The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP016380	Aeromonas hydrophila strain AHNIH1 chromosome, complete genome	4906118	677427	757595	4906118	tail,integrase,tRNA,head,terminase,capsid,holin,plate,portal,transposase	Aeromonas_virus(66.67%)	81	694366:694420	728153:728207
WP_065475544.1|677427_680052_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	37.9	6.2e-76
WP_011707428.1|680068_681316_+	aspartate kinase	NA	NA	NA	NA	NA
WP_005305164.1|681409_681598_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	2.9e-12
WP_065475546.1|682839_683667_-	D-alanyl-D-alanine endopeptidase	NA	NA	NA	NA	NA
WP_016352045.1|683806_684472_-	DedA family protein	NA	NA	NA	NA	NA
WP_024946378.1|684490_685783_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_043162791.1|685969_688822_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.2	3.1e-137
WP_065475549.1|688887_689343_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_011707422.1|689504_691013_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	37.6	4.4e-50
WP_065475552.1|691185_692298_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_065475555.1|692439_693510_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_043127228.1|693668_694190_-	RDD family protein	NA	NA	NA	NA	NA
694366:694420	attL	TTCAAAATCCGCCGGTGAATAACCGTGTCGGTTCGAGTCCGACCCCGGGCACCAT	NA	NA	NA	NA
WP_065475556.1|695159_696773_-	hypothetical protein	NA	A5X9J8	Aeromonas_virus	82.1	6.0e-263
WP_065475561.1|696769_697321_-	hypothetical protein	NA	A5X9J7	Aeromonas_virus	78.1	3.2e-67
WP_065475564.1|697317_698199_-	hypothetical protein	NA	A5X9J6	Aeromonas_virus	78.8	3.5e-124
WP_065475566.1|698195_698621_-|tail	tail fiber assembly protein	tail	A5X9J5	Aeromonas_virus	49.6	3.2e-30
WP_065475570.1|700935_701538_-|tail	phage tail protein	tail	A5X9J2	Aeromonas_virus	92.4	4.5e-107
WP_065475573.1|701530_702718_-|plate	baseplate J/gp47 family protein	plate	A5X9J1	Aeromonas_virus	91.7	3.5e-204
WP_065475575.1|702714_703038_-	DUF2590 family protein	NA	A5X9J0	Aeromonas_virus	93.5	5.5e-51
WP_065475578.1|703034_705092_-|tail	phage tail tape measure protein	tail	A5X9I9	Aeromonas_virus	59.2	1.0e-203
WP_167335816.1|705095_705239_-	hypothetical protein	NA	A5X9I8	Aeromonas_virus	72.3	4.9e-12
WP_065475580.1|705280_705544_-|tail	putative phage tail assembly chaperone	tail	A5X9I7	Aeromonas_virus	64.4	4.0e-23
WP_065475582.1|705667_706102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065475585.1|706098_706560_-	glycoside hydrolase family 104 protein	NA	G0ZT35	Aeromonas_phage	86.3	5.4e-76
WP_065475587.1|706546_706873_-|holin	phage holin, lambda family	holin	A5X9I3	Aeromonas_virus	62.6	6.8e-25
WP_042064911.1|706896_707106_-	TraR/DksA family transcriptional regulator	NA	A5X9I2	Aeromonas_virus	88.4	1.0e-29
WP_044800823.1|707116_707572_-	DUF2597 family protein	NA	A5X9I1	Aeromonas_virus	86.0	3.4e-70
WP_065475589.1|707575_708712_-	DUF2586 family protein	NA	A5X9I0	Aeromonas_virus	88.1	1.9e-191
WP_065475592.1|708715_709423_-	virion morphogenesis protein	NA	A5X9H9	Aeromonas_virus	55.9	4.9e-60
WP_187172444.1|709419_709941_-|tail	phage tail protein	tail	A5X9H8	Aeromonas_virus	81.9	1.5e-77
WP_065475594.1|709937_710399_-|head	head completion/stabilization protein	head	A5X9H7	Aeromonas_virus	91.5	3.8e-69
WP_065475597.1|710570_711299_-|terminase	terminase endonuclease subunit	terminase	A5X9H6	Aeromonas_virus	95.0	1.6e-130
WP_065475600.1|711302_712352_-|capsid	phage major capsid protein, P2 family	capsid	A5X9H5	Aeromonas_virus	92.5	1.4e-183
WP_065475602.1|712362_713232_-|capsid	GPO family capsid scaffolding protein	capsid	A5X9H4	Aeromonas_virus	77.2	4.8e-126
WP_065475606.1|713407_715222_+|terminase	terminase	terminase	A5X9H3	Aeromonas_virus	93.5	0.0e+00
WP_065475608.1|715218_716259_+|portal	phage portal protein	portal	A5X9H1	Aeromonas_virus	95.2	6.8e-175
WP_081304781.1|716317_716572_+	ogr/Delta-like zinc finger family protein	NA	A5X9H0	Aeromonas_virus	86.2	1.1e-33
WP_065475610.1|716711_719615_-	replication endonuclease	NA	A5X9G4	Aeromonas_virus	34.8	6.2e-117
WP_065475613.1|719614_719908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065475616.1|719907_720204_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065480456.1|720905_721187_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_017412429.1|721195_721381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065475619.1|721420_721849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081304471.1|721862_722438_-	phage regulatory CII family protein	NA	A5X9F7	Aeromonas_virus	55.7	2.5e-38
WP_065475621.1|722373_722661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081304783.1|722672_722858_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_081304472.1|722976_723630_+	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	42.3	3.4e-39
WP_081304473.1|723703_724837_+	ParB N-terminal domain-containing protein	NA	Q858T2	Yersinia_virus	50.0	9.2e-77
WP_147822834.1|724873_725857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065475624.1|725898_726840_-	DNA (cytosine-5-)-methyltransferase	NA	Q7Y4B5	Escherichia_virus	69.6	1.2e-133
WP_065475626.1|727030_728080_+|integrase	tyrosine-type recombinase/integrase	integrase	A5X9F3	Aeromonas_virus	81.4	1.5e-161
WP_065475629.1|728659_730096_+	ammonium transporter	NA	NA	NA	NA	NA
728153:728207	attR	TTCAAAATCCGCCGGTGAATAACCGTGTCGGTTCGAGTCCGACCCCGGGCACCAT	NA	NA	NA	NA
WP_065475631.1|730432_731785_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	43.1	9.0e-95
WP_081304474.1|731933_732116_+	DUF5363 family protein	NA	NA	NA	NA	NA
WP_011707416.1|732084_732702_-	type IVa pilus pseudopilin TppF	NA	NA	NA	NA	NA
WP_065475633.1|732742_733531_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_011707414.1|733744_735019_+	NupC/NupG family nucleoside CNT transporter	NA	NA	NA	NA	NA
WP_005305103.1|735142_735313_+	DUF1427 family protein	NA	R4TMJ4	Halovirus	60.0	6.3e-06
WP_011707413.1|735704_736478_+	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_042064696.1|736587_737919_+	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	40.0	8.9e-79
WP_065475635.1|737933_739142_+	phosphopentomutase	NA	NA	NA	NA	NA
WP_011707410.1|739219_739936_+	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_065475638.1|740005_742252_-	PAS domain S-box protein	NA	G3MA91	Bacillus_virus	32.6	4.6e-19
WP_017411238.1|742305_742914_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_065475642.1|743034_744045_+	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_065475646.1|744094_745000_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_045788992.1|745126_747505_-	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_011707405.1|747605_748970_+	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_011707404.1|749041_749422_-	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_011707403.1|749523_750006_-	Rsd/AlgQ family anti-sigma factor	NA	NA	NA	NA	NA
WP_130631666.1|750103_750289_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005305063.1|750347_750620_+	DNA-binding protein HU-alpha	NA	A0A249Y2G7	Serratia_phage	44.2	3.6e-11
WP_010636148.1|750721_751147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011707400.1|751222_751372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065475648.1|751374_752361_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_081304784.1|752499_752958_+	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_017411205.1|752947_753409_+	chemotaxis protein CheX	NA	NA	NA	NA	NA
WP_045525480.1|753413_753644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081304785.1|753714_755049_-	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_011707394.1|755385_756693_-	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_065475656.1|756884_757595_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
>prophage 2
NZ_CP016380	Aeromonas hydrophila strain AHNIH1 chromosome, complete genome	4906118	1651726	1660510	4906118	transposase	Enterobacteria_phage(42.86%)	8	NA	NA
WP_081304545.1|1651726_1652902_+	DegT/DnrJ/EryC1/StrS aminotransferase family protein	NA	A0A2K9L470	Tupanvirus	49.4	7.0e-104
WP_065476736.1|1652963_1654925_+	polysaccharide biosynthesis protein	NA	A0A2P1ELS8	Moumouvirus	25.3	4.1e-16
WP_065480510.1|1655175_1656261_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	51.6	1.3e-96
WP_065476739.1|1656260_1657148_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.7	1.1e-27
WP_065476741.1|1657260_1658148_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	63.4	2.4e-104
WP_081304546.1|1658253_1658793_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	48.7	4.6e-42
WP_081304547.1|1658865_1659519_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019706001.1|1659562_1660510_+|transposase	IS30-like element ISAs2 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.7	1.4e-41
>prophage 3
NZ_CP016380	Aeromonas hydrophila strain AHNIH1 chromosome, complete genome	4906118	2548205	2564656	4906118	tRNA	Hokovirus(12.5%)	12	NA	NA
WP_065477547.1|2548205_2552165_-	transporter substrate-binding domain-containing protein	NA	A0A1V0SGX0	Hokovirus	36.0	2.9e-32
WP_005300715.1|2552219_2552516_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	35.6	3.0e-11
WP_065477549.1|2552519_2554907_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	23.6	6.8e-05
WP_016350663.1|2554919_2555903_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	44.0	1.5e-35
WP_005300683.1|2556219_2556576_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_005300673.1|2556591_2556789_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_026080374.1|2556875_2557424_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	37.9	8.3e-15
WP_011706169.1|2557427_2559356_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.9	2.2e-126
WP_187172457.1|2559592_2560180_-	SEL1-like repeat protein	NA	NA	NA	NA	NA
WP_065477553.1|2560354_2561410_+	PA0069 family radical SAM protein	NA	A0A1C9EG97	Acidianus_two-tailed_virus	29.6	5.7e-12
WP_187172458.1|2561440_2561611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029300958.1|2561908_2564656_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	34.9	1.7e-108
>prophage 4
NZ_CP016380	Aeromonas hydrophila strain AHNIH1 chromosome, complete genome	4906118	2840496	2886130	4906118	protease,plate,tRNA	uncultured_Mediterranean_phage(14.29%)	36	NA	NA
WP_017409658.1|2840496_2841255_-|tRNA	tRNA-(ms[2]io[6]A)-hydroxylase	tRNA	NA	NA	NA	NA
WP_011705746.1|2841439_2842960_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	42.6	1.4e-88
WP_011705745.1|2842981_2843470_-	CvpA family protein	NA	NA	NA	NA	NA
WP_043168399.1|2843656_2844952_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	49.6	1.5e-91
WP_065477836.1|2845292_2846630_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	42.1	8.1e-80
WP_011705742.1|2846782_2847391_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_065477839.1|2847468_2849991_-	DNA translocase FtsK 4TM domain-containing protein	NA	A0A218M9A2	Mycobacterium_phage	48.4	4.7e-89
WP_005300047.1|2850192_2850684_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_075384527.1|2850833_2851064_+	alanine dehydrogenase	NA	NA	NA	NA	NA
WP_017409663.1|2851670_2852621_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.5	2.4e-62
WP_011705738.1|2852678_2853926_+	response regulator	NA	A0A127AWB9	Bacillus_phage	32.2	6.5e-15
WP_011705737.1|2854036_2854507_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_065477842.1|2854526_2855234_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_065477845.1|2855230_2855947_+	arginyltransferase	NA	NA	NA	NA	NA
WP_005300033.1|2856016_2856235_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_065477848.1|2856304_2858557_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	43.7	1.2e-168
WP_005300028.1|2858616_2858934_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	49.4	2.4e-14
WP_005300025.1|2859162_2859381_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	63.2	1.2e-17
WP_017411050.1|2859488_2860352_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	31.2	2.3e-27
WP_126882635.1|2861823_2862312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017783798.1|2862478_2863102_-	lytic enzyme	NA	A0A0X8WP64	Ralstonia_phage	37.8	5.5e-23
WP_065477854.1|2865134_2867183_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.9	1.1e-32
WP_017411057.1|2867193_2867481_-	type VI secretion system PAAR protein	NA	G4KK81	Yersinia_phage	39.4	2.3e-08
WP_065477857.1|2867738_2869169_-	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_065477860.1|2869215_2872701_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_065477863.1|2872742_2874188_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_065477866.1|2874196_2874802_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_065477869.1|2874801_2876340_-	sigma-54-dependent transcriptional regulator VasH	NA	NA	NA	NA	NA
WP_065477872.1|2876342_2878985_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	33.4	2.4e-91
WP_010634228.1|2879005_2879785_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_029301183.1|2879807_2881142_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_065477875.1|2881144_2881660_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_049048591.1|2881659_2882910_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_065477878.1|2882966_2883965_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_011705715.1|2883928_2885695_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_065477881.1|2885698_2886130_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 5
NZ_CP016380	Aeromonas hydrophila strain AHNIH1 chromosome, complete genome	4906118	3784079	3791588	4906118	protease	Staphylococcus_phage(50.0%)	8	NA	NA
WP_016351731.1|3784079_3784550_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	48.7	3.5e-30
WP_065479061.1|3784747_3785941_+|protease	serine protease	protease	I6WTR7	Cotesia_sesamiae_Mombasa_bracovirus	25.6	2.5e-08
WP_065479063.1|3786022_3787132_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	39.2	4.7e-65
WP_024944275.1|3787273_3787927_-	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	36.4	2.1e-20
WP_065479066.1|3787981_3789091_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	35.5	1.2e-49
WP_010675395.1|3789187_3789637_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_081304679.1|3789771_3790251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011707102.1|3790334_3791588_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	53.5	2.3e-100
>prophage 6
NZ_CP016380	Aeromonas hydrophila strain AHNIH1 chromosome, complete genome	4906118	3981931	4037992	4906118	integrase,transposase,capsid,tRNA	Aeromonas_virus(23.08%)	47	3997401:3997417	4035782:4035798
WP_029302666.1|3981931_3982897_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_005309538.1|3982922_3983219_+	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
WP_065479292.1|3983301_3983934_-	LysE family translocator	NA	NA	NA	NA	NA
WP_019706001.1|3987660_3988608_+|transposase	IS30-like element ISAs2 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.7	1.4e-41
WP_065479295.1|3991068_3993936_+	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	38.8	2.2e-21
WP_065479298.1|3994050_3994707_+|tRNA	bifunctional tRNA pseudouridine(32) synthase/23S rRNA pseudouridine(746) synthase RluA	tRNA	NA	NA	NA	NA
WP_065475368.1|3994811_3995774_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_073348952.1|3995820_3996009_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039214446.1|3996067_3997999_-	bifunctional diguanylate cyclase/phosphodiesterase	NA	NA	NA	NA	NA
3997401:3997417	attL	CGGGCCTCGCGGATCAA	NA	NA	NA	NA
WP_065479301.1|3998022_3998520_-	molybdopterin-binding oxidoreductase	NA	NA	NA	NA	NA
WP_011704804.1|3998615_4000250_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	67.0	4.9e-188
WP_005309514.1|4000291_4000585_-	co-chaperone GroES	NA	A0A221S322	uncultured_virus	36.8	8.6e-11
WP_081304692.1|4000767_4002168_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_162493509.1|4002191_4002668_-	FxsA family protein	NA	NA	NA	NA	NA
WP_065479308.1|4003117_4004560_+	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_011704800.1|4004687_4006007_+	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
WP_065475368.1|4006127_4007090_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_016349559.1|4007247_4008339_+	porin	NA	Q1MVN1	Enterobacteria_phage	35.2	2.1e-46
WP_065479311.1|4008403_4009597_-	multidrug efflux MFS transporter MdtH	NA	NA	NA	NA	NA
WP_024946193.1|4009804_4010704_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_065479315.1|4010755_4012525_-	M4 family metallopeptidase	NA	NA	NA	NA	NA
WP_017410624.1|4012876_4013431_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_016349554.1|4013430_4013982_+	ribosomal protein S5-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_005309486.1|4014084_4014330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065479317.1|4014639_4015689_-	oxidoreductase	NA	NA	NA	NA	NA
WP_024946189.1|4015797_4016961_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_065479320.1|4017183_4017780_+	XTP/dITP diphosphatase	NA	A0A0N9ZPX2	Ugandan_cassava_brown_streak_virus	31.9	5.8e-14
WP_065479324.1|4017914_4019060_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_017410628.1|4019176_4019395_-	ribosome alternative rescue factor ArfA	NA	NA	NA	NA	NA
WP_065479329.1|4019524_4020061_-	dihydrofolate reductase	NA	NA	NA	NA	NA
WP_005309469.1|4020050_4020488_-	Zn(2+)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_065479332.1|4020899_4022492_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	50.3	2.8e-71
WP_065479335.1|4022602_4023892_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_011704785.1|4024156_4024531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024946183.1|4024511_4025066_+	cytochrome b/b6 domain-containing protein	NA	NA	NA	NA	NA
WP_065479338.1|4025340_4027917_+	alpha amylase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_065479341.1|4028843_4030268_+|integrase	site-specific integrase	integrase	A0A0R6PGY7	Moraxella_phage	30.9	9.9e-44
WP_065479344.1|4030280_4031246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065479347.1|4031344_4031575_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_081304693.1|4031592_4031793_+	ogr/Delta-like zinc finger family protein	NA	A5X9H0	Aeromonas_virus	67.3	1.3e-15
WP_065479349.1|4031832_4032153_+	ogr/Delta-like zinc finger family protein	NA	A5X9H0	Aeromonas_virus	57.7	9.4e-19
WP_065479352.1|4032149_4032791_+|capsid	GPO family capsid scaffolding protein	capsid	A5X9H4	Aeromonas_virus	46.3	2.0e-28
WP_065479355.1|4032804_4033770_+|capsid	P2 family phage major capsid protein	capsid	F1BUM2	Cronobacter_phage	34.7	1.8e-36
WP_065479358.1|4033774_4034500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_147822878.1|4034580_4035051_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_147822879.1|4035047_4035299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081304694.1|4035295_4037992_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	32.0	1.5e-104
4035782:4035798	attR	TTGATCCGCGAGGCCCG	NA	NA	NA	NA
>prophage 7
NZ_CP016380	Aeromonas hydrophila strain AHNIH1 chromosome, complete genome	4906118	4041855	4051791	4906118	tRNA	uncultured_Mediterranean_phage(25.0%)	10	NA	NA
WP_073348937.1|4041855_4043721_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	32.6	1.1e-34
WP_065479366.1|4043934_4045722_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	41.1	4.0e-74
WP_065479369.1|4045810_4046254_-	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	48.6	2.2e-26
WP_005309452.1|4046269_4046485_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_024946180.1|4046664_4047678_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.3	9.1e-108
WP_011704778.1|4047762_4048746_-	RNA polymerase sigma factor RpoS	NA	F4YCU2	Synechococcus_phage	34.1	1.7e-34
WP_065479372.1|4048793_4049834_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A0A7NU10	Lactobacillus_phage	41.4	6.0e-14
WP_016349540.1|4049844_4050426_-	DedA family protein	NA	NA	NA	NA	NA
WP_011704775.1|4050422_4051040_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	46.4	4.0e-34
WP_017410638.1|4051044_4051791_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	54.1	7.2e-70
>prophage 1
NZ_CP016381	Aeromonas hydrophila strain AHNIH1 plasmid pASP-135, complete sequence	143348	59723	121930	143348	integrase,plate,tail,transposase	Escherichia_phage(47.62%)	59	92241:92300	113798:114712
WP_065480857.1|59723_60149_-|tail	tail fiber assembly protein	tail	A5X9J5	Aeromonas_virus	49.3	7.8e-29
WP_065480863.1|63274_64246_-	hypothetical protein	NA	Q71TP5	Escherichia_phage	30.7	1.1e-12
WP_065480865.1|64255_64672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147822899.1|64733_65579_-	hypothetical protein	NA	A0A222YWB7	Escherichia_phage	37.9	2.2e-46
WP_065480872.1|65575_66982_-	hypothetical protein	NA	Q71TP2	Escherichia_phage	39.9	7.9e-86
WP_065480874.1|66991_67339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162493518.1|67342_68497_-	transglycosylase SLT domain-containing protein	NA	A0A0A0P1R1	Enterobacteria_phage	37.1	3.9e-06
WP_065480879.1|70692_71520_-	hypothetical protein	NA	A0A222YZ63	Escherichia_phage	38.7	3.4e-44
WP_065480882.1|71529_72018_-	hypothetical protein	NA	A0A222YY05	Escherichia_phage	43.1	2.1e-30
WP_065480885.1|72027_72585_-	hypothetical protein	NA	Q1MVL0	Enterobacteria_phage	40.5	2.2e-23
WP_065480888.1|72661_73162_-|plate	baseplate protein	plate	A0A077SK14	Escherichia_phage	48.8	7.0e-45
WP_065480890.1|73171_73768_-	hypothetical protein	NA	A0A222YY02	Escherichia_phage	45.8	7.1e-36
WP_147822900.1|73787_74489_-	hypothetical protein	NA	A0A222YXT7	Escherichia_phage	35.1	1.1e-08
WP_065480895.1|74498_76091_-	hypothetical protein	NA	Q1MVJ6	Enterobacteria_phage	44.5	1.9e-112
WP_065480898.1|76097_76439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147822901.1|76489_78130_-	hypothetical protein	NA	Q71TM1	Escherichia_phage	35.0	7.6e-80
WP_065480909.1|78391_79171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065480912.1|79164_79665_-	hypothetical protein	NA	M4PQN8	Sulfitobacter_phage	58.6	6.2e-33
WP_147822902.1|79715_80117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065480918.1|80410_81112_-	hypothetical protein	NA	A0A222YWF1	Escherichia_phage	28.2	4.2e-11
WP_065480921.1|81108_82101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065480924.1|82097_82862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081304887.1|82858_83167_-	DUF4406 domain-containing protein	NA	H9C0Q9	Aeromonas_phage	58.2	4.2e-24
WP_065480927.1|83166_83703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065480929.1|83699_84917_-	hypothetical protein	NA	A0A222YXT1	Escherichia_phage	46.0	7.9e-66
WP_081304889.1|84919_85159_-	hypothetical protein	NA	A0A222YYR0	Escherichia_phage	49.3	1.4e-14
WP_147822903.1|85239_85899_-	hypothetical protein	NA	A0A222YZ79	Escherichia_phage	26.1	1.5e-10
WP_065480936.1|85989_86703_-	hypothetical protein	NA	Q71TG3	Escherichia_phage	37.7	4.5e-29
WP_147822904.1|86702_87011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065480941.1|87471_88020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001138073.1|88186_91159_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.1	0.0e+00
WP_001162012.1|91161_91719_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	5.8e-48
WP_000845039.1|92024_93038_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
92241:92300	attL	TTCTACGGCACGTTTGAAGGCGCGCTGAAAGGTCTGGTCATACATGTGATGGCGACGCAC	NA	NA	NA	NA
WP_001931474.1|93243_94110_+	PSE family carbenicillin-hydrolyzing class A beta-lactamase CARB-2	NA	A0A077SL40	Escherichia_phage	44.1	4.8e-57
WP_001261740.1|94227_95019_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_042946310.1|95107_96457_-	group II intron reverse transcriptase/maturase	NA	H7BV81	unidentified_phage	28.1	5.2e-10
WP_001256774.1|97257_98517_+	CmlA family chloramphenicol efflux MFS transporter	NA	S4TR35	Salmonella_phage	31.7	4.8e-26
WP_000800689.1|98641_99274_+	type B-2 chloramphenicol O-acetyltransferase CatB11	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	43.0	7.1e-26
WP_000679427.1|99463_99811_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|99804_100644_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000050481.1|101048_102590_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_002008781.1|102855_103356_+	hypothetical protein	NA	A0A1V0SB21	Catovirus	31.7	3.3e-10
WP_000019304.1|103355_103925_+	trimethoprim-resistant dihydrofolate reductase DfrA19	NA	A0A1V0SD48	Indivirus	27.2	3.5e-08
WP_000845039.1|104527_105541_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_000381802.1|105686_106220_+	aminoglycoside nucleotidyltransferase ANT(2'')-Ia	NA	NA	NA	NA	NA
WP_000186237.1|106302_106935_+	type B-3 chloramphenicol O-acetyltransferase CatB3	NA	A0A2R8FE91	Brazilian_cedratvirus	41.2	4.1e-26
WP_000679427.1|107091_107439_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259032.1|107432_108272_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_001389365.1|108446_109211_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001067855.1|109387_110092_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000052512.1|110541_112017_+	ABC-F type ribosomal protection protein Msr(E)	NA	A0A1B0RXA0	Streptococcus_phage	59.0	2.3e-160
WP_000155092.1|112072_112957_+	Mph(E) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_001067855.1|113040_113745_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000946487.1|114696_115548_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.1e-11
113798:114712	attR	TTCTACGGCACGTTTGAAGGCGCGCTGAAAGGTCTGGTCATACATGTGATGGCGACGCACGACACCGCTCCGTGGATCGGTCGAATGCGTGTGCTGCGCAAAAACCCAGAACCACGGCCAGGAATGCCCGGCGCGCGGATACTTCCGCTCAAGGGCGTCGGGAAGCGCAACGCCGCTGCGGCCCTCGGCCTGGTCCTTCAGCCACCATGCCCGTGCACGCGACAGCTGCTCGCGCAGGCTGGGTGCCAAGCTCTCGGGTAACATCAAGGCCCGATCCTTGGAGCCCTTGCCCTCCCGCACGATGATCGTGCCGTGATCGAAATCCAGATCCTTGACCCGCAGTTGCAAACCCTCACTGATCCGCATGCCCGTTCCATACAGAAGCTGGGCGAACAAACGATGCTCGCCTTCCAGAAAACCGAGGATGCGAACCACTTCATCCGGGGTCAGCACCACCGGCAAGCGCCGCGACGGCCGAGGTCTTCCGATCTCCTGAAGCCAGGGCAGATCCGTGCACAGCACCTTGCCGTAGAAGAACAGCAAGGCCGCCAATGCCTGACGATGCGTGGAGACCGAAACCTTGCGCTCGTTCGCCAGCCAGGACAGAAATGCCTCGACTTCGCTGCTGCCCAAGGTTGCCGGGTGACGCACACCGTGGAAACGGATGAAGGCACGAACCCAGTGGACATAAGCCTGTTCGGTTGGTAAGCTGTAATGCAAGTAGCGTATGCGCTCACGCAACTGGTCCAGAACCTTGACCGAACGCAGCGGTGGTAACGGCGCAGTGGCGGTTTTCATGGCTTGTTATGACTGTTTTTTTGTACAGTCTATGCCTCGGGCATCCAAGCAGCAAGCGCGTTACGCCGTGGGTCGATGTTTGATGTTATGGAGCAGCAACGATGTTACGCAGCAGGG	NA	NA	NA	NA
WP_000376623.1|115675_116176_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000287615.1|116354_117899_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	34.6	1.0e-38
WP_000983249.1|117967_118753_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	35.0	3.3e-33
WP_001324342.1|118739_120263_-|transposase	IS21-like element IS1326 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	24.2	1.2e-15
WP_000287615.1|120385_121930_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	34.6	1.0e-38
>prophage 2
NZ_CP016381	Aeromonas hydrophila strain AHNIH1 plasmid pASP-135, complete sequence	143348	125914	143211	143348	integrase,transposase	uncultured_Caudovirales_phage(20.0%)	21	141943:141962	143328:143347
WP_015063453.1|125914_127609_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
WP_000522996.1|127647_128073_-	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000732275.1|128100_128376_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001294656.1|128391_128757_-	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_001166628.1|128828_129284_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_065480943.1|129280_129676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065480946.1|129876_130590_+	hypothetical protein	NA	J7F9E6	Agrobacterium_phage	37.9	2.0e-21
WP_011787830.1|130483_133564_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	30.6	8.2e-51
WP_011918375.1|133587_133899_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_011787805.1|133898_134159_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_011787804.1|134328_134949_+	recombinase family protein	NA	E5FFF9	Burkholderia_phage	37.1	1.1e-26
WP_011787803.1|135066_135399_-	TraR/DksA C4-type zinc finger protein	NA	NA	NA	NA	NA
WP_011787802.1|135489_136344_-	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	48.6	1.3e-67
WP_011787801.1|136378_137869_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	82.2	8.6e-224
WP_065480949.1|138442_138907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065480951.1|138903_139839_+	hypothetical protein	NA	M1PAK5	Moumouvirus	30.4	8.6e-28
WP_147822905.1|139892_140459_+	hypothetical protein	NA	K7R9L4	Vibrio_phage	43.8	2.2e-42
WP_065480957.1|140455_140638_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065480961.1|140668_141181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065480964.1|141185_141806_+	DUF262 domain-containing protein	NA	A0A0F6WCK7	Sinorhizobium_phage	32.2	5.9e-09
141943:141962	attL	TCAAATCGGACTAATGACAA	NA	NA	NA	NA
WP_081304888.1|142086_143211_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2I7R1N2	Vibrio_phage	30.8	7.9e-36
WP_081304888.1|142086_143211_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2I7R1N2	Vibrio_phage	30.8	7.9e-36
143328:143347	attR	TTGTCATTAGTCCGATTTGA	NA	NA	NA	NA
