	NA
WP_066538780.1|2460390_2461782_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_066538782.1|2462479_2463394_+	AEC family transporter	NA	NA	NA	NA	NA
WP_157130661.1|2463921_2466690_+	hypothetical protein	NA	B6SBU8	Clostridium_virus	52.8	2.5e-06
WP_066538785.1|2466701_2467043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066538787.1|2467058_2467793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066538789.1|2467803_2468922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066538790.1|2469007_2470189_+|integrase	site-specific integrase	integrase	A0A0A8WIE1	Clostridium_phage	24.2	1.4e-22
WP_066538792.1|2470225_2470702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066538794.1|2470869_2471472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084384421.1|2471475_2472501_-	RNA-directed DNA polymerase	NA	NA	NA	NA	NA
WP_066538797.1|2472735_2473062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066538799.1|2473054_2473990_-	hypothetical protein	NA	NA	NA	NA	NA
2474119:2474164	attL	TGGCGCGCTTGACTGGATTCGAACCAGCGGCCCTCAGAGTCGGAGT	NA	NA	NA	NA
WP_066538801.1|2474507_2474753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088364400.1|2475065_2475861_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_066538803.1|2475833_2476403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066538805.1|2476882_2477263_-	type II toxin-antitoxin system death-on-curing family toxin	NA	D0R0D2	Streptococcus_phage	51.2	9.7e-31
WP_066538807.1|2477259_2477511_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A1X9I6A0	Streptococcus_phage	45.9	1.5e-11
WP_084384422.1|2477590_2477893_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_084384423.1|2477964_2478543_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_157130662.1|2478541_2478706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066541879.1|2478735_2479023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157130663.1|2479662_2480730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066538811.1|2480836_2483452_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_066538812.1|2483464_2485057_-	site-specific DNA-methyltransferase	NA	Q1MVP0	Enterobacteria_phage	33.3	5.7e-48
WP_066538813.1|2485020_2485887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088364400.1|2485917_2486714_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_066538815.1|2486950_2487271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066538816.1|2487271_2487538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066538823.1|2487626_2488148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066538828.1|2488225_2488972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066538830.1|2489288_2490281_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_088364512.1|2490858_2491092_+	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_084384424.1|2491058_2492447_+	relaxase/mobilization nuclease domain-containing protein	NA	A0A1B0RXG0	Streptococcus_phage	50.0	1.8e-10
WP_066538836.1|2492460_2493618_+|integrase	site-specific integrase	integrase	C5IUL7	Streptococcus_phage	25.7	4.9e-09
WP_066538838.1|2493767_2494949_+|integrase	site-specific integrase	integrase	A0A2R2ZGM9	Clostridioides_phage	27.0	2.3e-22
2496981:2497026	attR	TGGCGCGCTTGACTGGATTCGAACCAGCGGCCCTCAGAGTCGGAGT	NA	NA	NA	NA
>prophage 8
NZ_CP015400	Hungateiclostridiaceae bacterium KB18 chromosome, complete genome	3802844	2581848	2611571	3802844	tail,transposase,holin	Leptospira_phage(18.18%)	38	NA	NA
WP_066533705.1|2581848_2583156_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_066538986.1|2583494_2583755_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_084384436.1|2583741_2584530_-	TraM recognition domain-containing protein	NA	NA	NA	NA	NA
WP_084384437.1|2584578_2585844_-	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_084384438.1|2585726_2585963_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_066538994.1|2585890_2586946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066538995.1|2586933_2587338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066538997.1|2587735_2588131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066538999.1|2588143_2588740_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_066541895.1|2588753_2589740_-	virulence associated protein	NA	A0A1B1IUD7	uncultured_Mediterranean_phage	44.6	4.4e-59
WP_066539001.1|2589769_2590042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084384439.1|2590038_2590911_-	phosphoadenosine phosphosulfate reductase family protein	NA	NA	NA	NA	NA
WP_066539003.1|2590918_2591518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066539005.1|2591480_2592446_-	CHAP domain-containing protein	NA	NA	NA	NA	NA
WP_066539007.1|2592442_2594269_-	DUF87 domain-containing protein	NA	NA	NA	NA	NA
WP_084384440.1|2594284_2595115_-	class B sortase	NA	NA	NA	NA	NA
WP_066539011.1|2595068_2595656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066539013.1|2595660_2595921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084384441.1|2595920_2596301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088364511.1|2596308_2597241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066539017.1|2597305_2597638_-	DUF3852 domain-containing protein	NA	NA	NA	NA	NA
WP_066539019.1|2597723_2598053_-	DUF4406 domain-containing protein	NA	A0A0K8IXN3	Cronobacter_phage	34.1	3.6e-05
WP_157130668.1|2598049_2598502_-	VaFE repeat-containing surface-anchored protein	NA	NA	NA	NA	NA
WP_066539023.1|2598570_2599686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084384163.1|2599983_2600187_-	hypothetical protein	NA	S5VTD3	Leptospira_phage	45.6	3.4e-06
WP_084384442.1|2600217_2600979_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	32.4	2.2e-18
WP_157130669.1|2600872_2601553_-|transposase	transposase	transposase	S5VTD3	Leptospira_phage	31.5	3.3e-13
WP_084384443.1|2601631_2602666_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_066539028.1|2602975_2604388_-	N-acetylmuramoyl-L-alanine amidase	NA	H7BV89	unidentified_phage	55.4	7.3e-140
WP_066539029.1|2604391_2604826_-|holin	phage holin family protein	holin	D2XPZ9	Bacillus_virus	45.5	9.4e-22
WP_066539034.1|2604847_2605285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066539035.1|2605288_2605609_-	hypothetical protein	NA	F8J1D0	Lactobacillus_phage	48.8	3.1e-14
WP_157130670.1|2605720_2606749_-	Reverse transcriptase (RNA-dependent DNA polymerase)	NA	H7BUY3	unidentified_phage	27.0	5.2e-26
WP_066539037.1|2607001_2607556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066539038.1|2607607_2608543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066539040.1|2608559_2609537_-	hypothetical protein	NA	K4HYK7	Streptomyces_phage	37.1	2.6e-11
WP_066539042.1|2609540_2610650_-	hypothetical protein	NA	A0A2K9V3G5	Faecalibacterium_phage	28.3	2.9e-14
WP_066539044.1|2610653_2611571_-|tail	phage tail family protein	tail	NA	NA	NA	NA
>prophage 9
NZ_CP015400	Hungateiclostridiaceae bacterium KB18 chromosome, complete genome	3802844	2619611	2660095	3802844	holin,tRNA,protease,terminase,coat,portal	Brevibacillus_phage(17.39%)	45	NA	NA
WP_066539057.1|2619611_2619908_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_066539059.1|2619912_2620149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066539061.1|2620150_2622049_-	hypothetical protein	NA	A0A1J1J8Z3	Escherichia_phage	34.8	9.5e-50
WP_066539063.1|2622053_2623505_-|portal	phage portal protein	portal	A0A1Z1LZJ4	Bacillus_phage	32.0	2.4e-45
WP_066539065.1|2623501_2624869_-|terminase	PBSX family phage terminase large subunit	terminase	Q9T1C1	Listeria_phage	28.1	1.2e-33
WP_066539067.1|2624834_2625539_-|terminase	terminase	terminase	A0A0A8WJN3	Clostridium_phage	39.4	1.3e-31
WP_084384445.1|2625664_2626414_-	site-specific DNA-methyltransferase	NA	A0A097EWK8	Mycobacterium_phage	47.0	9.5e-54
WP_066539069.1|2626410_2626827_-	DUF1492 domain-containing protein	NA	NA	NA	NA	NA
WP_066539071.1|2626804_2627152_-	DUF4406 domain-containing protein	NA	NA	NA	NA	NA
WP_066539073.1|2627221_2628577_-	DEAD/DEAH box helicase	NA	S5MA26	Brevibacillus_phage	58.8	1.1e-153
WP_066539075.1|2628591_2628891_-	hypothetical protein	NA	A0A2I7QIL0	Bacillus_phage	42.9	1.3e-09
WP_066541900.1|2629181_2631611_-	hypothetical protein	NA	A0A0A7RTG3	Clostridium_phage	46.8	3.5e-198
WP_066539076.1|2631630_2632134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066539077.1|2632197_2632767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066539079.1|2632780_2634754_-	hypothetical protein	NA	S5M5X4	Brevibacillus_phage	52.2	1.9e-186
WP_066539083.1|2634769_2635315_-	DUF2815 family protein	NA	S5MC21	Brevibacillus_phage	64.2	8.7e-57
WP_066539085.1|2635328_2636507_-	DUF2800 domain-containing protein	NA	S5MUB5	Brevibacillus_phage	52.7	4.6e-103
WP_066539087.1|2636496_2636889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084384446.1|2636957_2637653_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_066539090.1|2637737_2637944_-	hypothetical protein	NA	A0A2K9V3Z0	Faecalibacterium_phage	52.9	1.6e-08
WP_066539091.1|2637940_2638783_-	HNH endonuclease	NA	A1EAC5	Streptococcus_phage	34.9	1.4e-29
WP_066539092.1|2638783_2639038_-	hypothetical protein	NA	A0A0P0IDD7	Lactobacillus_phage	50.7	3.7e-10
WP_066539095.1|2639052_2639625_-	hypothetical protein	NA	H7BVY3	unidentified_phage	63.6	3.1e-36
WP_066539097.1|2639779_2640205_+	helix-turn-helix transcriptional regulator	NA	A0A2K9V426	Faecalibacterium_phage	56.1	8.7e-12
WP_066539099.1|2640210_2640645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088364458.1|2641748_2642042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066539106.1|2642475_2643501_-	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_066539108.1|2643525_2644215_-	hypothetical protein	NA	D6QWL5	uncultured_phage	55.4	4.2e-48
WP_066539110.1|2644211_2644661_-|holin	phage holin family protein	holin	D9ZNF2	Clostridium_phage	40.3	1.5e-17
WP_066539112.1|2644676_2646077_-|terminase	PBSX family phage terminase large subunit	terminase	H7BW36	unidentified_phage	49.9	6.2e-115
WP_066539114.1|2646073_2646415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066539115.1|2646404_2646647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157130671.1|2646750_2647551_+	helix-turn-helix domain-containing protein	NA	A0A141E0Q5	Streptococcus_phage	32.6	2.5e-20
WP_066539117.1|2647600_2647795_+|coat	spore coat associated protein CotJA	coat	NA	NA	NA	NA
WP_066539118.1|2647791_2648052_+|coat	spore coat protein CotJB	coat	NA	NA	NA	NA
WP_084384448.1|2648051_2648162_+	manganese catalase	NA	NA	NA	NA	NA
WP_066539120.1|2648343_2649759_+	uracil-xanthine permease	NA	Q9KX94	Enterobacteria_phage	34.6	1.2e-57
WP_066539121.1|2649909_2651316_-	aminopeptidase	NA	NA	NA	NA	NA
WP_066539125.1|2652400_2653402_+	glycosidase	NA	NA	NA	NA	NA
WP_066541902.1|2653990_2654371_+	DUF3795 domain-containing protein	NA	NA	NA	NA	NA
WP_066539127.1|2654534_2655119_+	hydrolase	NA	NA	NA	NA	NA
WP_066539132.1|2655129_2655930_+	NYN domain-containing protein	NA	NA	NA	NA	NA
WP_066539133.1|2655939_2656329_-	glycerol-3-phosphate cytidylyltransferase	NA	A0A1V0SGE7	Hokovirus	41.5	7.4e-18
WP_066539134.1|2656412_2658980_-	DNA polymerase I	NA	F8WQ35	Bacillus_phage	31.9	4.9e-49
WP_066539135.1|2659108_2660095_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
>prophage 10
NZ_CP015400	Hungateiclostridiaceae bacterium KB18 chromosome, complete genome	3802844	3402806	3436296	3802844	integrase,portal,transposase,tRNA	Streptococcus_phage(14.29%)	35	3431424:3431444	3445705:3445725
WP_066540814.1|3402806_3404744_+|tRNA	lysine--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	42.6	6.8e-96
WP_066540816.1|3406837_3407209_+	TnpV protein	NA	A0A1B0RXG6	Streptococcus_phage	53.7	1.6e-33
WP_066540818.1|3407460_3408276_+|integrase	tyrosine-type recombinase/integrase	integrase	H7BUX8	unidentified_phage	39.6	4.3e-52
WP_066540820.1|3408176_3409106_-	chromosome partitioning protein ParB	NA	A0A1B0T6H9	Thiobacimonas_phage	30.2	1.6e-18
WP_066540823.1|3409462_3409924_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_084384525.1|3410226_3410346_-	cyclic lactone autoinducer peptide	NA	NA	NA	NA	NA
WP_066540825.1|3410338_3410929_-	accessory gene regulator B family protein	NA	NA	NA	NA	NA
WP_084384526.1|3411012_3411459_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_066540829.1|3411516_3412356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066540832.1|3412352_3413072_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_066540834.1|3413059_3413581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066540836.1|3413717_3414062_+	helix-turn-helix transcriptional regulator	NA	A0A2H4J245	uncultured_Caudovirales_phage	44.0	8.3e-05
WP_066540838.1|3414471_3414930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066540840.1|3415130_3416207_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_066542029.1|3417167_3417380_+	hypothetical protein	NA	A0A2K9V311	Faecalibacterium_phage	63.0	9.9e-09
WP_066540844.1|3417414_3417792_-	antitoxin HicB	NA	A0A1L2JY34	Aeribacillus_phage	40.5	2.7e-17
WP_066540846.1|3417818_3417995_-	type II toxin-antitoxin system HicA family toxin	NA	F0PIL1	Enterococcus_phage	53.6	1.0e-06
WP_066540850.1|3418075_3419329_+|portal	phage portal protein	portal	A0A2K9V303	Faecalibacterium_phage	60.9	2.1e-138
WP_066540852.1|3419654_3420785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084384527.1|3421063_3422098_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_157130708.1|3422176_3422845_+|transposase	transposase	transposase	S5VTD3	Leptospira_phage	32.6	1.5e-13
WP_088364435.1|3422750_3423512_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	32.4	1.3e-18
WP_084384163.1|3423542_3423746_+	hypothetical protein	NA	S5VTD3	Leptospira_phage	45.6	3.4e-06
WP_084384528.1|3424180_3424444_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_157130709.1|3424526_3424904_-	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_066540859.1|3424916_3427472_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_066540861.1|3427468_3428155_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.5	1.8e-30
WP_066540863.1|3428239_3429193_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_066540865.1|3429189_3429852_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_066540867.1|3430500_3431055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084384529.1|3431051_3431387_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
3431424:3431444	attL	TTTTGATGATTTATTGATGCT	NA	NA	NA	NA
WP_066540871.1|3431795_3434114_-	M56 family metallopeptidase	NA	NA	NA	NA	NA
WP_066540874.1|3434110_3434476_-	BlaI family transcriptional regulator	NA	NA	NA	NA	NA
WP_157130710.1|3434799_3434970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066540875.1|3435078_3436296_+|integrase	site-specific integrase	integrase	A0A1S5S7K9	Streptococcus_phage	22.3	3.6e-10
3445705:3445725	attR	TTTTGATGATTTATTGATGCT	NA	NA	NA	NA
>prophage 11
NZ_CP015400	Hungateiclostridiaceae bacterium KB18 chromosome, complete genome	3802844	3444454	3491644	3802844	integrase,transposase	Streptococcus_phage(43.75%)	52	3436332:3436353	3492174:3492195
3436332:3436353	attL	AATTTTTGATGATTTATTGATG	NA	NA	NA	NA
WP_084384530.1|3444454_3445396_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_066540893.1|3445919_3446513_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_084384531.1|3446518_3447871_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_066540895.1|3447854_3448586_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_066540897.1|3448823_3449285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066540903.1|3449471_3449978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066540913.1|3450777_3451995_+|integrase	site-specific integrase	integrase	I7HHN1	Helicobacter_pylori_bacteriophage	26.8	2.9e-07
WP_066540915.1|3452248_3452476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066540916.1|3452519_3453797_-	C40 family peptidase	NA	A0A1S5SEZ8	Streptococcus_phage	45.7	9.3e-25
WP_066540917.1|3453793_3454930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066540918.1|3454948_3455728_+	toxin MazF	NA	NA	NA	NA	NA
WP_088364504.1|3455849_3456701_+	radical SAM protein	NA	A0A0A7S0B8	Clostridium_phage	53.5	9.7e-79
WP_066540920.1|3456832_3457057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084384532.1|3457053_3457278_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_066542031.1|3457472_3458177_-	M23 family metallopeptidase	NA	A0A140G6T8	Arthrobacter_phage	33.6	4.5e-05
WP_066540921.1|3458280_3458913_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_066540922.1|3459416_3459731_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_084384533.1|3460203_3460899_-	hypothetical protein	NA	E4ZFN9	Streptococcus_phage	31.4	1.6e-15
WP_066540923.1|3460898_3462524_-	recombinase	NA	Q6DMS6	Streptococcus_phage	22.3	5.0e-15
WP_066540924.1|3462639_3462906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088364433.1|3462916_3463729_-	hypothetical protein	NA	Q4ZDB0	Staphylococcus_virus	26.0	4.1e-10
WP_066540929.1|3463718_3464660_-	chromosome partitioning protein ParB	NA	A0A1B0T6H9	Thiobacimonas_phage	32.0	1.4e-14
WP_066540823.1|3465015_3465477_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_084384525.1|3465779_3465899_-	cyclic lactone autoinducer peptide	NA	NA	NA	NA	NA
WP_066540932.1|3465891_3466482_-	accessory gene regulator B family protein	NA	NA	NA	NA	NA
WP_066540934.1|3466580_3467909_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_066540936.1|3467909_3468626_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_084384534.1|3469766_3470204_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084384535.1|3470175_3471507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066540945.1|3471560_3472703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084384536.1|3472798_3473329_-	M23 family metallopeptidase	NA	A0A2D0ZM66	Rhodococcus_phage	37.9	1.6e-15
WP_066540950.1|3473234_3473579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066540952.1|3473585_3473777_-	hypothetical protein	NA	D0R0F6	Streptococcus_phage	56.0	8.1e-10
WP_066540954.1|3473986_3475333_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	25.8	6.8e-18
WP_066540956.1|3475316_3475985_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.4	9.4e-37
WP_066540958.1|3476216_3477551_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_066540959.1|3477562_3478855_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_084384537.1|3478957_3479515_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	34.9	1.4e-17
WP_066540963.1|3481047_3481926_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_066540964.1|3482042_3482711_+	DUF4366 domain-containing protein	NA	NA	NA	NA	NA
WP_084384538.1|3482885_3483239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084384637.1|3483414_3484347_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066540967.1|3484535_3484892_-	helix-turn-helix transcriptional regulator	NA	A0A1S5SFA6	Streptococcus_phage	41.0	4.4e-17
WP_066540973.1|3484989_3485541_-	TetR/AcrR family transcriptional regulator	NA	A0A1X9I6A2	Streptococcus_phage	43.8	2.4e-06
WP_066540975.1|3485672_3486332_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_066540977.1|3486842_3487265_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_016316805.1|3487690_3487957_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066540979.1|3488073_3489750_+	recombinase	NA	E4ZFN9	Streptococcus_phage	27.1	1.3e-23
WP_084384539.1|3489803_3490334_+	TRIC cation channel family protein	NA	NA	NA	NA	NA
WP_066540980.1|3490983_3491175_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_084384540.1|3491199_3491499_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_084384541.1|3491464_3491644_+|transposase	transposase	transposase	NA	NA	NA	NA
3492174:3492195	attR	AATTTTTGATGATTTATTGATG	NA	NA	NA	NA
>prophage 12
NZ_CP015400	Hungateiclostridiaceae bacterium KB18 chromosome, complete genome	3802844	3511648	3557700	3802844	integrase,transposase,protease	Streptococcus_phage(37.5%)	40	3516602:3516625	3558040:3558063
WP_066541011.1|3511648_3512236_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	C4ML05	Xanthomonas_virus	33.3	9.5e-17
WP_066541014.1|3512249_3512873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088364430.1|3513258_3514077_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_066541021.1|3514142_3514616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066541023.1|3514633_3515191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157130712.1|3515426_3516566_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1S5S7K9	Streptococcus_phage	22.2	4.4e-10
3516602:3516625	attL	ATTTTGATGATTTATTGATGATGT	NA	NA	NA	NA
WP_066541029.1|3517179_3518310_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_066541031.1|3518402_3519335_-	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_066541033.1|3519428_3520664_-	MFS transporter	NA	NA	NA	NA	NA
WP_088364503.1|3521007_3521877_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_066542033.1|3521902_3522787_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_066541036.1|3522786_3523617_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_066541038.1|3523699_3525259_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_066541041.1|3525305_3526412_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_088364429.1|3526483_3527347_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_157130713.1|3527626_3527812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084384545.1|3527790_3528060_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_066541047.1|3528052_3528415_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_066542035.1|3528893_3530402_-	recombinase family protein	NA	A0A1L2BY67	Clostridium_phage	30.7	7.3e-61
WP_066541049.1|3530677_3531109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066541051.1|3531105_3531630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066541052.1|3531915_3534306_-	helix-turn-helix domain-containing protein	NA	A0A1B0RXB2	Streptococcus_phage	29.7	2.4e-34
WP_066541053.1|3534434_3535271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066541055.1|3535572_3537540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066541056.1|3537551_3538016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066541057.1|3538090_3538513_-	single-stranded DNA-binding protein	NA	A0A2K9V463	Faecalibacterium_phage	43.1	5.6e-19
WP_066541058.1|3539172_3540552_-	S-layer homology domain-containing protein	NA	NA	NA	NA	NA
WP_066541060.1|3541207_3543145_-	hypothetical protein	NA	Q9G0E3	Lactococcus_phage	29.9	5.7e-50
WP_066541062.1|3544669_3547099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066541000.1|3547064_3549188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066542032.1|3549165_3550089_-	DUF3991 domain-containing protein	NA	NA	NA	NA	NA
WP_066541063.1|3550085_3551072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066541064.1|3551090_3551519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084384544.1|3551515_3552865_-	TraM recognition domain-containing protein	NA	NA	NA	NA	NA
WP_066541011.1|3552770_3553358_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	C4ML05	Xanthomonas_virus	33.3	9.5e-17
WP_066541065.1|3553371_3553995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088364426.1|3554380_3555211_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_066541071.1|3555276_3555750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066541072.1|3555767_3556325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084384546.1|3556323_3557700_+|integrase	site-specific integrase	integrase	A0A1S5S7K9	Streptococcus_phage	23.0	4.1e-10
3558040:3558063	attR	ATTTTGATGATTTATTGATGATGT	NA	NA	NA	NA
>prophage 13
NZ_CP015400	Hungateiclostridiaceae bacterium KB18 chromosome, complete genome	3802844	3659379	3706931	3802844	integrase,transposase,protease	Tupanvirus(20.0%)	49	3663312:3663356	3699639:3699683
WP_089413688.1|3659379_3659640_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_084384557.1|3659821_3660238_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_157130719.1|3660642_3660810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066541268.1|3660809_3660992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084384558.1|3661160_3661766_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_066541272.1|3661758_3663153_+|integrase	site-specific integrase	integrase	A0A2H4JCB7	uncultured_Caudovirales_phage	33.9	7.5e-28
3663312:3663356	attL	TGGTTGCGGGGGCAGGATTTGAACCTGCGGCCTTCGGGTTATGAG	NA	NA	NA	NA
WP_066541274.1|3663487_3663787_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_066541278.1|3664284_3664626_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_066541280.1|3664787_3665936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066541281.1|3665932_3666709_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066541283.1|3666701_3667565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066541285.1|3667575_3668232_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	34.8	2.6e-31
WP_066541287.1|3668269_3669241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066541288.1|3669402_3669615_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_066541289.1|3669611_3669974_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_066541291.1|3670909_3671122_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_084384639.1|3671130_3671481_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_066541295.1|3671801_3672209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066538197.1|3673813_3674335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088364421.1|3674489_3674687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066538200.1|3674683_3676657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088364420.1|3676653_3677820_-	DNA cytosine methyltransferase	NA	R4TMW4	Halovirus	29.9	1.1e-27
WP_157130720.1|3678273_3678429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084384560.1|3678793_3679168_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_066541299.1|3679121_3679424_-	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_088364387.1|3679477_3680234_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_157130721.1|3681102_3683268_+	helix-turn-helix domain-containing protein	NA	A0A291LAM3	Bordetella_phage	37.8	3.0e-07
WP_066541305.1|3683320_3685282_-	DUF4965 domain-containing protein	NA	NA	NA	NA	NA
WP_066541307.1|3685337_3686801_-	sulfatase-like hydrolase/transferase	NA	A0A2K9L727	Tupanvirus	25.9	6.0e-20
WP_066541310.1|3686891_3688583_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_066541311.1|3688605_3689520_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_066541312.1|3689535_3690441_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_066542043.1|3690834_3692289_+	sulfatase	NA	A0A2K9L1A5	Tupanvirus	24.0	6.9e-16
WP_066541314.1|3692276_3693404_+	anaerobic sulfatase maturase	NA	NA	NA	NA	NA
WP_084384641.1|3693415_3694192_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_066541318.1|3694466_3695435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088364418.1|3695598_3695811_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_066541322.1|3695807_3696170_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_088364417.1|3696492_3696900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066541326.1|3696902_3698252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066541327.1|3698381_3699530_+|integrase	site-specific integrase	integrase	A0A1B0T6A8	Bacillus_phage	30.9	1.6e-36
WP_066541328.1|3699903_3700146_+	hypothetical protein	NA	NA	NA	NA	NA
3699639:3699683	attR	TGGTTGCGGGGGCAGGATTTGAACCTGCGGCCTTCGGGTTATGAG	NA	NA	NA	NA
WP_066541329.1|3700138_3700411_+	type II toxin-antitoxin system YafQ family toxin	NA	NA	NA	NA	NA
WP_084384642.1|3700481_3702101_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.1	9.0e-33
WP_066541335.1|3702120_3703011_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_066541337.1|3703175_3703505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084384562.1|3703797_3706020_-	DUF4368 domain-containing protein	NA	A0A0P0IX98	Lactobacillus_phage	32.3	8.2e-61
WP_084384563.1|3706036_3706171_-	conjugal transfer protein	NA	D0R0F6	Streptococcus_phage	73.2	7.9e-12
WP_066541343.1|3706172_3706931_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 14
NZ_CP015400	Hungateiclostridiaceae bacterium KB18 chromosome, complete genome	3802844	3762239	3773941	3802844		Bacillus_phage(50.0%)	11	NA	NA
WP_066541442.1|3762239_3764093_-	asparagine synthase (glutamine-hydrolyzing)	NA	F2Y1H0	Organic_Lake_phycodnavirus	24.0	6.4e-27
WP_066541444.1|3764186_3764735_-	DUF1836 domain-containing protein	NA	NA	NA	NA	NA
WP_084384575.1|3764746_3765598_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_066541447.1|3765601_3765937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066541448.1|3765949_3766156_+	helix-turn-helix transcriptional regulator	NA	A0A1V0E021	Clostridioides_phage	80.9	1.5e-22
WP_066541449.1|3766251_3766761_+	helix-turn-helix transcriptional regulator	NA	A0A139ZPI6	Marinitoga_camini_virus	41.9	8.5e-06
WP_066541450.1|3766900_3769282_+	AAA family ATPase	NA	A7KV33	Bacillus_phage	36.0	1.6e-115
WP_066541453.1|3769292_3769976_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_066541454.1|3769994_3770453_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_066541459.1|3770474_3772196_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.7	4.6e-43
WP_066541463.1|3772192_3773941_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.4	2.5e-52
