The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP015406	Flavonifractor plautii strain YL31 chromosome, complete genome	3818478	785519	811896	3818478	capsid,integrase,tail,head,terminase,portal	unidentified_phage(23.08%)	43	780776:780799	810374:810397
780776:780799	attL	GCAGGGCCTCGCCCTCCTTCAGCT	NA	NA	NA	NA
WP_065534068.1|785519_786548_-|integrase	site-specific integrase	integrase	H7BVF7	unidentified_phage	28.7	2.1e-27
WP_065534069.1|786560_786812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084461895.1|786929_787172_-	helix-turn-helix domain-containing protein	NA	A0A0A0YV45	Streptococcus_phage	42.9	5.3e-06
WP_080568005.1|787229_787457_-	helix-turn-helix transcriptional regulator	NA	S5MA03	Brevibacillus_phage	42.3	6.5e-06
WP_065534070.1|787855_788551_-	NYN domain-containing protein	NA	A4JWQ6	Burkholderia_virus	43.6	1.6e-42
WP_065534071.1|788796_789057_-	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_065534072.1|789049_789307_-	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_065534073.1|789475_790114_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_157781239.1|790442_790757_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_050001803.1|790973_791294_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_065534075.1|791469_791790_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_065534076.1|792083_792590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089413487.1|792937_793138_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_065534078.1|793231_793624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065534079.1|793750_793954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084461897.1|793958_794462_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_065534081.1|794458_794800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065534082.1|794796_795057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021631304.1|795050_795305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021631303.1|795366_796155_+	helix-turn-helix domain-containing protein	NA	A0A075KJL8	Lactobacillus_phage	53.5	8.5e-21
WP_065534083.1|796141_797539_+	AAA family ATPase	NA	Q9MC54	Pseudomonas_phage	32.7	1.5e-47
WP_009261056.1|797659_797845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065534084.1|797863_798634_+	ParA family protein	NA	H7BUL8	unidentified_phage	33.7	1.8e-31
WP_065534085.1|798633_800184_+	ParB N-terminal domain-containing protein	NA	H7BUL7	unidentified_phage	28.8	2.2e-12
WP_007488437.1|800170_800593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065534086.1|800585_800789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065534087.1|800813_801038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065534088.1|801034_801262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065534090.1|801490_801790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089413488.1|802228_802453_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_065534092.1|802704_803052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065534093.1|803163_803616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065534094.1|803799_804006_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065534095.1|804005_804773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084461899.1|804811_805012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065534096.1|805081_805450_+	HNH endonuclease	NA	A0A218MNA6	uncultured_virus	43.6	1.1e-15
WP_065534097.1|805742_806252_+|terminase	phage terminase small subunit P27 family	terminase	Q9ZXG2	Bacillus_phage	33.8	1.2e-15
WP_065534098.1|806248_808066_+|terminase	terminase	terminase	A0A2I7SBY8	Paenibacillus_phage	43.2	1.2e-118
WP_065534099.1|808090_808270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065534100.1|808266_809622_+|portal	phage portal protein	portal	A0A2K5B287	Erysipelothrix_phage	33.2	1.3e-48
WP_065534101.1|809638_810331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065534102.1|810327_811554_+|capsid	phage major capsid protein	capsid	Q9ZXF6	Bacillus_phage	28.6	6.3e-39
810374:810397	attR	AGCTGAAGGAGGGCGAGGCCCTGC	NA	NA	NA	NA
WP_065534103.1|811557_811896_+|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
>prophage 2
NZ_CP015406	Flavonifractor plautii strain YL31 chromosome, complete genome	3818478	972612	1045359	3818478	holin,transposase,capsid,protease,head,portal,tail,plate,terminase,integrase	Paenibacillus_phage(28.57%)	82	986144:986157	1011196:1011209
WP_157781240.1|972612_974097_+|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	45.5	3.0e-107
WP_084461912.1|974396_975590_-	S8/S53 family peptidase	NA	NA	NA	NA	NA
WP_065534196.1|976302_978348_-	serine hydrolase	NA	G1BRK9	Mycobacterium_phage	30.3	7.1e-11
WP_065534197.1|978472_979180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065534198.1|979233_980523_-	recombinase family protein	NA	A0A1L2BY67	Clostridium_phage	39.3	4.0e-68
WP_065534199.1|980658_981027_+	BlaI/MecI/CopY family transcriptional regulator	NA	NA	NA	NA	NA
WP_065534200.1|981019_983941_+	peptidase M56	NA	NA	NA	NA	NA
WP_065534201.1|983997_984246_-	TIGR03905 family TSCPD domain-containing protein	NA	NA	NA	NA	NA
WP_007492539.1|984346_984934_+	TetR/AcrR family transcriptional regulator C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_009260263.1|985019_986303_+	cation:proton antiporter	NA	NA	NA	NA	NA
986144:986157	attL	CCTGCTCAAGCTGG	NA	NA	NA	NA
WP_084461914.1|986307_987930_-	ferrous iron transporter B	NA	NA	NA	NA	NA
WP_065534202.1|987920_988163_-	ferrous iron transport protein A	NA	NA	NA	NA	NA
WP_007492546.1|988268_988706_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_065534203.1|988692_989343_+	C40 family peptidase	NA	NA	NA	NA	NA
WP_065534204.1|989453_990812_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_157781241.1|991096_991234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084461915.1|991612_992020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065534206.1|992066_995705_-	S-layer homology domain-containing protein	NA	NA	NA	NA	NA
WP_065534207.1|996008_996296_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_065534208.1|996285_997536_+|terminase	PBSX family phage terminase large subunit	terminase	E5DV50	Deep-sea_thermophilic_phage	47.4	1.7e-108
WP_065534209.1|997572_998733_+	serine/threonine protein phosphatase	NA	NA	NA	NA	NA
WP_065534210.1|999751_1000612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065534211.1|1000656_1001007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065534212.1|1001026_1002061_+|capsid	phage major capsid protein	capsid	NA	NA	NA	NA
WP_065534213.1|1002057_1002408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065534214.1|1002404_1002752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065534215.1|1002764_1003253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065534216.1|1003249_1004284_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	NA	NA	NA	NA
WP_007492097.1|1004303_1004693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009258872.1|1004694_1005105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065534217.1|1005101_1005311_+	molybdopterin oxidoreductase	NA	NA	NA	NA	NA
WP_065534218.1|1005307_1005868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044941481.1|1005879_1006437_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_065534219.1|1006436_1007375_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065534220.1|1007390_1007759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065534221.1|1007770_1008106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084462085.1|1008296_1009172_+|plate	baseplate J/gp47 family protein	plate	B5TK75	Pseudomonas_phage	30.2	5.0e-14
WP_009258863.1|1009168_1009738_+	DUF2313 domain-containing protein	NA	NA	NA	NA	NA
WP_065534222.1|1009867_1011040_-|integrase	site-specific integrase	integrase	A0A2R2ZGM9	Clostridioides_phage	30.0	1.9e-37
WP_065534223.1|1011145_1011403_-	hypothetical protein	NA	NA	NA	NA	NA
1011196:1011209	attR	CCAGCTTGAGCAGG	NA	NA	NA	NA
WP_065534224.1|1011442_1011961_-	hypothetical protein	NA	A0A0K2CP90	Brevibacillus_phage	37.7	7.3e-05
WP_065534225.1|1012076_1012505_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_065534226.1|1012511_1012874_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_065534227.1|1013073_1013307_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_065535737.1|1013337_1014219_+	Rha family transcriptional regulator	NA	A0A2H4J8K8	uncultured_Caudovirales_phage	42.0	7.7e-47
WP_065534228.1|1014218_1014398_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_065534229.1|1014394_1014646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065534230.1|1014642_1015164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065534231.1|1015175_1015484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065534232.1|1015480_1015756_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065534233.1|1015752_1017033_+	AAA family ATPase	NA	A0A0K2CZN2	Paenibacillus_phage	69.7	2.8e-114
WP_065534234.1|1017033_1018110_+	ATP-binding protein	NA	A0A0K2CZH1	Paenibacillus_phage	50.8	3.3e-100
WP_055178833.1|1018182_1018704_+	hypothetical protein	NA	A0A2I7SC41	Paenibacillus_phage	42.9	7.3e-29
WP_065534235.1|1018703_1020299_+	DEAD/DEAH box helicase	NA	A0A0K2CZF8	Paenibacillus_phage	71.4	2.1e-223
WP_065534236.1|1020300_1022589_+	AAA family ATPase	NA	A0A2I7SC35	Paenibacillus_phage	56.9	2.0e-256
WP_084461917.1|1022836_1023292_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A2I7SC39	Paenibacillus_phage	60.3	2.8e-40
WP_065534237.1|1023275_1023650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065534238.1|1023646_1023871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065534239.1|1023870_1024086_+	helix-turn-helix transcriptional regulator	NA	D2XQ11	Bacillus_virus	44.6	2.3e-05
WP_157781242.1|1025154_1025592_+|terminase	P27 family phage terminase small subunit	terminase	NA	NA	NA	NA
WP_065534242.1|1025584_1027258_+|terminase	terminase	terminase	A0A2P1CCE7	Lactobacillus_phage	49.1	9.0e-145
WP_084461918.1|1027287_1028511_+|portal	phage portal protein	portal	A0A075KK59	Lactobacillus_phage	41.7	3.0e-81
WP_065534244.1|1028500_1029130_+|head,protease	HK97 family phage prohead protease	head,protease	A0A1C8EA63	Bacillus_phage	51.5	1.5e-39
WP_065534245.1|1029132_1030296_+|capsid	phage major capsid protein	capsid	F7V9A6	Lactobacillus_virus	45.6	6.1e-84
WP_044940002.1|1030311_1030491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084461919.1|1030502_1030853_+|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_065534246.1|1030857_1031232_+|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
WP_065534247.1|1031228_1031594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065534248.1|1031574_1031997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065534249.1|1032008_1032587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065534250.1|1032588_1032978_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065534251.1|1033111_1037497_+|tail	phage tail tape measure protein	tail	A3F654	Streptococcus_phage	41.6	1.2e-58
WP_065534252.1|1037493_1037871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065534253.1|1037863_1040011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157781243.1|1040013_1040175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065534254.1|1040178_1041378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157781244.1|1041380_1042394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089413489.1|1042393_1042747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065534257.1|1042752_1042950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065534258.1|1042987_1043389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065534259.1|1043381_1044878_+	N-acetylmuramoyl-L-alanine amidase	NA	Q9ZXD7	Bacillus_phage	42.2	7.5e-34
WP_065534260.1|1044879_1045359_+|holin	phage holin family protein	holin	NA	NA	NA	NA
>prophage 3
NZ_CP015406	Flavonifractor plautii strain YL31 chromosome, complete genome	3818478	2993524	3009895	3818478	transposase,terminase,portal	Clostridium_phage(38.46%)	25	NA	NA
WP_065535268.1|2993524_2995453_-	hypothetical protein	NA	A0A2P1CG17	Microbacterium_phage	62.4	3.9e-75
WP_065535269.1|2995648_2995873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065535270.1|2995914_2996283_-	hypothetical protein	NA	B6CXF0	Clostridium_phage	35.7	7.5e-12
WP_065535271.1|2996287_2996860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065535272.1|2996873_2997242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065535273.1|2997238_2997595_-	hypothetical protein	NA	A0A1J1J9Q7	Escherichia_phage	40.8	2.0e-14
WP_084462020.1|2997591_2997942_-	hypothetical protein	NA	F8UBC2	Clostridium_phage	42.5	8.7e-18
WP_065535274.1|2997938_2998361_-	hypothetical protein	NA	F8UBC1	Clostridium_phage	35.6	1.4e-17
WP_084462021.1|2998376_2998775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065535276.1|2998774_2999704_-	hypothetical protein	NA	A0A097PAT5	Streptococcus_pyogenes_phage	34.8	6.5e-12
WP_065535277.1|2999718_3000345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167624384.1|3000691_3001165_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_065535278.1|3001122_3001332_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_084462022.1|3002101_3002515_-	HK97 gp10 family phage protein	NA	A0A1S5S8X0	Streptococcus_phage	39.2	5.1e-17
WP_065535279.1|3002530_3002740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065535280.1|3002736_3004038_-	hypothetical protein	NA	B6CXD5	Clostridium_phage	36.9	5.2e-39
WP_065535281.1|3004024_3005422_-|portal	phage portal protein	portal	F8UBA8	Clostridium_phage	33.7	4.1e-58
WP_084462023.1|3005426_3006623_-|terminase	PBSX family phage terminase large subunit	terminase	A0A2K9V3G6	Faecalibacterium_phage	56.6	1.0e-126
WP_065535283.1|3006609_3007059_-|transposase	transposase	transposase	A5GYP7	Lactococcus_phage	61.1	2.2e-37
WP_084462024.1|3007346_3007985_-	Bro-N domain-containing protein	NA	A0A2R2ZGJ9	Clostridioides_phage	60.0	2.4e-42
WP_065535284.1|3008564_3008780_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_065535285.1|3008783_3008996_-	DUF551 domain-containing protein	NA	NA	NA	NA	NA
WP_065535286.1|3008988_3009216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065535287.1|3009212_3009452_-	Lar family restriction alleviation protein	NA	NA	NA	NA	NA
WP_065535288.1|3009448_3009895_-	hypothetical protein	NA	A8ASP1	Listeria_phage	31.4	2.0e-11
>prophage 4
NZ_CP015406	Flavonifractor plautii strain YL31 chromosome, complete genome	3818478	3013786	3018194	3818478		Paracoccus_phage(14.29%)	8	NA	NA
WP_065535297.1|3013786_3014134_-	DUF1064 domain-containing protein	NA	A0A0U2C0S3	Paracoccus_phage	42.5	7.1e-12
WP_157781258.1|3014126_3014276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065535298.1|3014262_3015531_-	AAA family ATPase	NA	A0A0U4B0G9	Pseudomonas_phage	32.7	1.7e-26
WP_142988505.1|3015475_3016141_-	hypothetical protein	NA	A0A0F7L7L4	uncultured_marine_virus	47.8	4.7e-12
WP_065535299.1|3016153_3016573_-	single-stranded DNA-binding protein	NA	A0A1J0MFD7	Staphylococcus_phage	41.5	3.5e-21
WP_065535300.1|3016861_3017203_-	hypothetical protein	NA	I1TJY2	Clostridium_phage	31.1	3.3e-06
WP_065535301.1|3017187_3017706_-	hypothetical protein	NA	A0A0E3Y6D2	Fusobacterium_phage	46.8	2.5e-29
WP_065535302.1|3017705_3018194_-	siphovirus Gp157 family protein	NA	E5DV79	Deep-sea_thermophilic_phage	30.7	1.1e-10
