The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP016335	Corynebacterium glutamicum strain ATCC 13869 chromosome, complete genome	3296500	447985	485595	3296500	transposase	Catovirus(20.0%)	22	NA	NA
WP_065366598.1|447985_449251_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	97.6	7.8e-234
WP_060563801.1|450554_453206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157676166.1|453251_454112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065532534.1|454149_455526_+	glycosyltransferase family 25 protein	NA	NA	NA	NA	NA
WP_060563805.1|455744_456629_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_077311031.1|456756_457479_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_060563812.1|459422_459845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089158484.1|460232_464762_-	glycosyltransferase	NA	A0A1V0SAE6	Catovirus	31.6	2.3e-33
WP_060563814.1|465092_466346_-	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HFY9	Paramecium_bursaria_Chlorella_virus	25.0	8.8e-20
WP_060563821.1|469662_471615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060563823.1|471897_472806_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_060563825.1|473084_474272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065532535.1|474306_477534_+	glycosyltransferase	NA	A0A1V0SAE6	Catovirus	28.3	8.9e-32
WP_060563829.1|477792_477990_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_060563542.1|478124_479435_-|transposase	ISL3-like element IS13869 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	44.2	2.5e-86
WP_060563833.1|479971_480283_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081299820.1|480279_480879_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	28.6	4.5e-14
WP_152024168.1|480856_482058_-|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	30.5	1.2e-26
WP_075348078.1|482116_482296_-|transposase	transposase	transposase	A0A1B3AZF8	Gordonia_phage	49.1	2.4e-08
WP_065366609.1|482435_482915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060563843.1|483085_484525_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.2	1.1e-45
WP_060563845.1|484671_485595_+	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	39.7	2.6e-45
>prophage 2
NZ_CP016335	Corynebacterium glutamicum strain ATCC 13869 chromosome, complete genome	3296500	1481984	1546181	3296500	protease,integrase,transposase	Liberibacter_phage(10.0%)	57	1535092:1535143	1548719:1548770
WP_081302979.1|1481984_1483403_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_060564449.1|1485340_1486576_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_065366844.1|1486572_1489659_+	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	29.3	1.8e-58
WP_081299843.1|1489642_1490389_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_060564451.1|1490430_1492062_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_060564452.1|1492058_1493156_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_060564454.1|1494050_1495016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060564455.1|1495016_1495298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107111914.1|1496166_1497006_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	34.5	1.5e-07
WP_060564456.1|1497086_1498010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065366846.1|1498143_1499556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060564458.1|1499650_1500877_+	leucine-rich repeat protein	NA	NA	NA	NA	NA
WP_157676144.1|1501542_1501737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060564459.1|1501907_1503062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011014272.1|1503058_1503385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065366847.1|1503381_1505145_-	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_107111918.1|1505483_1505774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060565493.1|1506313_1506643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034983522.1|1506921_1508232_+|transposase	ISL3-like element IS31831 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	42.2	1.0e-82
WP_065366848.1|1508317_1510705_-	glycogen/starch/alpha-glucan phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	47.7	6.4e-19
WP_065366849.1|1511116_1512526_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_060564462.1|1512633_1513386_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_060564463.1|1513435_1513915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060564464.1|1513975_1514542_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	36.8	1.6e-08
WP_003861499.1|1514524_1515232_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_060564465.1|1515485_1516931_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_060564466.1|1516949_1517543_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_065532559.1|1517889_1518900_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_003858849.1|1519177_1520176_+	NAD(P)-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_060564468.1|1520200_1521283_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_060564469.1|1521339_1522320_-	DUF3515 domain-containing protein	NA	NA	NA	NA	NA
WP_060564470.1|1522387_1523377_+	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_060564471.1|1523376_1524126_+	uracil-DNA glycosylase	NA	S4VZ65	Pandoravirus	35.7	1.2e-29
WP_060564472.1|1524137_1525841_+	DAK2 domain-containing protein	NA	NA	NA	NA	NA
WP_065366851.1|1525845_1527969_+	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_003858832.1|1527988_1528204_+	acetyl-CoA carboxylase biotin carboxyl carrier protein subunit	NA	NA	NA	NA	NA
WP_003858829.1|1528203_1528788_+	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_060564475.1|1528791_1529274_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	30.8	1.9e-15
WP_065532560.1|1529845_1530610_-	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.9	1.6e-19
WP_060564477.1|1530613_1531564_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003858822.1|1531606_1532611_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_060564478.1|1532710_1533520_+	DUF1266 domain-containing protein	NA	NA	NA	NA	NA
WP_003858816.1|1533602_1534583_-	DUF368 domain-containing protein	NA	NA	NA	NA	NA
1535092:1535143	attL	GTTTCCGCTGGTAGTGGTGCCCCTGGTGAGACTCGAACTCACACTGGACGGG	NA	NA	NA	NA
WP_003858814.1|1535230_1535920_-|integrase	site-specific integrase	integrase	G9FH48	Rhodococcus_phage	36.2	2.1e-15
WP_003858812.1|1535929_1536385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003861519.1|1536381_1537128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003858809.1|1537320_1537755_+	metallopeptidase	NA	NA	NA	NA	NA
WP_089158527.1|1538433_1539635_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	34.2	2.5e-27
WP_003858803.1|1539740_1540355_+	DUF4258 domain-containing protein	NA	NA	NA	NA	NA
WP_003858801.1|1540357_1540579_+	DUF2283 domain-containing protein	NA	NA	NA	NA	NA
WP_038583885.1|1541227_1541662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003858799.1|1541677_1541893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003858795.1|1542331_1542703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003858794.1|1542777_1542990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003858792.1|1543419_1543623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003861526.1|1544594_1544972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003861528.1|1545230_1546181_-|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
1548719:1548770	attR	GTTTCCGCTGGTAGTGGTGCCCCTGGTGAGACTCGAACTCACACTGGACGGG	NA	NA	NA	NA
>prophage 3
NZ_CP016335	Corynebacterium glutamicum strain ATCC 13869 chromosome, complete genome	3296500	3148584	3206242	3296500	integrase,transposase	Streptococcus_phage(13.33%)	58	3169378:3169393	3203351:3203366
WP_040968032.1|3148584_3148875_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_040968033.1|3149418_3149625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065532601.1|3149900_3151463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003860174.1|3152247_3152874_-	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	36.4	1.9e-23
WP_011013963.1|3153223_3153583_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_046552205.1|3153582_3154179_+	cadmium transporter	NA	NA	NA	NA	NA
WP_003859023.1|3154437_3155859_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	30.0	1.2e-44
WP_003859021.1|3155957_3156347_+	heavy metal-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_060565376.1|3156837_3157548_-|transposase	IS6-like element ISCef5 family transposase	transposase	A0A077SL39	Escherichia_phage	59.8	3.6e-79
WP_003862073.1|3157651_3157963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040968043.1|3157959_3158202_-	DUF2892 domain-containing protein	NA	NA	NA	NA	NA
WP_003862071.1|3158438_3159740_-	APC family permease	NA	NA	NA	NA	NA
WP_060565377.1|3159805_3161287_-	multicopper oxidase family protein	NA	NA	NA	NA	NA
WP_003862069.1|3161283_3161550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157676154.1|3162261_3162768_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q8W6R2	Burkholderia_virus	54.2	1.2e-39
WP_157676156.1|3162803_3163013_+	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_040968233.1|3163170_3163839_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_011015535.1|3163994_3164231_+	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_011015536.1|3164436_3164754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060565379.1|3165397_3167275_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	37.2	6.0e-105
WP_003861174.1|3168482_3168857_-	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	38.7	4.5e-12
WP_060565381.1|3169042_3169249_+	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
3169378:3169393	attL	TTTGCTTATCGACGCC	NA	NA	NA	NA
WP_003861178.1|3169448_3170768_+	MFS transporter	NA	NA	NA	NA	NA
WP_003861180.1|3170727_3170910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040968046.1|3170920_3171319_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_038586436.1|3171315_3171501_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060565382.1|3171729_3173262_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	42.3	1.1e-88
WP_003855068.1|3173869_3174322_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_060565383.1|3174378_3175056_-	single-stranded DNA-binding protein	NA	A0A1P8D5R5	Corynebacterium_phage	52.7	2.9e-49
WP_011898087.1|3175092_3175389_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_003861194.1|3175739_3175931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011015546.1|3175927_3177388_-	DUF2029 domain-containing protein	NA	NA	NA	NA	NA
WP_060565384.1|3177433_3179596_-	penicillin-binding protein	NA	NA	NA	NA	NA
WP_060565385.1|3179687_3180080_-	DUF5318 family protein	NA	NA	NA	NA	NA
WP_003855083.1|3180271_3180745_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003861200.1|3180775_3181717_+	universal stress protein	NA	NA	NA	NA	NA
WP_003861203.1|3181748_3182246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038586445.1|3182313_3182637_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_060565387.1|3182657_3183596_-	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
WP_060565388.1|3183643_3184909_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_003855103.1|3184905_3185598_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	43.1	1.0e-38
WP_060565535.1|3185601_3187440_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_003855107.1|3187806_3188898_+	inositol-3-phosphate synthase	NA	A0A0H4IPK5	Stenotrophomonas_phage	42.4	8.6e-72
WP_060565389.1|3188973_3189519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060565390.1|3189593_3191081_-	DUF1846 domain-containing protein	NA	NA	NA	NA	NA
WP_006285365.1|3191449_3191863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006285366.1|3192039_3192945_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	U5P429	Shigella_phage	27.5	3.4e-13
WP_081299886.1|3193258_3194464_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	32.7	2.1e-31
WP_060565391.1|3194972_3195470_-	DNA starvation/stationary phase protection protein Dps	NA	NA	NA	NA	NA
WP_060565392.1|3195621_3196431_+	Fpg/Nei family DNA glycosylase	NA	NA	NA	NA	NA
WP_060565393.1|3196667_3197819_+	RtcB family protein	NA	A0A0M5M6X2	Mycobacterium_phage	63.2	1.4e-136
WP_003855120.1|3197825_3198302_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	42.7	5.0e-16
WP_075348439.1|3198316_3199330_-	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_060565394.1|3199487_3200411_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011898098.1|3200714_3201893_+	MFS transporter	NA	NA	NA	NA	NA
WP_038586475.1|3202168_3203347_+	NADP-dependent malic enzyme	NA	NA	NA	NA	NA
WP_065532602.1|3203477_3204851_+	hypothetical protein	NA	NA	NA	NA	NA
3203351:3203366	attR	TTTGCTTATCGACGCC	NA	NA	NA	NA
WP_034983522.1|3204931_3206242_+|transposase	ISL3-like element IS31831 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	42.2	1.0e-82
