The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP015408	Lactobacillus reuteri strain I49 chromosome, complete genome	2044771	485714	493779	2044771	tRNA	Staphylococcus_phage(33.33%)	8	NA	NA
WP_003666054.1|485714_485990_+	HU family DNA-binding protein	NA	A0A0H3UZA0	Geobacillus_virus	68.5	2.6e-25
WP_065532857.1|486125_487391_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_065532858.1|487516_488728_+|tRNA	CCA tRNA nucleotidyltransferase	tRNA	G3MAR3	Bacillus_virus	39.3	1.4e-35
WP_065532859.1|488729_490640_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	30.4	1.4e-56
WP_065532860.1|490658_491621_+	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	60.9	2.1e-114
WP_065532861.1|491636_492125_+	dihydrofolate reductase	NA	A0A1B2IBQ4	Erwinia_phage	40.8	3.3e-23
WP_003666062.1|492113_492758_-	hemolysin III family protein	NA	NA	NA	NA	NA
WP_019251613.1|492936_493779_+	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	34.1	8.0e-17
>prophage 2
NZ_CP015408	Lactobacillus reuteri strain I49 chromosome, complete genome	2044771	948036	1008220	2044771	transposase,integrase,protease,tRNA	Enterococcus_phage(31.25%)	57	957769:957790	1009275:1009296
WP_065533136.1|948036_949725_-|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	32.4	1.0e-71
WP_065533137.1|950086_950902_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_065533138.1|950914_951853_+	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_065533139.1|952039_952312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003670821.1|952453_952789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065533140.1|952754_953918_-	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	24.6	2.3e-06
WP_065533141.1|953919_954507_-	non-canonical purine NTP pyrophosphatase	NA	NA	NA	NA	NA
WP_065533142.1|954496_955756_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_065533143.1|955742_956321_-	GTP cyclohydrolase I FolE	NA	A0A2I7S8W4	Vibrio_phage	41.8	2.9e-34
WP_065533144.1|956302_956815_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_084405193.1|956817_957177_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_065533146.1|957240_957636_-	ASCH domain-containing protein	NA	NA	NA	NA	NA
957769:957790	attL	GCGCGTCTGCCAATTCCGCCAC	NA	NA	NA	NA
WP_003664194.1|957878_958157_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_065533147.1|958500_959178_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003670806.1|959161_959407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065533148.1|959533_960457_-	ribokinase	NA	NA	NA	NA	NA
WP_065533149.1|960513_961530_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_019251768.1|961611_962220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003664204.1|962435_963068_+	deoxynucleoside kinase	NA	C1KFI3	Lactobacillus_virus	46.4	2.1e-46
WP_065533150.1|963102_964152_-	glucosaminidase domain-containing protein	NA	A0A249Y0X5	Enterococcus_phage	32.2	9.0e-10
WP_003668541.1|964240_964753_-	universal stress protein	NA	NA	NA	NA	NA
WP_065533151.1|964778_966182_-	dipeptidase PepV	NA	NA	NA	NA	NA
WP_065533152.1|966270_967131_+	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_065533153.1|967194_968844_-	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_065533154.1|968958_969222_-	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_065533155.1|969286_971707_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	68.6	0.0e+00
WP_065533156.1|972028_973216_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	67.7	4.7e-148
WP_065533157.1|973376_973916_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_065533158.1|973996_975436_-	MFS transporter	NA	NA	NA	NA	NA
WP_029507527.1|975559_976015_+	transcriptional repressor	NA	NA	NA	NA	NA
WP_065533159.1|976046_977393_-	amino acid permease	NA	NA	NA	NA	NA
WP_065533160.1|977483_978095_+	VanZ family protein	NA	NA	NA	NA	NA
WP_003664220.1|978106_978274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019253874.1|978567_979092_+	DUF308 domain-containing protein	NA	NA	NA	NA	NA
WP_065533161.1|979115_979559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084405229.1|979558_981043_-	LytTR family transcriptional regulator	NA	Q6DMX4	Streptococcus_phage	28.0	1.2e-36
WP_065533163.1|981179_981611_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_065533164.1|981743_982592_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_003664227.1|982836_984135_-	NAD-dependent dihydropyrimidine dehydrogenase subunit PreA	NA	NA	NA	NA	NA
WP_065533165.1|984127_985369_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_065533166.1|985664_986426_+	exodeoxyribonuclease III	NA	E3T4M6	Cafeteria_roenbergensis_virus	41.2	2.5e-49
WP_065533167.1|986551_987520_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_003664230.1|989536_990244_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A096XT26	Enterococcus_phage	45.8	5.5e-27
WP_065533168.1|990573_992274_-	phosphoenolpyruvate carboxykinase	NA	NA	NA	NA	NA
WP_003664232.1|992428_993238_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A0E3XCL7	Enterococcus_phage	68.4	5.5e-23
WP_065533169.1|993622_994516_-	SufD family Fe-S cluster assembly protein	NA	NA	NA	NA	NA
WP_065533170.1|994524_995103_-	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A0C5K925	Enterococcus_phage	59.7	3.6e-53
WP_065533171.1|995168_997403_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0C5KKX3	Enterococcus_phage	59.4	2.3e-249
WP_084405194.1|997808_999215_+	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_101495432.1|1000654_1001083_+|integrase	tyrosine-type recombinase/integrase	integrase	D2XR58	Bacillus_phage	38.8	8.4e-15
WP_003664241.1|1001193_1001682_-	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_003664242.1|1001718_1001862_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_035152987.1|1002290_1003289_+	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_003664245.1|1003293_1003632_+	metal-sulfur cluster assembly factor	NA	NA	NA	NA	NA
WP_065533173.1|1003730_1005107_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	34.4	1.0e-37
WP_065532961.1|1005252_1006221_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_065532760.1|1006675_1008220_-|transposase	IS66 family transposase	transposase	S5VLC8	Leptospira_phage	24.8	6.6e-17
1009275:1009296	attR	GCGCGTCTGCCAATTCCGCCAC	NA	NA	NA	NA
