The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP015771	Bordetella pertussis strain UT25Sm1 chromosome, complete genome	4124767	9928	65389	4124767	transposase	Streptococcus_phage(20.0%)	49	NA	NA
WP_005013747.1|9928_10879_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929956.1|10977_11928_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_003812014.1|12026_12461_-	Cd(II)/Pb(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_010931098.1|12543_14880_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	42.8	3.2e-124
WP_065486988.1|15071_16088_+|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
WP_003819753.1|16278_16869_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010931097.1|16959_17265_-	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_023853546.1|17732_18740_+	biotin synthase BioB	NA	NA	NA	NA	NA
WP_010931095.1|18736_19612_+	membrane protein	NA	NA	NA	NA	NA
WP_010931094.1|19686_21087_-	MFS transporter	NA	NA	NA	NA	NA
WP_003809348.1|21164_21668_-	peroxiredoxin	NA	M1I839	Pelagibacter_phage	44.1	1.8e-24
WP_010931092.1|21914_22346_+	lipoprotein	NA	NA	NA	NA	NA
WP_010931091.1|22355_23240_-	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_010931090.1|23257_26719_-	DUF748 domain-containing protein	NA	NA	NA	NA	NA
WP_003819741.1|26854_27340_+	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_003819740.1|27320_27572_+	MoaD/ThiS family protein	NA	NA	NA	NA	NA
WP_023853551.1|27577_28060_+	molybdenum cofactor biosynthesis protein MoaE	NA	NA	NA	NA	NA
WP_010931088.1|28056_28578_+	molybdenum cofactor biosynthesis protein B	NA	NA	NA	NA	NA
WP_010931087.1|28584_29790_+	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_010931086.1|29934_31032_-	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_010931085.1|31042_32149_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005012067.1|32283_33234_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931084.1|33336_33921_+	nitroreductase	NA	NA	NA	NA	NA
WP_003812010.1|33990_35412_-	argininosuccinate lyase	NA	NA	NA	NA	NA
WP_010931083.1|35519_36866_+	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_050818159.1|36904_38548_+	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	36.4	1.9e-86
WP_003812004.1|38591_38930_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_010931081.1|38954_39329_-	endonuclease	NA	F4YXR7	Roseobacter_phage	54.4	2.1e-25
WP_003811986.1|42441_43323_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010931080.1|43430_45059_+	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_010931079.1|45100_46618_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_019247679.1|46712_47657_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003813309.1|48838_49741_-	ribosome small subunit-dependent GTPase A	NA	NA	NA	NA	NA
WP_003813306.1|49737_51003_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_003813303.1|51047_51593_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	37.7	2.1e-26
WP_003813302.1|51626_52313_+	NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_010931077.1|52284_53214_-	phenylacetic acid degradation operon negative regulatory protein PaaX	NA	NA	NA	NA	NA
WP_003813298.1|53385_54375_+	1,2-phenylacetyl-CoA epoxidase subunit A	NA	NA	NA	NA	NA
WP_010931076.1|54439_54724_+	1,2-phenylacetyl-CoA epoxidase subunit B	NA	NA	NA	NA	NA
WP_003813293.1|54739_55504_+	phenylacetate-CoA oxygenase subunit PaaC	NA	NA	NA	NA	NA
WP_010931075.1|55500_56007_+	phenylacetate-CoA oxygenase subunit PaaJ	NA	NA	NA	NA	NA
WP_010929591.1|57168_58119_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931074.1|58206_59859_+	phenylacetic acid degradation protein PaaN	NA	NA	NA	NA	NA
WP_010931073.1|59869_60658_+	2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase	NA	NA	NA	NA	NA
WP_003813284.1|60657_61128_+	hydroxyphenylacetyl-CoA thioesterase PaaI	NA	NA	NA	NA	NA
WP_010931072.1|61202_62516_+	phenylacetate--CoA ligase	NA	NA	NA	NA	NA
WP_010931071.1|62569_63175_-	fimbrial protein	NA	NA	NA	NA	NA
WP_010927663.1|63491_64442_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013747.1|64438_65389_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP015771	Bordetella pertussis strain UT25Sm1 chromosome, complete genome	4124767	116317	174070	4124767	transposase	Salmonella_phage(28.57%)	49	NA	NA
WP_005013747.1|116317_117268_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931041.1|121014_121626_-	DUF2239 family protein	NA	NA	NA	NA	NA
WP_003812368.1|121848_123309_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	41.3	1.6e-97
WP_010931040.1|123405_124998_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	33.3	1.0e-17
WP_019247974.1|125351_125609_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003816876.1|125610_126951_+	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_010931038.1|127046_127736_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_019247976.1|127748_129179_+	MFS transporter	NA	NA	NA	NA	NA
WP_014905903.1|130903_131725_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010931036.1|131735_133307_+	amidohydrolase	NA	NA	NA	NA	NA
WP_010931035.1|133335_134313_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010931034.1|134339_135143_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.2	2.7e-30
WP_010931033.1|135139_135934_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003816890.1|135941_137177_+	DUF521 domain-containing protein	NA	NA	NA	NA	NA
WP_019247978.1|137190_137604_+	DUF126 domain-containing protein	NA	NA	NA	NA	NA
WP_010931031.1|138876_140604_-	sulfate permease	NA	NA	NA	NA	NA
WP_010931030.1|140715_142074_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_005013747.1|142366_143317_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931029.1|143357_144428_+	FUSC family protein	NA	NA	NA	NA	NA
WP_010931028.1|144450_145329_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_010931027.1|145500_146472_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010931026.1|146634_147477_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010931025.1|147638_148319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010931024.1|148312_149482_+	NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_010931023.1|149478_150510_+	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A2K9L339	Tupanvirus	27.8	1.8e-26
WP_023853282.1|150577_151795_+	MFS transporter	NA	NA	NA	NA	NA
WP_010931021.1|151829_153362_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_010931020.1|153442_154066_+	FMN-binding negative transcriptional regulator	NA	NA	NA	NA	NA
WP_010931019.1|154096_154708_+	LysE family translocator	NA	NA	NA	NA	NA
WP_010931018.1|154743_155214_+	DUF1801 domain-containing protein	NA	NA	NA	NA	NA
WP_019248147.1|155645_156650_+	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_010931017.1|156686_158201_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010931016.1|158204_159164_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_010931015.1|159192_159996_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_010931014.1|159997_161632_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.1	2.9e-15
WP_010931013.1|161715_162777_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_004567322.1|162975_163245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010931012.1|163248_163773_+	DNA-binding protein	NA	J9Q7G7	Salmonella_phage	32.9	6.5e-09
WP_010929591.1|164188_165139_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931011.1|165135_166170_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_003816758.1|166278_166917_+	DedA family protein	NA	NA	NA	NA	NA
WP_019247724.1|167211_167439_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003820420.1|167561_168275_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_005013747.1|168519_169470_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_023853496.1|169609_169855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010931008.1|169969_171418_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_010929584.1|171528_172479_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_003816756.1|172475_172925_-	dUTP diphosphatase	NA	S4TNT3	Salmonella_phage	67.2	3.7e-45
WP_010929584.1|173119_174070_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP015771	Bordetella pertussis strain UT25Sm1 chromosome, complete genome	4124767	262712	315891	4124767	tRNA,transposase	Salmonella_phage(22.22%)	46	NA	NA
WP_005013747.1|262712_263663_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814065.1|263829_264183_+	cytochrome c	NA	NA	NA	NA	NA
WP_003814063.1|264195_264558_+	cytochrome c	NA	NA	NA	NA	NA
WP_003814061.1|264599_265025_-	DUF1841 family protein	NA	NA	NA	NA	NA
WP_003814059.1|265227_266484_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	64.8	1.2e-11
WP_003814057.1|266682_267663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005015028.1|267812_269054_+	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_005013747.1|269152_270103_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814052.1|270111_270807_-	two-component system response regulator KdpE	NA	NA	NA	NA	NA
WP_003814050.1|273627_274227_-	potassium-transporting ATPase subunit KdpC	NA	NA	NA	NA	NA
WP_010930950.1|274237_276403_-	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	27.1	1.2e-24
WP_010930949.1|276426_278211_-	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_017685545.1|278210_278300_-	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_003814042.1|278994_279267_+	DUF4212 domain-containing protein	NA	NA	NA	NA	NA
WP_003814040.1|279266_281333_+	cation acetate symporter	NA	NA	NA	NA	NA
WP_010929577.1|281329_282280_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005015014.1|282395_282728_-	multidrug transporter	NA	NA	NA	NA	NA
WP_010929073.1|282724_283411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010930948.1|283397_284357_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	40.2	3.1e-57
WP_010930947.1|284389_286759_+	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	48.0	7.6e-81
WP_010930946.1|286758_287391_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_010930945.1|287492_288833_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	38.9	1.6e-75
WP_010930944.1|288879_290235_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	47.5	1.6e-83
WP_005014990.1|290525_290762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003814024.1|290949_291267_-	virulence factor	NA	NA	NA	NA	NA
WP_003814023.1|291539_292055_-	hypothetical protein	NA	T1SAR8	Salmonella_phage	44.6	5.1e-06
WP_003814022.1|292148_292310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003814021.1|292325_293081_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_019247690.1|293419_293626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003814020.1|293633_294293_-	NAAT family transporter	NA	NA	NA	NA	NA
WP_010930941.1|294587_296792_-	TonB-dependent alcaligin siderophore receptor FauA	NA	NA	NA	NA	NA
WP_010930940.1|296902_298126_-	alcaligin siderophore export MFS transporter Bcr	NA	S4TR35	Salmonella_phage	29.4	9.8e-24
WP_003814017.1|298248_299223_-	alcaligin siderophore biosynthesis transcriptional regulator AlcR	NA	NA	NA	NA	NA
WP_005013753.1|299290_300484_-	alcaligin siderophore biosynthesis protein AlcE	NA	NA	NA	NA	NA
WP_003814016.1|300498_301299_-	alcaligin siderophore biosynthesis protein AlcD	NA	NA	NA	NA	NA
WP_010930939.1|301295_303152_-	alcaligin siderophore biosynthesis protein AlcC	NA	NA	NA	NA	NA
WP_003814014.1|303148_303754_-	alcaligin siderophore biosynthesis protein AlcB	NA	NA	NA	NA	NA
WP_003814013.1|303772_305158_-	alcaligin siderophore biosynthesis protein AlcA	NA	NA	NA	NA	NA
WP_003814012.1|305883_307110_+	transporter	NA	NA	NA	NA	NA
WP_003814011.1|307198_307981_+	3-hydroxybutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_005012067.1|308079_309030_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814010.1|309056_309830_+	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_003814009.1|309841_311083_+	MFS transporter	NA	NA	NA	NA	NA
WP_076879548.1|312864_313815_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930389.1|313846_314944_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.3	3.5e-20
WP_005013747.1|314940_315891_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP015771	Bordetella pertussis strain UT25Sm1 chromosome, complete genome	4124767	357740	417652	4124767	transposase,tRNA	Streptococcus_virus(12.5%)	52	NA	NA
WP_010930416.1|357740_358229_+|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
WP_019248504.1|358346_358925_+	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_010930418.1|359030_359399_+	ribbon-helix-helix domain-containing protein	NA	NA	NA	NA	NA
WP_005012067.1|359497_360448_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_023994932.1|360454_361567_-	D-alanyl-D-alanine endopeptidase	NA	NA	NA	NA	NA
WP_010930419.1|362253_363456_+	MFS transporter	NA	NA	NA	NA	NA
WP_004568212.1|363491_363638_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010930420.1|363659_366320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010930421.1|366332_369737_+	UvrD-helicase domain-containing protein	NA	NA	NA	NA	NA
WP_023995689.1|370404_372630_+	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	38.5	1.2e-43
WP_010930423.1|372676_373003_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_010930424.1|373053_373662_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_005013747.1|373760_374711_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930742.1|374809_375760_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930425.1|375829_376594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033446226.1|376590_377127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010930427.1|377293_378145_-	membrane protein	NA	A0A1I9SA48	Rhodococcus_phage	35.3	7.0e-37
WP_010928449.1|378204_378831_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_010929591.1|378827_379778_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_019249265.1|379876_380989_-	DUF1513 domain-containing protein	NA	NA	NA	NA	NA
WP_024000672.1|380978_381980_-	imelysin family protein	NA	NA	NA	NA	NA
WP_019247498.1|382085_383597_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_023853587.1|383593_384898_-	imelysin	NA	NA	NA	NA	NA
WP_033446227.1|385009_385567_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_010930432.1|385837_386392_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	32.0	1.7e-15
WP_010930433.1|386847_387063_-	dodecin domain-containing protein	NA	NA	NA	NA	NA
WP_033446228.1|387317_389915_+	DNA mismatch repair protein MutS	NA	A0A1V0SDQ0	Indivirus	22.6	1.5e-21
WP_010930435.1|389911_391099_+	cupin	NA	NA	NA	NA	NA
WP_010930436.1|391757_392372_+	serotype 3 fimbrial subunit	NA	NA	NA	NA	NA
WP_023994740.1|392460_393582_-	outer membrane protein assembly factor BamC	NA	NA	NA	NA	NA
WP_033446216.1|393599_394505_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_005012067.1|395397_396348_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930439.1|396529_397282_+	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_003811112.1|397350_398010_+	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_003811113.1|398006_398735_+	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	39.3	3.3e-35
WP_010930440.1|398747_401027_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A1B1IUF0	uncultured_Mediterranean_phage	32.1	5.9e-06
WP_010930441.1|401051_401255_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_010930442.1|401296_401929_-	guanylate kinase	NA	A0A218KC48	Bacillus_phage	33.9	2.4e-13
WP_010930443.1|402064_402982_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_010930444.1|402978_403692_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_003811135.1|403929_404700_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_003811137.1|404704_405304_-	C40 family peptidase	NA	A0A0A8WF62	Clostridium_phage	41.6	1.4e-20
WP_003811138.1|405548_407039_+	AMP nucleosidase	NA	NA	NA	NA	NA
WP_010926696.1|407097_407382_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010930445.1|407519_407675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003811148.1|407947_408874_-	YicC family protein	NA	NA	NA	NA	NA
WP_003811149.1|409010_409751_+	ribonuclease PH	NA	NA	NA	NA	NA
WP_010930446.1|409917_411294_-	MmgE/PrpD family protein	NA	NA	NA	NA	NA
WP_003811152.1|411475_412381_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930448.1|414032_415835_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_010930449.1|415961_416603_+	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	NA	NA	NA	NA
WP_005012808.1|416701_417652_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP015771	Bordetella pertussis strain UT25Sm1 chromosome, complete genome	4124767	462770	518360	4124767	transposase	Brazilian_cedratvirus(25.0%)	46	NA	NA
WP_005013747.1|462770_463721_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930486.1|463779_464553_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_014486074.1|464545_466102_+	LTA synthase family protein	NA	NA	NA	NA	NA
WP_005013747.1|466098_467049_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003810741.1|468375_468978_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003810743.1|469217_469919_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_003816696.1|469912_470695_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	25.8	2.0e-09
WP_005012808.1|470879_471830_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930483.1|471928_472666_-	TerC family protein	NA	A0A0S4KZH7	Pseudomonas_phage	46.6	4.1e-41
WP_010926609.1|472855_473614_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010930482.1|473660_474650_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010930481.1|474827_475796_-	transporter	NA	NA	NA	NA	NA
WP_010930480.1|477335_478304_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_010930479.1|478312_479254_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_010930478.1|479727_480738_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_010930477.1|480728_482243_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_010930476.1|482239_483586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010930475.1|483588_484623_+	haloacid dehalogenase-like hydrolase	NA	NA	NA	NA	NA
WP_023852967.1|484672_486298_+	arylsulfatase	NA	A0A2P0VMN7	Tetraselmis_virus	52.2	2.0e-149
WP_005012067.1|486850_487801_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930487.1|487905_488853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019247865.1|488906_490721_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_010930489.1|490713_491388_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_023995112.1|491517_494592_+	autotransporter SphB2	NA	NA	NA	NA	NA
WP_019247905.1|494605_494905_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010930492.1|495219_495843_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_010930493.1|496086_496956_+	TauD/TfdA family dioxygenase	NA	NA	NA	NA	NA
WP_010930494.1|496933_497878_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_019247909.1|497963_498890_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_019247910.1|499002_499782_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010930497.1|499772_500969_-	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_010930498.1|500999_501950_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_010930499.1|502171_502861_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010930500.1|502925_503681_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010930501.1|503732_504725_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010930502.1|504734_505688_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003811538.1|505803_506766_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_019249376.1|508167_508596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013747.1|508592_509543_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930503.1|509836_510559_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	68.2	1.3e-87
WP_010930505.1|512187_512538_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_010930506.1|514287_515259_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010930507.1|515272_515986_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010930508.1|515990_516908_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003811452.1|517014_517311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010929588.1|517409_518360_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP015771	Bordetella pertussis strain UT25Sm1 chromosome, complete genome	4124767	525656	588622	4124767	tRNA,transposase	Klosneuvirus(12.5%)	55	NA	NA
WP_005013747.1|525656_526607_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_019247780.1|526650_527193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010930513.1|527290_528139_+	hydrolase	NA	NA	NA	NA	NA
WP_010930514.1|528188_528638_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	38.2	2.0e-06
WP_010930515.1|528634_529636_+	muramoyltetrapeptide carboxypeptidase	NA	NA	NA	NA	NA
WP_010930516.1|529648_530443_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_010930517.1|530491_532393_-	TRAP transporter large permease subunit	NA	NA	NA	NA	NA
WP_003810992.1|532389_533013_-	TRAP transporter small permease subunit	NA	NA	NA	NA	NA
WP_003816541.1|533139_534264_-	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010930518.1|534644_536249_+	ABC-F family ATPase	NA	A0A1V0SKJ1	Klosneuvirus	28.9	1.2e-53
WP_010930519.1|536404_537181_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.2	1.2e-30
WP_010930520.1|537265_538264_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010930521.1|538260_539034_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_005012067.1|540018_540969_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930523.1|541006_541594_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	35.8	4.7e-16
WP_003811007.1|541611_541995_-	thioredoxin family protein	NA	V9SJ74	Achromobacter_phage	25.8	8.1e-09
WP_003811011.1|543354_544647_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	36.0	1.7e-66
WP_010930524.1|544781_545822_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	51.3	6.1e-91
WP_010929632.1|545919_546936_-|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
WP_023852762.1|547203_547839_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_010930526.1|547976_548735_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	51.2	1.4e-68
WP_019247478.1|548719_549499_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	46.9	4.8e-32
WP_003811022.1|549516_550401_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A292GJG6	Xanthomonas_phage	49.5	4.6e-15
WP_004568488.1|550397_551177_+	3'-5' exonuclease	NA	NA	NA	NA	NA
WP_003816527.1|551203_551881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010930529.1|552169_552922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003816525.1|553040_554441_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	26.5	7.3e-31
WP_003816523.1|554464_554863_-	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_003811035.1|555038_555239_+	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_010930530.1|555377_556106_+	redoxin family protein	NA	A0A1D8KSL1	Synechococcus_phage	56.8	9.6e-43
WP_003816520.1|556239_557655_+	dihydrolipoyl dehydrogenase	NA	NA	NA	NA	NA
WP_003816518.1|557658_558522_-	23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ	NA	NA	NA	NA	NA
WP_004568486.1|558534_559284_-	glycerophosphodiester phosphodiesterase	NA	A0A2H4PGQ5	Escherichia_phage	27.8	1.5e-14
WP_010930531.1|559526_561482_+	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_019247882.1|561463_562132_-	arylesterase	NA	NA	NA	NA	NA
WP_005012067.1|562906_563857_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003813572.1|564005_564344_-	BON domain-containing protein	NA	NA	NA	NA	NA
WP_003813570.1|564401_564563_-	DUF1328 domain-containing protein	NA	NA	NA	NA	NA
WP_003813568.1|564594_564795_-	CsbD family protein	NA	NA	NA	NA	NA
WP_010930533.1|565060_567634_-	cyanophycin synthetase	NA	NA	NA	NA	NA
WP_019247811.1|567704_570254_-	cyanophycin synthetase	NA	NA	NA	NA	NA
WP_023852690.1|572822_573293_+	DUF1854 domain-containing protein	NA	NA	NA	NA	NA
WP_029443743.1|573384_574536_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_004566336.1|574589_575411_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_010930537.1|575449_576679_+	lytic murein transglycosylase	NA	NA	NA	NA	NA
WP_004566334.1|576807_577248_+	DUF937 domain-containing protein	NA	NA	NA	NA	NA
WP_005012808.1|577358_578309_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930538.1|578305_578779_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_033446178.1|578940_579879_+	membrane protein	NA	NA	NA	NA	NA
WP_010930540.1|579880_581089_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	30.0	3.8e-36
WP_010930541.1|581193_581700_-	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_010930542.1|581702_584564_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	25.5	1.0e-71
WP_010930543.1|584553_585519_-	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_076879626.1|585578_587573_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	33.3	4.4e-21
WP_005012067.1|587671_588622_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP015771	Bordetella pertussis strain UT25Sm1 chromosome, complete genome	4124767	639870	699139	4124767	tRNA,protease,transposase	Klosneuvirus(40.0%)	50	NA	NA
WP_005013747.1|639870_640821_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930573.1|640945_641755_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_005012067.1|641955_642906_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929577.1|643004_643955_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930574.1|645228_646446_+	four-carbon acid sugar kinase family protein	NA	NA	NA	NA	NA
WP_003818670.1|647502_648405_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930576.1|648481_649354_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_003818672.1|649484_649853_+	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_010930577.1|649910_650957_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_010930578.1|651152_652409_+	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_003810623.1|652413_653751_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_050818134.1|653900_654857_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_019247555.1|654959_655892_-	acyclic terpene utilization AtuA family protein	NA	NA	NA	NA	NA
WP_019247554.1|656007_656328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033446181.1|656314_656680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010930581.1|656727_658302_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003810637.1|658354_659299_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_010930582.1|659316_660147_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_010930583.1|660139_661774_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.7	8.2e-18
WP_010930584.1|661770_663126_+	amidase	NA	NA	NA	NA	NA
WP_010930585.1|664032_665610_+	lipoprotein	NA	NA	NA	NA	NA
WP_010930586.1|665613_666888_+	type 4b pilus protein PilO2	NA	NA	NA	NA	NA
WP_010930587.1|666985_667360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010930588.1|669075_670209_+	general secretion pathway protein	NA	NA	NA	NA	NA
WP_010930589.1|670847_671666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010930590.1|671737_674362_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.4	1.7e-81
WP_004568544.1|674348_674603_+	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_010930591.1|674669_675251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010926757.1|675554_675815_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_014905757.1|675980_676604_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_003816734.1|676603_677377_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_010930593.1|677373_678582_-	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_010930594.1|678607_679081_-	RidA family protein	NA	NA	NA	NA	NA
WP_010930048.1|679154_680105_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930796.1|680203_681553_-	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_023852900.1|682318_683074_+	MipA/OmpV family protein	NA	NA	NA	NA	NA
WP_010930794.1|683166_686049_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	37.1	3.7e-138
WP_003810689.1|686371_686797_+	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	43.2	2.1e-21
WP_004568542.1|686824_687973_+	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_003810693.1|687969_688476_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_033446257.1|688491_689778_+	flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase	NA	NA	NA	NA	NA
WP_033446258.1|689827_691123_+|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_010930791.1|691124_691763_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_023852925.1|691768_692926_+	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_003810703.1|692952_694308_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_010930790.1|694311_695382_+	histidinol-phosphate transaminase	NA	A0A1X6WGT4	Pacmanvirus	25.7	2.5e-15
WP_003810707.1|695520_695757_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_010930789.1|695844_696951_+	GTPase HflX	NA	NA	NA	NA	NA
WP_010930788.1|696916_698221_+|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_010930787.1|698239_699139_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
>prophage 8
NZ_CP015771	Bordetella pertussis strain UT25Sm1 chromosome, complete genome	4124767	709379	769879	4124767	transposase	Staphylococcus_phage(14.29%)	57	NA	NA
WP_005013747.1|709379_710330_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930782.1|710529_711615_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_003810400.1|711630_712392_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_010930781.1|712388_713312_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	33.6	1.6e-23
WP_010930780.1|713410_713911_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_010930779.1|713943_714687_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_010930778.1|714782_715022_-	membrane protein	NA	NA	NA	NA	NA
WP_010930777.1|715035_715188_-	lipoprotein	NA	NA	NA	NA	NA
WP_010930776.1|715273_716764_-	cytochrome c oxidase accessory protein CcoG	NA	NA	NA	NA	NA
WP_010930775.1|716855_717794_-	cytochrome-c oxidase, cbb3-type subunit III	NA	NA	NA	NA	NA
WP_003818560.1|717790_717967_-	cytochrome oxidase	NA	NA	NA	NA	NA
WP_003810383.1|717969_718632_-	cytochrome-c oxidase, cbb3-type subunit II	NA	NA	NA	NA	NA
WP_003810379.1|720253_720397_-	cbb3-type cytochrome oxidase assembly protein CcoS	NA	NA	NA	NA	NA
WP_010930774.1|720393_721368_-	membrane protein	NA	NA	NA	NA	NA
WP_005012067.1|721534_722485_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930773.1|722481_723756_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.9	9.6e-14
WP_010930771.1|725048_725702_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_010930770.1|725698_727135_+	dethiobiotin synthase	NA	NA	NA	NA	NA
WP_010930769.1|727122_727482_+	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_154585107.1|728228_728390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010930768.1|729400_731266_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930767.1|731523_733044_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_003816959.1|733131_733782_-	flavodoxin family protein	NA	NA	NA	NA	NA
WP_010930766.1|734730_736026_+	DUF445 domain-containing protein	NA	NA	NA	NA	NA
WP_010930765.1|736047_736932_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930764.1|737030_737906_+	PhzF family phenazine biosynthesis protein	NA	NA	NA	NA	NA
WP_003816964.1|737895_738252_-	DUF1428 domain-containing protein	NA	NA	NA	NA	NA
WP_010930763.1|738382_739357_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003812228.1|739486_739666_-	DUF3008 family protein	NA	NA	NA	NA	NA
WP_029443822.1|739763_740288_+	DUF302 domain-containing protein	NA	NA	NA	NA	NA
WP_010930761.1|740298_741135_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003816971.1|741247_741619_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_010930760.1|741615_742167_+	SRPBCC family protein	NA	NA	NA	NA	NA
WP_003816975.1|742182_743874_-	STAS domain-containing protein	NA	A0A2H4J153	uncultured_Caudovirales_phage	27.3	5.0e-42
WP_003816977.1|743922_744603_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014905663.1|744850_745315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010930758.1|745484_746414_+	ZIP family metal transporter	NA	NA	NA	NA	NA
WP_019247659.1|746426_747074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023997035.1|747147_748965_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.4	2.3e-37
WP_005012067.1|749048_749999_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929577.1|750651_751602_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003812199.1|751620_751968_-	GFA family protein	NA	NA	NA	NA	NA
WP_010930755.1|751996_753436_-	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	37.4	7.4e-55
WP_010930754.1|753454_753850_-	VOC family protein	NA	NA	NA	NA	NA
WP_003812191.1|754024_754633_+	peptidase S16	NA	NA	NA	NA	NA
WP_010930753.1|754645_755464_+	hypothetical protein	NA	A0A1B1INV8	uncultured_Mediterranean_phage	28.8	2.3e-16
WP_010930752.1|755415_756390_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_003812183.1|756418_757480_-	XdhC family protein	NA	NA	NA	NA	NA
WP_010930751.1|757476_759693_-	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	NA	NA	NA	NA
WP_010930750.1|759706_760165_-	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_003812179.1|760322_760667_-	exported protein	NA	NA	NA	NA	NA
WP_010930749.1|760823_761729_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930748.1|761815_762829_+	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_010930153.1|764808_765825_+|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
WP_019247707.1|765967_767320_-	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	2.9e-45
WP_003812172.1|767494_767791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013747.1|768928_769879_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP015771	Bordetella pertussis strain UT25Sm1 chromosome, complete genome	4124767	781369	845723	4124767	transposase	Vibrio_phage(20.0%)	51	NA	NA
WP_010930742.1|781369_782320_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930800.1|782541_783492_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_023852887.1|783590_784556_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010930740.1|784693_785593_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930739.1|788187_789675_+	hydroxymethylglutaryl-CoA synthase family protein	NA	NA	NA	NA	NA
WP_014486081.1|789685_790882_+	acetyl-CoA acetyltransferase	NA	NA	NA	NA	NA
WP_003816680.1|790954_792274_+	AMP-binding protein	NA	NA	NA	NA	NA
WP_010930737.1|792270_793146_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_010930736.1|793176_794325_-	CoA transferase	NA	NA	NA	NA	NA
WP_010930735.1|794342_794657_-	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	NA	NA	NA	NA
WP_003816687.1|794678_795401_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_003816690.1|795400_796219_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_003816691.1|796223_796751_-	aromatic-ring-hydroxylating dioxygenase subunit beta	NA	NA	NA	NA	NA
WP_010930733.1|796756_798013_-	Rieske 2Fe-2S domain-containing protein	NA	NA	NA	NA	NA
WP_010930732.1|798371_799511_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010930731.1|799588_800461_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_076879629.1|801331_802282_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013747.1|802380_803331_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930729.1|803290_803926_-	membrane protein	NA	NA	NA	NA	NA
WP_010930728.1|804285_805608_-	isocitrate lyase	NA	NA	NA	NA	NA
WP_010930727.1|805926_806748_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.6	4.1e-42
WP_003810356.1|808172_808745_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_010930726.1|808784_810614_-	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_010930725.1|810576_811635_-	beta-N-acetylhexosaminidase	NA	NA	NA	NA	NA
WP_010930724.1|811672_812134_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_003810344.1|812218_812965_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_019247651.1|814455_817686_-	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_019247652.1|817752_819069_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_010930721.1|819321_819696_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010930720.1|819798_820977_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_003810329.1|820987_821578_-	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_003818535.1|821688_822495_+	TOBE domain-containing protein	NA	NA	NA	NA	NA
WP_010930719.1|822520_823315_-	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	25.7	5.1e-05
WP_010930718.1|824315_825290_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003818533.1|825448_825961_-	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	52.3	1.8e-43
WP_003818532.1|826117_827089_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_023853104.1|828833_829628_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_010930716.1|829636_830938_-	malonyl-CoA decarboxylase	NA	NA	NA	NA	NA
WP_010930715.1|830888_831653_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930714.1|831766_832537_-	spermidine synthase	NA	NA	NA	NA	NA
WP_010930713.1|832621_833809_-	acetyl-CoA C-acyltransferase family protein	NA	NA	NA	NA	NA
WP_003818524.1|833881_834256_-	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
WP_003810308.1|834356_835619_-	glycine betaine/L-proline ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.6	6.8e-28
WP_003810306.1|835615_836473_-	proline/glycine betaine ABC transporter permease	NA	NA	NA	NA	NA
WP_003818523.1|836645_837647_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010929591.1|838098_839049_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_033446265.1|840612_841764_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_003810297.1|842132_842369_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_010930711.1|842432_842600_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_023853105.1|842713_844609_-	STAS domain-containing protein	NA	A0A2H4J153	uncultured_Caudovirales_phage	27.5	2.3e-19
WP_010931070.1|844772_845723_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP015771	Bordetella pertussis strain UT25Sm1 chromosome, complete genome	4124767	1441505	1508005	4124767	transposase	uncultured_Caudovirales_phage(40.0%)	56	NA	NA
WP_005012067.1|1441505_1442456_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003811850.1|1442825_1443398_+	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
WP_003811852.1|1443400_1444411_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_010930335.1|1444403_1444904_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_003811855.1|1444914_1445256_+	flagellar biosynthetic protein FliO	NA	NA	NA	NA	NA
WP_010930334.1|1445324_1446059_+	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_003811859.1|1446075_1446345_+	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_010930333.1|1446367_1447156_+	flagellar biosynthetic protein FliR	NA	NA	NA	NA	NA
WP_010929632.1|1447202_1448219_-|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
WP_014486070.1|1448435_1449878_-	PAS domain-containing protein	NA	A0A1B0V854	Salmonella_phage	41.8	1.0e-35
WP_010930332.1|1450056_1451676_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	45.3	1.5e-08
WP_010930331.1|1451796_1453617_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	52.6	6.4e-11
WP_010930330.1|1453695_1455228_-	flagellar hook-associated protein 3	NA	NA	NA	NA	NA
WP_010930329.1|1455261_1456908_-	flagellar hook-associated protein FlgK	NA	NA	NA	NA	NA
WP_010930328.1|1456977_1458000_-	flagellar assembly peptidoglycan hydrolase FlgJ	NA	A0A088F6W1	Sulfitobacter_phage	31.4	1.9e-12
WP_010930327.1|1458017_1459151_-	flagellar basal body P-ring protein FlgI	NA	NA	NA	NA	NA
WP_010930326.1|1459153_1459843_-	flagellar basal body L-ring protein FlgH	NA	NA	NA	NA	NA
WP_010930325.1|1459842_1460628_-	flagellar basal-body rod protein FlgG	NA	NA	NA	NA	NA
WP_003817181.1|1460671_1461436_-	flagellar basal body rod protein FlgF	NA	NA	NA	NA	NA
WP_003817180.1|1461474_1462896_-	flagellar hook-basal body complex protein	NA	NA	NA	NA	NA
WP_010930324.1|1462961_1463666_-	flagellar basal body rod modification protein FlgD	NA	NA	NA	NA	NA
WP_003817176.1|1463713_1464133_-	flagellar basal body rod protein FlgC	NA	NA	NA	NA	NA
WP_010930323.1|1464145_1464553_-	flagellar basal body rod protein FlgB	NA	NA	NA	NA	NA
WP_010930322.1|1464736_1465447_+	flagellar basal body P-ring formation protein FlgA	NA	NA	NA	NA	NA
WP_003817172.1|1465573_1465864_+	flagellar biosynthesis anti-sigma factor FlgM	NA	NA	NA	NA	NA
WP_003817170.1|1465881_1466364_+	flagellar protein FlgN	NA	NA	NA	NA	NA
WP_010930321.1|1470869_1472024_-	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_010929632.1|1472329_1473346_+|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
WP_010930319.1|1473592_1474381_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003812020.1|1474447_1475128_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003812022.1|1475124_1475895_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.1	9.8e-30
WP_010930208.1|1475993_1476944_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003811401.1|1476999_1477917_-	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_003811400.1|1477927_1479106_-	mandelate racemase/muconate lactonizing enzyme family protein	NA	NA	NA	NA	NA
WP_010930318.1|1479125_1480121_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_003811396.1|1481709_1482318_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_003811393.1|1482305_1483346_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_003811391.1|1483363_1484326_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_003811389.1|1484322_1485516_-	CoA transferase	NA	NA	NA	NA	NA
WP_010930317.1|1485512_1486310_-	citryl-CoA lyase	NA	NA	NA	NA	NA
WP_014486069.1|1486335_1487322_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010930316.1|1487340_1489380_-	acetyl-CoA synthetase	NA	NA	NA	NA	NA
WP_010930315.1|1489581_1490262_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930314.1|1490275_1491187_-	CoA ester lyase	NA	NA	NA	NA	NA
WP_003811381.1|1491183_1491762_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_010930313.1|1491900_1492806_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930312.1|1492813_1496233_+	TM0106 family RecB-like putative nuclease	NA	NA	NA	NA	NA
WP_010930311.1|1496220_1498821_-	BP1344/BB2830 family autotransporter	NA	NA	NA	NA	NA
WP_003811375.1|1499776_1500409_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003811372.1|1500802_1501561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003811370.1|1501557_1502760_+	cardiolipin synthase ClsB	NA	NA	NA	NA	NA
WP_010930208.1|1502947_1503898_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930310.1|1504805_1505951_+	DUF3182 family protein	NA	NA	NA	NA	NA
WP_019247449.1|1505937_1506693_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_003811361.1|1506809_1506989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010930208.1|1507054_1508005_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP015771	Bordetella pertussis strain UT25Sm1 chromosome, complete genome	4124767	1670571	1793167	4124767	tRNA,holin,transposase	Bacillus_phage(15.38%)	92	NA	NA
WP_023853639.1|1670571_1671522_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012067.1|1671620_1672571_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003813574.1|1672669_1673551_-	PhzF family phenazine biosynthesis protein	NA	NA	NA	NA	NA
WP_003821443.1|1673628_1675008_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_010930218.1|1675046_1675892_-	membrane protein	NA	NA	NA	NA	NA
WP_033451623.1|1675907_1676222_-	cupredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_010930217.1|1676254_1676791_-	membrane protein	NA	NA	NA	NA	NA
WP_003813585.1|1676963_1677539_-	polyhydroxyalkanoate synthesis repressor PhaR	NA	NA	NA	NA	NA
WP_003813586.1|1677641_1678379_-	acetoacetyl-CoA reductase	NA	NA	NA	NA	NA
WP_010930216.1|1678446_1680084_-	class I poly(R)-hydroxyalkanoic acid synthase	NA	NA	NA	NA	NA
WP_019247742.1|1680191_1680947_-	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_010930214.1|1680934_1681897_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_033446255.1|1682004_1682799_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_010930213.1|1682860_1684936_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	30.0	2.4e-75
WP_010930212.1|1685100_1687476_+	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_010930211.1|1687556_1688912_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003813618.1|1690390_1691113_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010930207.1|1691167_1692151_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005012067.1|1692280_1693231_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012067.1|1693329_1694280_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003813621.1|1694276_1695179_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930206.1|1695266_1696025_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_023853245.1|1696037_1697129_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_003813626.1|1697226_1698654_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.1	2.1e-41
WP_010930204.1|1698883_1700098_-	2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
WP_003813631.1|1700143_1703014_-	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
WP_005013747.1|1703338_1704289_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930202.1|1706473_1706962_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930201.1|1707087_1709784_+	alpha-ketoglutarate dehydrogenase	NA	NA	NA	NA	NA
WP_010930200.1|1709938_1712221_+	NADP-dependent malic enzyme	NA	NA	NA	NA	NA
WP_010930199.1|1712388_1713021_+	fimbrial protein	NA	NA	NA	NA	NA
WP_010930198.1|1713119_1714070_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003812405.1|1714116_1714671_-	transcription elongation factor GreB	NA	NA	NA	NA	NA
WP_003816844.1|1714738_1715584_-	PHP domain-containing protein	NA	NA	NA	NA	NA
WP_019248398.1|1715653_1716622_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_023853221.1|1716621_1718418_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930196.1|1720317_1724244_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_010930194.1|1724979_1728210_-	autotransporter SphB3	NA	NA	NA	NA	NA
WP_010928340.1|1728491_1729319_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_003812422.1|1729352_1730048_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	38.6	7.0e-35
WP_019247537.1|1730040_1731321_-	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_023853218.1|1731366_1732308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010930191.1|1732289_1733990_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.3	1.3e-50
WP_010926448.1|1734092_1735196_+	peptide chain release factor 2	NA	NA	NA	NA	NA
WP_010926447.1|1735226_1735982_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010930190.1|1735988_1737509_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.0	1.2e-82
WP_003812436.1|1737836_1738469_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930188.1|1738547_1740413_-	long-chain fatty acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	23.3	9.3e-50
WP_020699602.1|1740409_1741204_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	23.3	1.2e-11
WP_010930186.1|1741232_1742348_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010930185.1|1743252_1744131_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_010930184.1|1744130_1744955_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	22.7	1.0e-08
WP_005012067.1|1745122_1746073_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930183.1|1746285_1749135_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_010930182.1|1749116_1749845_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_010930181.1|1749985_1751449_-	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	32.5	1.7e-43
WP_010930180.1|1751445_1751817_-	DUF2069 domain-containing protein	NA	NA	NA	NA	NA
WP_003812701.1|1751834_1753148_+	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_003812703.1|1753184_1753643_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_005012067.1|1753755_1754706_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930178.1|1754702_1755716_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_003812707.1|1755855_1756842_+	homoserine kinase	NA	NA	NA	NA	NA
WP_161633091.1|1757200_1757908_-	DUF192 domain-containing protein	NA	NA	NA	NA	NA
WP_076879620.1|1758488_1759439_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003809618.1|1759590_1760193_-	YhbY family RNA-binding protein	NA	NA	NA	NA	NA
WP_010930175.1|1760211_1760844_+	RlmE family RNA methyltransferase	NA	NA	NA	NA	NA
WP_162096758.1|1760888_1761140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010930174.1|1761081_1762968_+	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	M4QMW8	Micromonas_pusilla_virus	41.5	1.4e-109
WP_010930173.1|1762986_1763829_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	32.5	3.2e-26
WP_003819875.1|1763825_1765184_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_003809629.1|1765404_1766199_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_010930172.1|1766429_1767923_-	exopolyphosphatase	NA	NA	NA	NA	NA
WP_010930171.1|1768158_1770240_+	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_014486066.1|1770434_1771475_+	phosphate ABC transporter substrate-binding protein PstS	NA	M4QHS4	Cyanophage	40.2	2.1e-51
WP_010930169.1|1771609_1772626_+	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_003809638.1|1772647_1773505_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_010930167.1|1773549_1774326_+	phosphate ABC transporter ATP-binding protein PstB	NA	G9BWD6	Planktothrix_phage	28.7	4.3e-17
WP_005012067.1|1774693_1775644_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931070.1|1775742_1776693_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_003809441.1|1776719_1777184_-	barstar family protein	NA	NA	NA	NA	NA
WP_014486065.1|1778390_1780679_-	NADP-dependent malic enzyme	NA	NA	NA	NA	NA
WP_010930165.1|1780795_1781668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010930164.1|1781710_1782865_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_010930163.1|1782899_1783730_-	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_023853525.1|1783813_1785358_+	4-hydroxy-3-polyprenylbenzoate decarboxylase	NA	NA	NA	NA	NA
WP_010930161.1|1785400_1785760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003819794.1|1785761_1786175_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_003809432.1|1786215_1786533_-	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_003809431.1|1786617_1787334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010930160.1|1787597_1789019_+	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_010930159.1|1789085_1791818_-	pertactin autotransporter	NA	NA	NA	NA	NA
WP_062826652.1|1792150_1793167_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_CP015771	Bordetella pertussis strain UT25Sm1 chromosome, complete genome	4124767	1801788	1873112	4124767	tRNA,transposase	Pseudomonas_phage(14.29%)	60	NA	NA
WP_062826652.1|1801788_1802805_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_015041211.1|1803742_1805170_+|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_010930151.1|1805166_1806189_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	45.4	8.7e-50
WP_003809396.1|1806178_1806652_+	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_010930149.1|1806792_1807680_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_014486064.1|1807676_1809320_+	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
WP_003819773.1|1809316_1810324_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_010929632.1|1811154_1812171_+|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
WP_003817162.1|1812270_1812903_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_003811911.1|1812911_1813301_-	chemotaxis protein CheY	NA	Q56AR1	Bacillus_thuringiensis_phage	33.3	5.7e-10
WP_010930146.1|1813353_1814406_-	chemotaxis response regulator protein-glutamate methylesterase	NA	NA	NA	NA	NA
WP_010930145.1|1815269_1816976_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	41.7	1.4e-12
WP_003811919.1|1817049_1817550_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_010930144.1|1817564_1819622_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_019247393.1|1819648_1819942_-	response regulator	NA	NA	NA	NA	NA
WP_003817154.1|1820043_1820991_-	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_003811927.1|1821003_1821879_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_003811929.1|1821999_1822560_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_010930143.1|1822594_1822918_-	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_003811933.1|1823353_1824091_+	RNA polymerase sigma factor FliA	NA	NA	NA	NA	NA
WP_005012067.1|1824389_1825340_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012067.1|1825438_1826389_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003809486.1|1826632_1826896_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_003819817.1|1826969_1827251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010930142.1|1827267_1828128_-	M23 family metallopeptidase	NA	A0A292GJG6	Xanthomonas_phage	36.1	2.6e-15
WP_003809479.1|1828124_1828460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010930141.1|1828513_1829164_-	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
WP_010930140.1|1829348_1830824_+	inorganic phosphate transporter	NA	NA	NA	NA	NA
WP_019247197.1|1830844_1831789_-	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_003809467.1|1831834_1832152_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930139.1|1832154_1833093_-	DnaJ domain-containing protein	NA	A0A0P0YMJ9	Yellowstone_lake_phycodnavirus	24.1	5.6e-11
WP_003819814.1|1833270_1833756_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_010930138.1|1833774_1834323_+	diguanylate cyclase	NA	NA	NA	NA	NA
WP_023994624.1|1834354_1834507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010930137.1|1835836_1836478_+	glutathione transferase	NA	NA	NA	NA	NA
WP_010930136.1|1836632_1838981_+	DUF3141 domain-containing protein	NA	NA	NA	NA	NA
WP_003809454.1|1838977_1839916_+	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_010930135.1|1839941_1841132_+	acetate kinase	NA	NA	NA	NA	NA
WP_010930134.1|1841128_1841902_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_010930133.1|1841931_1843125_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_010930132.1|1843242_1844253_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_010930131.1|1844270_1846307_-	transketolase	NA	NA	NA	NA	NA
WP_010930130.1|1846501_1847242_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_005012808.1|1847340_1848291_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003817151.1|1848333_1849509_+	FliC/FljB family flagellin	NA	NA	NA	NA	NA
WP_010930129.1|1849730_1851521_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	25.2	2.4e-39
WP_010930128.1|1851533_1853195_-	dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
WP_010930127.1|1853207_1855913_-	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_003817147.1|1856205_1857960_+	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_010930126.1|1857956_1858583_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003811948.1|1858579_1859431_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	39.8	2.1e-33
WP_010930125.1|1859560_1861621_+	M3 family metallopeptidase	NA	NA	NA	NA	NA
WP_010930124.1|1861807_1862422_+	SCO family protein	NA	NA	NA	NA	NA
WP_010930123.1|1862567_1862819_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_065486814.1|1862888_1864271_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_010930121.1|1864267_1867447_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_029443805.1|1868254_1869172_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930119.1|1869223_1869955_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_010926548.1|1870014_1870587_+	chorismate lyase	NA	NA	NA	NA	NA
WP_010929632.1|1872095_1873112_+|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
>prophage 13
NZ_CP015771	Bordetella pertussis strain UT25Sm1 chromosome, complete genome	4124767	1893705	1958653	4124767	transposase	Bacillus_phage(18.18%)	58	NA	NA
WP_010929591.1|1893705_1894656_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_033446303.1|1894754_1895339_-	helix-hairpin-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003821513.1|1895373_1896363_-	ADP-glyceromanno-heptose 6-epimerase	NA	E3SJ87	Synechococcus_phage	34.4	2.2e-26
WP_010930105.1|1896359_1897301_-	D-glycero-beta-D-manno-heptose-7-phosphate kinase	NA	A0A2H4N7X4	Lake_Baikal_phage	28.1	1.5e-16
WP_010930104.1|1897297_1898518_-	lipopolysaccharide assembly protein LapB	NA	NA	NA	NA	NA
WP_010930103.1|1898560_1898875_-	DUF1049 domain-containing protein	NA	NA	NA	NA	NA
WP_010930102.1|1899066_1899426_-	integration host factor subunit beta	NA	NA	NA	NA	NA
WP_010930101.1|1899427_1901143_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_010930100.1|1901330_1902002_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_010930099.1|1902016_1903345_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_010930098.1|1903341_1904241_-	prephenate dehydrogenase/arogenate dehydrogenase family protein	NA	NA	NA	NA	NA
WP_010930097.1|1904327_1905413_-	prephenate dehydratase	NA	NA	NA	NA	NA
WP_023852687.1|1905405_1906536_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	44.0	4.9e-78
WP_010930095.1|1906538_1909220_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	33.5	3.2e-104
WP_010930094.1|1909590_1910172_+	OmpA family protein	NA	NA	NA	NA	NA
WP_010930093.1|1910297_1911023_+	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_010930092.1|1911019_1911697_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_010930091.1|1911912_1913094_+	MFS transporter	NA	NA	NA	NA	NA
WP_010930090.1|1913866_1914049_+	type II toxin-antitoxin system HicA family toxin	NA	A0A1L2JY37	Aeribacillus_phage	56.1	3.7e-12
WP_005012808.1|1914078_1915029_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_004566317.1|1915158_1915551_+	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0R6PJ17	Moraxella_phage	45.0	4.8e-25
WP_003821497.1|1915827_1916739_-	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	27.6	4.4e-05
WP_010930088.1|1916863_1917838_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005012067.1|1917834_1918785_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003810865.1|1918883_1919969_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_010930072.1|1920066_1920477_+	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_003810859.1|1921092_1923006_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_010930071.1|1923141_1925754_+	PBP1A family penicillin-binding protein	NA	NA	NA	NA	NA
WP_010930070.1|1925755_1926490_-	serine/threonine protein phosphatase	NA	A0A2H4J0P0	uncultured_Caudovirales_phage	49.6	3.8e-63
WP_003810851.1|1926653_1927835_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_003810850.1|1927831_1928044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010930069.1|1928040_1929021_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_010930068.1|1929066_1929894_-	oxidoreductase	NA	A0A2H4PQR8	Staphylococcus_phage	47.4	1.7e-67
WP_023852913.1|1930043_1931858_+	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	27.9	5.7e-44
WP_003810840.1|1931912_1932296_+	Rieske 2Fe-2S domain-containing protein	NA	NA	NA	NA	NA
WP_010930066.1|1932292_1933243_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003810839.1|1933355_1933607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003810837.1|1933800_1934016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003810835.1|1934112_1935231_-	mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_003810832.1|1935350_1935563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010930064.1|1935722_1935944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|1935996_1936947_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930062.1|1938123_1939494_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_010930061.1|1939526_1940318_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930060.1|1940330_1941386_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_019247557.1|1941411_1942287_-	amidohydrolase	NA	NA	NA	NA	NA
WP_023852826.1|1942392_1942641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003819989.1|1942675_1944130_-	carboxylase	NA	NA	NA	NA	NA
WP_004568140.1|1944126_1944648_-	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_010930057.1|1944676_1946029_-	MmgE/PrpD family protein	NA	NA	NA	NA	NA
WP_010930056.1|1951293_1952595_+	phospholipase	NA	NA	NA	NA	NA
WP_010930055.1|1952609_1953326_-	flagellar brake protein	NA	NA	NA	NA	NA
WP_010930054.1|1953607_1954288_+	DUF3313 domain-containing protein	NA	NA	NA	NA	NA
WP_003809770.1|1954299_1954467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023852837.1|1954575_1954722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010930052.1|1954815_1955475_-	thiopurine S-methyltransferase	NA	NA	NA	NA	NA
WP_010930051.1|1955873_1957706_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.4	1.3e-27
WP_005012067.1|1957702_1958653_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 14
NZ_CP015771	Bordetella pertussis strain UT25Sm1 chromosome, complete genome	4124767	2050276	2119270	4124767	transposase	Klosneuvirus(16.67%)	55	NA	NA
WP_010930048.1|2050276_2051227_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003813068.1|2051223_2052243_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	35.7	1.5e-49
WP_010930049.1|2052252_2054961_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	24.0	2.8e-15
WP_014905890.1|2055108_2055756_+	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_014486111.1|2055854_2056805_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_023998705.1|2056952_2057846_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_010930013.1|2058045_2059740_+	thiamine pyrophosphate-binding protein	NA	NA	NA	NA	NA
WP_010930012.1|2059774_2060701_+	VOC family protein	NA	NA	NA	NA	NA
WP_010930011.1|2060769_2061867_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003818996.1|2061885_2062749_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.9	9.6e-34
WP_010930010.1|2062760_2063543_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_004566042.1|2063539_2064658_+	DUF2817 domain-containing protein	NA	NA	NA	NA	NA
WP_010930009.1|2064654_2066187_+	acyl--CoA ligase	NA	NA	NA	NA	NA
WP_003818991.1|2066227_2067235_+	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_023999677.1|2067379_2068102_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930007.1|2068117_2069140_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_010930006.1|2069456_2070191_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930005.1|2070275_2072021_+	acetolactate synthase	NA	NA	NA	NA	NA
WP_010930004.1|2072017_2072770_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010930003.1|2072814_2073771_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_003818983.1|2073859_2074426_+	membrane protein	NA	NA	NA	NA	NA
WP_010930002.1|2074433_2075294_-	D-amino acid aminotransferase	NA	NA	NA	NA	NA
WP_020699739.1|2075323_2076052_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.4	3.4e-32
WP_003807497.1|2076083_2076767_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_010930000.1|2077604_2078519_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010929999.1|2078583_2079492_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010929998.1|2079582_2081007_-	TolC family protein	NA	NA	NA	NA	NA
WP_010929997.1|2081008_2082331_-	cyclolysin T1SS periplasmic adaptor subunit CyaD	NA	NA	NA	NA	NA
WP_010929996.1|2082327_2084466_-	cyclolysin T1SS permease/ATPase CyaB	NA	W8CYL7	Bacillus_phage	29.2	2.7e-45
WP_010929995.1|2084543_2089664_-	bifunctional adenylate cyclase toxin/hemolysin CyaA	NA	NA	NA	NA	NA
WP_153302771.1|2089764_2090073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010929994.1|2090142_2090700_+	cyclolysin-activating lysine-acyltransferase	NA	NA	NA	NA	NA
WP_010929993.1|2090715_2092197_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_023853308.1|2092251_2094105_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929992.1|2094367_2095705_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_010929991.1|2095739_2097737_-	hydantoinase B/oxoprolinase family protein	NA	NA	NA	NA	NA
WP_010929990.1|2097754_2099803_-	hydantoinase/oxoprolinase family protein	NA	NA	NA	NA	NA
WP_010929989.1|2099933_2100800_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010929988.1|2101068_2102034_-	octaprenyl diphosphate synthase	NA	NA	NA	NA	NA
WP_010929987.1|2102148_2103297_-	fumarylacetoacetate hydrolase	NA	NA	NA	NA	NA
WP_003807462.1|2103721_2104033_+	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_003807460.1|2104066_2104327_+	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_003807459.1|2104476_2105610_+	GTPase ObgE	NA	NA	NA	NA	NA
WP_003807457.1|2105680_2106817_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	44.8	5.8e-63
WP_010925762.1|2106982_2107777_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003807452.1|2107839_2108283_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005012808.1|2108398_2109349_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929985.1|2109450_2109879_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010929984.1|2109951_2112147_+	DUF1156 domain-containing protein	NA	NA	NA	NA	NA
WP_005012067.1|2112368_2113319_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_023852739.1|2113278_2113803_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_003814467.1|2113934_2114906_+	FecR family protein	NA	NA	NA	NA	NA
WP_010929983.1|2115025_2117470_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_010929982.1|2117485_2118076_-	polyisoprenoid-binding protein	NA	NA	NA	NA	NA
WP_010929591.1|2118319_2119270_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 15
NZ_CP015771	Bordetella pertussis strain UT25Sm1 chromosome, complete genome	4124767	2134716	2236927	4124767	protease,tRNA,transposase,tail,terminase	uncultured_Caudovirales_phage(14.29%)	108	NA	NA
WP_005012067.1|2134716_2135667_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814437.1|2136398_2136776_+	4a-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
WP_003814436.1|2136760_2137462_-	membrane protein	NA	NA	NA	NA	NA
WP_010931409.1|2137605_2138298_-	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_023852735.1|2138297_2139338_-	phosphotransferase	NA	NA	NA	NA	NA
WP_033446130.1|2139516_2141883_+	LPS-assembly protein LptD	NA	NA	NA	NA	NA
WP_010931412.1|2141879_2143439_+	chaperone SurA	NA	NA	NA	NA	NA
WP_010931413.1|2143463_2144261_+	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_010931414.1|2144292_2145438_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	42.2	1.7e-41
WP_003814419.1|2145542_2146985_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_010929184.1|2146987_2148217_-	spore maturation protein	NA	NA	NA	NA	NA
WP_005012808.1|2150354_2151305_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_019247922.1|2152434_2152992_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_019247923.1|2152967_2153318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003814657.1|2153486_2154281_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.6	2.4e-15
WP_010931416.1|2154277_2155327_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_003814652.1|2155326_2156016_-	tol-pal system protein YbgF	NA	NA	NA	NA	NA
WP_003814650.1|2156102_2156600_-	peptidoglycan-associated lipoprotein Pal	NA	NA	NA	NA	NA
WP_010931417.1|2156631_2157948_-	Tol-Pal system protein TolB	NA	NA	NA	NA	NA
WP_010931418.1|2157964_2158939_-	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_003814643.1|2158975_2159434_-	protein TolR	NA	NA	NA	NA	NA
WP_003814641.1|2159433_2160114_-	protein TolQ	NA	NA	NA	NA	NA
WP_010931419.1|2160116_2160545_-	tol-pal system-associated acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_003814636.1|2160597_2162328_-|tRNA	proline--tRNA ligase	tRNA	A0A2K9L3R9	Tupanvirus	29.4	4.6e-11
WP_003814635.1|2162393_2162966_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_010931420.1|2162946_2163633_+	response regulator	NA	NA	NA	NA	NA
WP_010931421.1|2163988_2164660_+	SOS response-associated peptidase	NA	Q5QF62	Pseudomonas_virus	39.9	4.7e-36
WP_010931422.1|2164988_2165210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010926433.1|2165209_2165491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010931423.1|2165487_2166003_-	DUF2514 family protein	NA	NA	NA	NA	NA
WP_010931424.1|2166002_2166554_-	lysozyme	NA	NA	NA	NA	NA
WP_010931425.1|2166532_2166775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010931426.1|2166779_2167592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010926428.1|2167591_2167855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_124740660.1|2167895_2168093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010931428.1|2168073_2168490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010931429.1|2168494_2172451_-	DUF1983 domain-containing protein	NA	A0A0B5A1N2	Achromobacter_phage	40.8	3.9e-215
WP_010931430.1|2172443_2172833_-	C40 family peptidase	NA	A0A0G3EYJ9	Achromobacter_phage	50.0	3.0e-35
WP_010931431.1|2172829_2173363_-	DUF1833 family protein	NA	A5A3Q9	Burkholderia_phage	46.9	1.1e-40
WP_010931432.1|2173430_2173790_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010931433.1|2173799_2176412_-|tail	phage tail tape measure protein	tail	A0A2H4J107	uncultured_Caudovirales_phage	38.6	4.9e-105
WP_010931434.1|2176437_2176728_-	DUF1799 domain-containing protein	NA	A0A2H4JBP7	uncultured_Caudovirales_phage	45.2	3.7e-14
WP_003813412.1|2176745_2177075_-	hypothetical protein	NA	A0A2H4J121	uncultured_Caudovirales_phage	44.0	2.9e-15
WP_010931435.1|2177084_2177603_-	hypothetical protein	NA	A0A1S5R1H0	Pseudomonas_phage	38.3	5.4e-24
WP_010931436.1|2177857_2178358_-	HNH endonuclease	NA	A0A1I9SEX5	Klebsiella_phage	45.1	4.4e-31
WP_010931437.1|2178365_2178788_-	DUF4128 domain-containing protein	NA	NA	NA	NA	NA
WP_010931438.1|2178784_2179183_-	hypothetical protein	NA	I6PCW1	Cronobacter_phage	38.0	4.2e-16
WP_010931439.1|2179179_2179575_-	hypothetical protein	NA	A0A2D2W284	Stenotrophomonas_phage	35.0	7.8e-07
WP_010931440.1|2179574_2179775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019247789.1|2179776_2180259_-	hypothetical protein	NA	A0A2H4JE38	uncultured_Caudovirales_phage	37.1	1.8e-13
WP_010931442.1|2180321_2180573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012808.1|2181247_2182198_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931443.1|2183675_2184278_-	hypothetical protein	NA	R9TF81	Synechococcus_phage	43.6	7.9e-27
WP_010931444.1|2184400_2184643_-	hypothetical protein	NA	A0A0H5AUE5	Pseudomonas_phage	53.2	5.6e-16
WP_010931445.1|2184648_2185704_-	hypothetical protein	NA	A0A0H5BBX3	Pseudomonas_phage	50.6	2.6e-97
WP_010931446.1|2185732_2187151_-	DUF4055 domain-containing protein	NA	R9TF43	Synechococcus_phage	42.1	2.2e-99
WP_010931447.1|2187153_2188431_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	64.7	2.4e-150
WP_033469562.1|2188417_2188903_-|terminase	terminase	terminase	C7U0W1	Enterobacteria_phage	61.5	7.3e-39
WP_005012067.1|2189542_2190493_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_161633094.1|2190749_2191439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023853179.1|2191431_2191683_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_010931451.1|2192237_2192849_+	S24 family peptidase	NA	NA	NA	NA	NA
WP_019247378.1|2192920_2193127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|2193378_2194329_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012067.1|2194427_2195378_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_019248926.1|2195476_2196550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050818153.1|2196717_2197512_+	dioxygenase	NA	NA	NA	NA	NA
WP_010925795.1|2197551_2198076_-	DUF934 domain-containing protein	NA	NA	NA	NA	NA
WP_010931474.1|2198068_2199811_-	nitrite/sulfite reductase	NA	NA	NA	NA	NA
WP_010931473.1|2200020_2200779_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	24.4	4.4e-14
WP_010931472.1|2200781_2201489_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.4	8.2e-07
WP_010931471.1|2201505_2202387_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_019247734.1|2202397_2203156_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_019248554.1|2203124_2203880_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010931468.1|2203949_2205368_+	amidase	NA	NA	NA	NA	NA
WP_003819076.1|2205389_2206040_-	carbonic anhydrase	NA	NA	NA	NA	NA
WP_033446132.1|2206173_2206509_-	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_010930892.1|2206597_2207548_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931467.1|2207624_2209445_+	DNA helicase RecQ	NA	L7RCS0	Acanthamoeba_polyphaga_moumouvirus	35.3	3.1e-74
WP_010931466.1|2209449_2210523_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.7	2.3e-08
WP_003814230.1|2210645_2211614_+	threo-3-hydroxy-L-aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_010927008.1|2211687_2212599_+	complex I NDUFA9 subunit family protein	NA	NA	NA	NA	NA
WP_003814226.1|2212617_2213190_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_010931465.1|2213270_2213819_-	crossover junction endodeoxyribonuclease RuvC	NA	NA	NA	NA	NA
WP_010931464.1|2213818_2215408_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.2	8.7e-65
WP_003814221.1|2215477_2215717_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_023995141.1|2215757_2216783_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_033446131.1|2216848_2218021_-	UbiH/UbiF/VisC/COQ6 family ubiquinone biosynthesis hydroxylase	NA	NA	NA	NA	NA
WP_010931463.1|2218126_2218579_+	membrane protein	NA	NA	NA	NA	NA
WP_010931462.1|2218588_2219929_-	M24 family metallopeptidase	NA	NA	NA	NA	NA
WP_050818144.1|2220245_2221283_+	sodium:calcium antiporter	NA	NA	NA	NA	NA
WP_003814209.1|2221664_2222024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041166340.1|2222107_2223049_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_076879617.1|2223123_2224074_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814206.1|2224367_2225462_+	porin	NA	NA	NA	NA	NA
WP_033446149.1|2225552_2226425_+	cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
WP_003814203.1|2226446_2227286_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	48.9	1.1e-66
WP_010931459.1|2227361_2228879_+|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_010931458.1|2228975_2230076_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_010931457.1|2230092_2230515_-	SnoaL-like domain-containing protein	NA	NA	NA	NA	NA
WP_003814195.1|2230537_2230750_-	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_010931456.1|2230796_2231717_-	branched-chain amino acid transaminase	NA	NA	NA	NA	NA
WP_010931455.1|2231899_2232649_+	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_003814188.1|2232651_2232981_+	AzlD domain-containing protein	NA	NA	NA	NA	NA
WP_033446148.1|2233268_2234621_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.4	2.1e-51
WP_003814185.1|2234632_2235016_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_010931453.1|2235077_2235878_+	EI24 domain-containing protein	NA	NA	NA	NA	NA
WP_005015810.1|2235976_2236927_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 16
NZ_CP015771	Bordetella pertussis strain UT25Sm1 chromosome, complete genome	4124767	2396545	2443394	4124767	transposase	Lake_Baikal_phage(25.0%)	39	NA	NA
WP_005012067.1|2396545_2397496_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929827.1|2397612_2398680_+	linear amide C-N hydrolase	NA	NA	NA	NA	NA
WP_019247670.1|2398755_2401884_-	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_033446197.1|2402451_2403357_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_010929830.1|2403359_2404031_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_010929831.1|2404187_2405147_+	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_003821340.1|2405154_2405817_+	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_005013747.1|2405813_2406764_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930176.1|2406862_2407813_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929806.1|2407934_2409188_+	CoA transferase	NA	NA	NA	NA	NA
WP_010929805.1|2409165_2410128_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010929804.1|2410259_2410754_+	MaoC family dehydratase	NA	NA	NA	NA	NA
WP_010929803.1|2410753_2411986_+	dehydratase	NA	NA	NA	NA	NA
WP_019247316.1|2412731_2413013_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010929802.1|2412999_2413986_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010929801.1|2414129_2414534_+	RidA family protein	NA	NA	NA	NA	NA
WP_010929800.1|2414675_2418062_+	molybdopterin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_010929799.1|2418092_2419556_+	short-chain fatty acid transporter	NA	NA	NA	NA	NA
WP_019248869.1|2419576_2421193_+	L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_010929797.1|2421278_2421938_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010929796.1|2421967_2422408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010929795.1|2422918_2423122_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	58.2	5.8e-14
WP_010929794.1|2423297_2424203_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930363.1|2424301_2425252_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012067.1|2425350_2426301_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814674.1|2428082_2429276_-	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_010929793.1|2429341_2430370_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_019247419.1|2430396_2431569_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_003814681.1|2431694_2432672_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003814685.1|2432682_2433654_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010929791.1|2433720_2434506_-	crotonase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_003814691.1|2434498_2435731_-	CoA transferase	NA	NA	NA	NA	NA
WP_003814694.1|2435926_2436682_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	40.8	2.9e-42
WP_010929789.1|2436792_2437311_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	38.9	2.1e-12
WP_010929788.1|2439099_2440500_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_003820700.1|2440599_2440944_+	TIGR01244 family phosphatase	NA	NA	NA	NA	NA
WP_003814701.1|2441032_2441503_+	universal stress protein	NA	NA	NA	NA	NA
WP_019247421.1|2441913_2442312_+	GTP-binding protein	NA	E4ZFJ7	Streptococcus_phage	44.3	9.0e-19
WP_010929577.1|2442443_2443394_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 17
NZ_CP015771	Bordetella pertussis strain UT25Sm1 chromosome, complete genome	4124767	2451590	2509461	4124767	tRNA,transposase	Streptococcus_phage(33.33%)	56	NA	NA
WP_022997984.1|2451590_2452568_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_033446199.1|2452660_2453155_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003814720.1|2453284_2454343_+	glycosyltransferase family 2 protein	NA	I1TED8	Salmonella_phage	40.5	2.8e-59
WP_010927086.1|2454339_2455959_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_042962164.1|2455918_2456314_-	GtrA family protein	NA	NA	NA	NA	NA
WP_023853020.1|2456248_2457250_+	ChbG/HpnK family deacetylase	NA	NA	NA	NA	NA
WP_010929783.1|2457246_2457702_+	multidrug/biocide efflux PACE transporter	NA	NA	NA	NA	NA
WP_003814709.1|2457707_2458631_-	alpha/beta fold hydrolase	NA	A0A1C9C5K3	Heterosigma_akashiwo_virus	27.2	4.8e-07
WP_010929782.1|2458720_2459380_-	LysE family translocator	NA	NA	NA	NA	NA
WP_047122777.1|2459376_2460291_-	DMT family transporter	NA	NA	NA	NA	NA
WP_010929577.1|2460379_2461330_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_014486055.1|2461405_2462386_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_003807865.1|2462846_2463446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003807867.1|2463514_2464507_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_014486054.1|2464556_2466146_+	sulfurtransferase	NA	NA	NA	NA	NA
WP_014486053.1|2466186_2467083_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014486052.1|2467079_2468786_+	thiamine pyrophosphate-requiring protein	NA	NA	NA	NA	NA
WP_019247259.1|2468953_2470132_+	CoA transferase	NA	NA	NA	NA	NA
WP_014486051.1|2470128_2470899_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_014486050.1|2470947_2471649_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_014486049.1|2471575_2472559_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_014486048.1|2472657_2473611_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	42.5	5.6e-59
WP_010929483.1|2473915_2474725_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014486047.1|2476455_2477100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014486046.1|2477096_2478317_+	CoA transferase	NA	NA	NA	NA	NA
WP_014486045.1|2478339_2479335_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_003815840.1|2479407_2480613_-	CoA transferase	NA	NA	NA	NA	NA
WP_003815842.1|2480609_2480858_-	glutaredoxin family protein	NA	NA	NA	NA	NA
WP_010927231.1|2480854_2481772_-	reductase	NA	NA	NA	NA	NA
WP_005012067.1|2481908_2482859_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012067.1|2482957_2483908_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929781.1|2483904_2484477_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.5	3.2e-25
WP_010929780.1|2484473_2485412_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	NA	NA	NA	NA
WP_100208326.1|2485536_2486013_+	YraN family protein	NA	NA	NA	NA	NA
WP_033446211.1|2486021_2486615_+	phosphoheptose isomerase	NA	A0A067XQR2	Caulobacter_phage	34.8	5.6e-17
WP_003815190.1|2486611_2487355_+	BON domain-containing protein	NA	NA	NA	NA	NA
WP_003815191.1|2487351_2487843_+	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_010929779.1|2487983_2488772_-	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010929778.1|2489033_2489936_+	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_010929777.1|2489935_2490682_+	pyrimidine 5'-nucleotidase	NA	NA	NA	NA	NA
WP_010927138.1|2490731_2491307_+	nucleoid occlusion factor SlmA	NA	NA	NA	NA	NA
WP_010929776.1|2491519_2493013_+	DASS family sodium-coupled anion symporter	NA	NA	NA	NA	NA
WP_010929775.1|2493023_2494079_+	Ldh family oxidoreductase	NA	NA	NA	NA	NA
WP_003815198.1|2494104_2495241_-	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_003815201.1|2495237_2497190_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_003815202.1|2497203_2497767_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_010929773.1|2497753_2498638_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_003815204.1|2498726_2499770_-	rod shape-determining protein	NA	NA	NA	NA	NA
WP_010929772.1|2500000_2500309_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_010929771.1|2500311_2501850_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_010929770.1|2501852_2503307_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_010929769.1|2503420_2504095_-	orotate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_010929768.1|2504232_2505021_+	exodeoxyribonuclease III	NA	M1PSC0	Streptococcus_phage	25.7	1.2e-19
WP_010929767.1|2505443_2506787_+	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_010929766.1|2506823_2507462_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_005012067.1|2508510_2509461_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 18
NZ_CP015771	Bordetella pertussis strain UT25Sm1 chromosome, complete genome	4124767	2543431	2594386	4124767	protease,transposase	Paramecium_bursaria_Chlorella_virus(14.29%)	47	NA	NA
WP_005013747.1|2543431_2544382_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814960.1|2544504_2545233_+	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_010929739.1|2545329_2546508_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_010929738.1|2546504_2547338_+	symmetrical bis(5'-nucleosyl)-tetraphosphatase	NA	NA	NA	NA	NA
WP_010929737.1|2547374_2548115_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_010929736.1|2548234_2549410_-	dihydroorotase	NA	NA	NA	NA	NA
WP_003820560.1|2549406_2550360_-	aspartate carbamoyltransferase catalytic subunit	NA	A7RB08	Paramecium_bursaria_Chlorella_virus	35.8	2.5e-30
WP_010929735.1|2550373_2550775_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_010927118.1|2550767_2551373_-	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_003814980.1|2551460_2551625_-	rubredoxin	NA	NA	NA	NA	NA
WP_010929734.1|2551741_2552590_+	hydroxymethylpyrimidine/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_003814984.1|2552586_2553240_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_010929733.1|2553256_2554540_+	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_010929732.1|2554779_2556405_+	DUF342 domain-containing protein	NA	NA	NA	NA	NA
WP_003814990.1|2556498_2556900_-	RidA family protein	NA	NA	NA	NA	NA
WP_003814993.1|2556924_2557359_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_003814996.1|2557360_2559010_-	AMP-binding protein	NA	A0A2H4PQU7	Staphylococcus_phage	31.2	2.6e-56
WP_010929731.1|2559050_2560220_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_010929730.1|2560222_2561086_-	enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_010929729.1|2564449_2565154_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.2	1.1e-16
WP_003815010.1|2565147_2565942_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	23.5	2.6e-09
WP_003815011.1|2565938_2566904_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003815013.1|2566907_2567828_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003815015.1|2567924_2569088_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010929728.1|2569310_2570201_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003815019.1|2570204_2570708_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010929727.1|2570750_2571749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010930048.1|2571745_2572696_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_111735998.1|2572784_2573072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013747.1|2573263_2574214_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_004566083.1|2574273_2574834_+	5'-3'-deoxyribonucleotidase	NA	A0A1E1EUN3	Acanthamoeba_castellanii_mimivirus	30.8	3.2e-14
WP_004566082.1|2576336_2577218_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010929725.1|2577331_2578534_+	MFS transporter	NA	NA	NA	NA	NA
WP_003819105.1|2578662_2580522_-	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
WP_003819104.1|2580599_2581409_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_010929724.1|2581479_2582481_+	2-isopropylmalate synthase	NA	NA	NA	NA	NA
WP_003807710.1|2582512_2583373_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_057048199.1|2583572_2584577_+	alpha/beta hydrolase	NA	A0A2P1EM31	Moumouvirus	31.7	5.8e-30
WP_003819100.1|2584573_2586160_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003807706.1|2586168_2587095_+	glyoxylate/hydroxypyruvate reductase A	NA	NA	NA	NA	NA
WP_003807705.1|2587117_2587744_+	FMN-binding negative transcriptional regulator	NA	NA	NA	NA	NA
WP_005015810.1|2587842_2588793_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_014906092.1|2588789_2589926_-|protease	trypsin-like serine protease	protease	W5SAB9	Pithovirus	31.2	1.2e-07
WP_010927226.1|2589979_2590756_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_010929721.1|2590780_2591239_-	large conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_003815815.1|2591378_2592020_+	ubiquinol-cytochrome c reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_005013747.1|2593435_2594386_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 19
NZ_CP015771	Bordetella pertussis strain UT25Sm1 chromosome, complete genome	4124767	2597723	2661198	4124767	tRNA,protease,transposase	Bacillus_phage(22.22%)	49	NA	NA
WP_005012067.1|2597723_2598674_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929717.1|2599717_2599996_-	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_010929716.1|2601138_2601687_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	43.1	1.3e-28
WP_010929715.1|2601749_2603429_-	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	27.6	3.6e-16
WP_010929714.1|2603425_2605177_-	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	23.8	3.4e-09
WP_003817696.1|2605173_2605299_-	cytochrome bd-I oxidase subunit CydX	NA	NA	NA	NA	NA
WP_004567834.1|2605312_2606467_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_023852659.1|2606482_2608060_-	cytochrome d ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_010929712.1|2608185_2608731_-	GbsR/MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012067.1|2609290_2610241_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929711.1|2610971_2611952_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010929710.1|2611965_2613090_+	CoA transferase	NA	NA	NA	NA	NA
WP_003814321.1|2613097_2614852_-	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_010929709.1|2614958_2615858_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003814324.1|2615922_2616906_-	tripartite tricarboxylate transporter substrate binding protein BugE	NA	NA	NA	NA	NA
WP_010929708.1|2617041_2618022_+	AEC family transporter	NA	NA	NA	NA	NA
WP_010929707.1|2618038_2619430_-	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_010929706.1|2619581_2620118_+|tRNA	bifunctional alanine racemase/tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_019247543.1|2620048_2621434_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A2H4JCM7	uncultured_Caudovirales_phage	30.3	4.5e-17
WP_033446171.1|2621576_2622197_-	membrane protein	NA	NA	NA	NA	NA
WP_010929705.1|2622301_2624191_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	32.8	3.3e-79
WP_003814337.1|2624187_2625129_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_003814339.1|2625234_2626284_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	43.6	5.6e-68
WP_010929704.1|2626536_2627238_+	DnaA regulatory inactivator Hda	NA	NA	NA	NA	NA
WP_010929703.1|2627234_2627933_+	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_010929702.1|2627933_2629289_+	polynucleotide adenylyltransferase PcnB	NA	A0A1B1IVF3	uncultured_Mediterranean_phage	36.8	3.4e-25
WP_010929701.1|2629285_2629777_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_003814351.1|2629795_2630752_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_003814355.1|2632162_2634265_-	TRAP transporter large permease subunit	NA	NA	NA	NA	NA
WP_003814356.1|2634435_2635479_+	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003814358.1|2635522_2636266_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003814363.1|2637287_2637698_-	4-carboxymuconolactone decarboxylase	NA	NA	NA	NA	NA
WP_010929700.1|2638647_2639445_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010930742.1|2639543_2640494_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013747.1|2640592_2641543_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010927663.1|2641539_2642490_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012067.1|2642576_2643527_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929681.1|2643641_2644643_-	HindIII family type II restriction endonuclease	NA	NA	NA	NA	NA
WP_010929682.1|2644733_2645300_-	preprotein translocase subunit SecD	NA	NA	NA	NA	NA
WP_010929683.1|2645618_2647532_+	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_010929684.1|2647573_2649004_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_019247308.1|2649116_2650529_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_003818947.1|2650545_2651241_-	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012808.1|2651459_2652410_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929687.1|2652434_2653334_-	virginiamycin B lyase	NA	NA	NA	NA	NA
WP_010929688.1|2653488_2654037_+	N-acetyltransferase	NA	A0A2H4J136	uncultured_Caudovirales_phage	41.7	1.2e-21
WP_010929689.1|2654075_2654795_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A0A0RPC6	Escherichia_phage	43.9	8.0e-50
WP_023994893.1|2654965_2657809_+	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_033446404.1|2658402_2661198_+|protease	serine protease autotransporter SphB1	protease	NA	NA	NA	NA
>prophage 20
NZ_CP015771	Bordetella pertussis strain UT25Sm1 chromosome, complete genome	4124767	2701612	2769436	4124767	tRNA,transposase	Bacillus_phage(22.22%)	58	NA	NA
WP_010929591.1|2701612_2702563_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003815898.1|2702769_2703246_+	bacterioferritin	NA	NA	NA	NA	NA
WP_010929663.1|2703327_2704011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003815895.1|2704035_2705643_-	peptide chain release factor 3	NA	A0A2K9L6L3	Tupanvirus	37.8	9.3e-14
WP_010929661.1|2705691_2706321_-	LysE family transporter	NA	NA	NA	NA	NA
WP_010929660.1|2706354_2707785_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	29.8	5.8e-44
WP_003815889.1|2708067_2708697_+	LemA family protein	NA	NA	NA	NA	NA
WP_010929659.1|2708674_2709577_+	YgcG family protein	NA	NA	NA	NA	NA
WP_005015810.1|2711020_2711971_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_023995348.1|2712529_2714083_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	A0A2N9QVT9	Dishui_lake_phycodnavirus	28.7	1.0e-33
WP_023853232.1|2714088_2714724_-	SCP-2 sterol transfer family protein	NA	NA	NA	NA	NA
WP_010929656.1|2714952_2715975_-	Tim44 domain-containing protein	NA	NA	NA	NA	NA
WP_003815111.1|2716140_2716917_-	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_003815113.1|2717080_2717779_+	phosphate regulon transcriptional regulatory protein PhoB	NA	W8CYM9	Bacillus_phage	37.1	8.6e-33
WP_010929655.1|2717790_2719101_+	phosphate regulon sensor histidine kinase PhoR	NA	A0A1V0SGX0	Hokovirus	25.5	6.2e-16
WP_010929654.1|2719156_2719834_+	heavy metal response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.2	1.5e-29
WP_010929653.1|2719830_2721228_+	heavy metal sensor histidine kinase	NA	NA	NA	NA	NA
WP_010929652.1|2721333_2721795_+	DUF411 domain-containing protein	NA	NA	NA	NA	NA
WP_023853237.1|2721898_2723098_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	42.6	3.1e-91
WP_010929650.1|2723149_2724025_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003815126.1|2724126_2724558_+	VOC family protein	NA	NA	NA	NA	NA
WP_010929649.1|2724582_2725311_+	5-oxoprolinase subunit PxpB	NA	NA	NA	NA	NA
WP_010929648.1|2725307_2726288_+	biotin-dependent carboxyltransferase	NA	NA	NA	NA	NA
WP_003815135.1|2727054_2727837_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010929647.1|2727955_2728927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019247545.1|2728998_2729757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019247546.1|2729775_2730219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003817676.1|2730239_2731052_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_010929646.1|2731057_2731990_+	alpha/beta hydrolase fold domain-containing protein	NA	NA	NA	NA	NA
WP_010929645.1|2731973_2733197_+	CoA transferase	NA	NA	NA	NA	NA
WP_010929644.1|2733284_2734067_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_019247146.1|2734119_2738082_-	FAD/FMN-binding oxidoreductase	NA	NA	NA	NA	NA
WP_003815155.1|2738828_2740337_+	threonine ammonia-lyase, biosynthetic	NA	NA	NA	NA	NA
WP_005012067.1|2740755_2741706_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929512.1|2742972_2743851_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023853394.1|2743878_2744163_-	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_023853393.1|2744273_2745713_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_010929640.1|2745711_2746359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010929639.1|2746785_2748486_+	2-isopropylmalate synthase	NA	NA	NA	NA	NA
WP_033446324.1|2748576_2749842_-	amidase	NA	NA	NA	NA	NA
WP_019247800.1|2750723_2751113_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_010929637.1|2751109_2752120_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_003815918.1|2752956_2753790_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_014905488.1|2753786_2754692_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.7	9.8e-21
WP_005012067.1|2754790_2755741_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929635.1|2755841_2756663_+	phosphodiesterase	NA	NA	NA	NA	NA
WP_010929634.1|2756768_2757809_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.7	6.0e-22
WP_010929633.1|2757851_2759144_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003815927.1|2759154_2760030_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_003815929.1|2760026_2760827_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_010930147.1|2760902_2761919_-|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
WP_003815930.1|2762201_2762519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003815933.1|2762609_2762957_-	DUF1840 domain-containing protein	NA	NA	NA	NA	NA
WP_023853376.1|2763244_2764927_+|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_010927242.1|2764936_2765620_+	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_010929628.1|2765681_2766311_+	thiol:disulfide interchange protein DsbA/DsbL	NA	NA	NA	NA	NA
WP_010929627.1|2766392_2767586_-	cystathionine beta-lyase	NA	NA	NA	NA	NA
WP_005012808.1|2768485_2769436_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 21
NZ_CP015771	Bordetella pertussis strain UT25Sm1 chromosome, complete genome	4124767	2797259	2833199	4124767	transposase	Sphingobium_phage(33.33%)	33	NA	NA
WP_041166334.1|2797259_2798204_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012067.1|2798278_2799229_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929607.1|2799225_2800635_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_010929606.1|2800740_2801583_+	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_003807805.1|2801584_2801836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003807804.1|2801924_2802506_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	54.3	1.7e-05
WP_010929605.1|2802537_2803158_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_010929604.1|2803319_2805227_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	37.2	1.1e-117
WP_003816713.1|2806419_2806734_-	DUF1153 domain-containing protein	NA	NA	NA	NA	NA
WP_005012808.1|2806827_2807778_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929603.1|2808199_2809381_+	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_019247832.1|2810010_2811282_+	TRAP transporter large permease	NA	NA	NA	NA	NA
WP_029443770.1|2811316_2812375_+	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	NA	NA	NA	NA
WP_010929600.1|2812493_2812796_+	Rieske 2Fe-2S domain-containing protein	NA	NA	NA	NA	NA
WP_010929599.1|2812808_2813390_+	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_019248755.1|2813446_2814421_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010929597.1|2814844_2815786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047122776.1|2815975_2816389_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010929595.1|2816388_2817615_+	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_010929584.1|2818415_2819366_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929594.1|2819459_2820359_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_023852650.1|2820438_2821200_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003817737.1|2821196_2821886_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_019247224.1|2821910_2822501_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.6	3.2e-20
WP_010929592.1|2822506_2823241_+	aspartate/glutamate racemase family protein	NA	NA	NA	NA	NA
WP_029443813.1|2824472_2825729_-	muropeptide transporter	NA	NA	NA	NA	NA
WP_010929591.1|2825771_2826722_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003817748.1|2826857_2827472_-	methionine biosynthesis protein MetW	NA	NA	NA	NA	NA
WP_010929590.1|2827468_2828716_-	homoserine O-acetyltransferase	NA	NA	NA	NA	NA
WP_003815255.1|2829885_2830779_-	membrane protein	NA	NA	NA	NA	NA
WP_003815265.1|2830906_2831143_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010929589.1|2831114_2831663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010930208.1|2832248_2833199_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 22
NZ_CP015771	Bordetella pertussis strain UT25Sm1 chromosome, complete genome	4124767	2887528	3025027	4124767	integrase,transposase,tRNA	Planktothrix_phage(13.04%)	113	2913965:2913986	3018699:3018720
WP_010931687.1|2887528_2888881_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
WP_003816050.1|2888997_2890584_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010931686.1|2890603_2891578_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_010931685.1|2891574_2892495_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_010931684.1|2892521_2893523_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.6	8.9e-15
WP_010931683.1|2893519_2894536_+	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_003816039.1|2894593_2895793_+	amidohydrolase	NA	NA	NA	NA	NA
WP_003816037.1|2895922_2896846_+	TauD/TfdA family dioxygenase	NA	NA	NA	NA	NA
WP_010931682.1|2896889_2897933_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010931681.1|2897934_2898750_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	40.4	6.1e-30
WP_010927255.1|2898746_2899628_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003816030.1|2899688_2901128_-	catalase	NA	A0A2K9L0T1	Tupanvirus	40.8	2.4e-106
WP_010929591.1|2901259_2902210_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_023853477.1|2902756_2903995_-	CoA transferase	NA	NA	NA	NA	NA
WP_003819309.1|2904076_2904856_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_023853465.1|2904852_2905836_-	hydroxymethylglutaryl-CoA lyase	NA	NA	NA	NA	NA
WP_003808010.1|2906033_2906720_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023853488.1|2906800_2907562_-	nitroreductase	NA	M1I6Q5	Acanthocystis_turfacea_Chlorella_virus	31.0	2.0e-19
WP_010931677.1|2907558_2908383_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_010931676.1|2908384_2909353_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010931675.1|2909375_2910788_-	MmgE/PrpD family protein	NA	NA	NA	NA	NA
WP_010931674.1|2910827_2911982_-	CoA transferase	NA	NA	NA	NA	NA
WP_077274100.1|2911971_2912994_-	CoA transferase	NA	NA	NA	NA	NA
WP_010929577.1|2912882_2913833_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
2913965:2913986	attL	CCGGGTGCCTGTCCCCGCCGGG	NA	NA	NA	NA
WP_003815086.1|2914015_2914789_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003815084.1|2914878_2915688_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_033446142.1|2915698_2916766_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_010931672.1|2920626_2921274_-	chemoreceptor glutamine deamidase CheD	NA	NA	NA	NA	NA
WP_010927126.1|2921485_2922394_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_003815073.1|2922390_2923062_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	38.2	9.5e-29
WP_003815070.1|2923380_2924397_+	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	42.1	1.0e-71
WP_003815068.1|2924516_2925707_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003815066.1|2925708_2926809_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003815064.1|2926863_2927604_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.7	4.4e-35
WP_010931671.1|2927724_2928747_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_003815061.1|2928746_2929214_+	membrane protein	NA	NA	NA	NA	NA
WP_010931670.1|2929232_2930759_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_010931669.1|2930745_2932203_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_003815055.1|2932300_2932489_+	DUF3460 family protein	NA	NA	NA	NA	NA
WP_003815053.1|2932515_2933403_+	segregation/condensation protein A	NA	NA	NA	NA	NA
WP_003815051.1|2933447_2934290_+	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_003815049.1|2934387_2934735_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003815047.1|2934817_2935561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003820519.1|2935801_2936641_+	prepilin peptidase	NA	NA	NA	NA	NA
WP_010931667.1|2936649_2937294_+	dephospho-CoA kinase	NA	NA	NA	NA	NA
WP_023853184.1|2937335_2938088_+	cell division protein ZapD	NA	NA	NA	NA	NA
WP_010931666.1|2938268_2939519_+	MdtA/MuxA family multidrug efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_010931665.1|2939515_2942584_+	MdtB/MuxB family multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_003815032.1|2942580_2945688_+	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_023994937.1|2945684_2947178_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_010929577.1|2947174_2948125_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010927663.1|2948223_2949174_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_003815027.1|2949274_2950237_-	Nudix family hydrolase	NA	A0A221LFJ1	Barns_Ness_breadcrumb_sponge_sobemo-like_virus	53.4	1.9e-06
WP_010931663.1|2950229_2951096_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_010931662.1|2951295_2952522_-	bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ	NA	NA	NA	NA	NA
WP_010929851.1|2952691_2953642_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_080478376.1|2953677_2954178_+	hypothetical protein	NA	Q3HQX1	Burkholderia_phage	71.3	1.0e-43
WP_005012067.1|2954164_2955115_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010926411.1|2955427_2955805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010926410.1|2955801_2955984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010929849.1|2955987_2956974_+	DNA recombinase	NA	H9C0R8	Aeromonas_phage	57.3	2.0e-67
WP_010929848.1|2956970_2957618_+	YqaJ viral recombinase family protein	NA	A0A0U2BXF3	Paracoccus_phage	41.4	2.0e-31
WP_010929847.1|2957675_2958203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019247983.1|2958239_2959424_+	hypothetical protein	NA	A0A291L9X3	Bordetella_phage	37.8	1.5e-24
WP_010929845.1|2959434_2959776_+	hypothetical protein	NA	A0A0H5ARN8	Pseudomonas_phage	45.3	1.0e-10
WP_010926403.1|2959888_2960089_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010929843.1|2960085_2961075_-|integrase	site-specific integrase	integrase	A0A1B1P9F9	Acinetobacter_phage	44.4	4.4e-75
WP_010929841.1|2962561_2964532_-	DUF3220 domain-containing protein	NA	NA	NA	NA	NA
WP_005012067.1|2964771_2965722_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814626.1|2965822_2966221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010929840.1|2966229_2967153_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012067.1|2967610_2968561_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010927254.1|2968791_2970483_-	membrane protein insertase YidC	NA	NA	NA	NA	NA
WP_003816027.1|2970531_2970804_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	52.2	7.0e-15
WP_003816026.1|2970800_2971172_-	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_003816025.1|2971267_2971402_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_010929554.1|2971807_2973217_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_010929839.1|2973219_2974329_+	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	32.6	1.2e-41
WP_010929838.1|2974423_2976877_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.8	2.3e-112
WP_023853625.1|2976995_2977787_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010929836.1|2977906_2979334_+	amidase	NA	NA	NA	NA	NA
WP_010929835.1|2979372_2980344_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010929834.1|2980762_2981926_+	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_010929833.1|2982013_2982859_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012067.1|2984415_2985366_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003818201.1|2985920_2986295_-	MerR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_010929807.1|2986369_2987428_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_010929591.1|2987451_2988402_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929808.1|2991283_2992453_+	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_003815953.1|2992553_2994161_+	methylcrotonoyl-CoA carboxylase	NA	A0A1B2ITV7	Pike_perch_iridovirus	57.3	5.4e-22
WP_010929810.1|2994207_2996229_+	acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha	NA	NA	NA	NA	NA
WP_003815955.1|2996257_2996503_-	DUF1653 domain-containing protein	NA	NA	NA	NA	NA
WP_057110655.1|2996516_2997707_-	acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.7	4.4e-21
WP_010929811.1|2997902_2998868_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010929812.1|2998890_3000030_-	DSD1 family PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_010929813.1|3000241_3001204_+	TAXI family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_010929814.1|3001327_3003352_+	TRAP transporter permease	NA	NA	NA	NA	NA
WP_010929815.1|3003548_3005792_+	TonB-dependent hemoglobin/transferrin/lactoferrin family receptor	NA	NA	NA	NA	NA
WP_003815964.1|3006070_3006529_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_010929816.1|3007456_3010078_-	DUF4401 domain-containing protein	NA	NA	NA	NA	NA
WP_010929817.1|3010141_3012769_+	DNA topoisomerase III	NA	A0A0G2YA05	Acanthamoeba_polyphaga_mimivirus	25.4	6.1e-23
WP_010929818.1|3012920_3013985_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_020699616.1|3013984_3014755_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.9	8.1e-24
WP_010929819.1|3014763_3015597_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003818225.1|3015609_3016389_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010929820.1|3016462_3017896_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_010929821.1|3017923_3018682_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_023853380.1|3018737_3020579_-	biosynthetic-type acetolactate synthase large subunit	NA	E4WLQ6	Ostreococcus_tauri_virus	30.4	2.2e-59
3018699:3018720	attR	CCGGGTGCCTGTCCCCGCCGGG	NA	NA	NA	NA
WP_010929823.1|3020681_3021158_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_023853391.1|3021174_3022095_-	bestrophin	NA	NA	NA	NA	NA
WP_003818232.1|3022201_3022702_+	SET domain-containing protein	NA	NA	NA	NA	NA
WP_010929826.1|3023075_3023768_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	41.6	6.3e-36
WP_005012067.1|3024076_3025027_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 23
NZ_CP015771	Bordetella pertussis strain UT25Sm1 chromosome, complete genome	4124767	3396193	3448946	4124767	tRNA,transposase	Pseudomonas_phage(11.11%)	43	NA	NA
WP_010929956.1|3396193_3397144_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929957.1|3397866_3399141_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_003807618.1|3399227_3400310_+	peptide chain release factor 1	NA	A0A0S4KWG0	Pseudomonas_phage	40.7	3.3e-07
WP_010929958.1|3400320_3401133_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_010929959.1|3401169_3401496_+	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_003807624.1|3401500_3402061_+	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_003819054.1|3402301_3403294_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010929960.1|3403312_3404308_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_023853194.1|3404323_3405700_+	FAD binding domain in molybdopterin dehydrogenase	NA	A0A0P0IVM8	Acinetobacter_phage	37.3	2.4e-18
WP_010929962.1|3405692_3408074_+	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	NA	NA	NA	NA
WP_019247263.1|3408090_3408480_+	SRPBCC family protein	NA	NA	NA	NA	NA
WP_020699695.1|3408606_3408837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|3408941_3409892_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929963.1|3409990_3410941_-	septal ring lytic transglycosylase RlpA family protein	NA	F5B3X9	Synechococcus_phage	47.2	6.9e-17
WP_003815183.1|3410937_3411810_-	RNase adapter RapZ	NA	A0A1P8D5W0	Corynebacterium_phage	34.5	2.4e-08
WP_010929964.1|3412740_3414027_+	cytochrome c	NA	NA	NA	NA	NA
WP_010929965.1|3414080_3415007_-	HPr kinase/phosphorylase	NA	NA	NA	NA	NA
WP_010929966.1|3415025_3415481_-	PTS transporter subunit EIIA	NA	NA	NA	NA	NA
WP_003815177.1|3416332_3417124_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.4	9.5e-20
WP_003815175.1|3417155_3417776_-	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_010929967.1|3417772_3418402_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_003815172.1|3418414_3419023_-	HAD-IIIA family hydrolase	NA	E3T535	Cafeteria_roenbergensis_virus	26.1	5.2e-10
WP_003815171.1|3419019_3420009_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	37.7	4.3e-38
WP_010929968.1|3420114_3421329_+	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_005012067.1|3423280_3424231_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929970.1|3425664_3426951_+	membrane protein	NA	NA	NA	NA	NA
WP_010929971.1|3427116_3427425_+	FmdB family transcriptional regulator	NA	NA	NA	NA	NA
WP_023852857.1|3427440_3428091_+	DUF502 domain-containing protein	NA	A0A2I7S9X1	Vibrio_phage	28.4	8.6e-11
WP_003807038.1|3428131_3429922_+|tRNA	aspartate--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	25.5	6.5e-08
WP_010929972.1|3430034_3430895_+	endonuclease	NA	NA	NA	NA	NA
WP_010929973.1|3430891_3432097_+	cardiolipin synthase ClsB	NA	NA	NA	NA	NA
WP_010929974.1|3432093_3432978_-	DMT family transporter	NA	NA	NA	NA	NA
WP_033446233.1|3434494_3434929_-	carbon monoxide dehydrogenase	NA	NA	NA	NA	NA
WP_014905478.1|3434891_3435890_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931408.1|3436001_3437147_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010931407.1|3437221_3438550_+	amidase	NA	NA	NA	NA	NA
WP_003815296.1|3438583_3439174_-	cysteine dioxygenase	NA	NA	NA	NA	NA
WP_023852623.1|3439487_3440258_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010931405.1|3441436_3442162_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_010931404.1|3442168_3443035_-	copper resistance protein B	NA	NA	NA	NA	NA
WP_029443756.1|3444865_3445363_-	cupredoxin family protein	NA	NA	NA	NA	NA
WP_005013747.1|3445659_3446610_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931400.1|3447995_3448946_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 24
NZ_CP015771	Bordetella pertussis strain UT25Sm1 chromosome, complete genome	4124767	3466064	3518471	4124767	tRNA,transposase	Acinetobacter_phage(37.5%)	48	NA	NA
WP_005012808.1|3466064_3467015_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931391.1|3467113_3469183_-	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	37.3	2.6e-101
WP_019247688.1|3469225_3471328_-	primosomal protein N'	NA	NA	NA	NA	NA
WP_010931389.1|3471634_3472711_-	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_010931388.1|3472786_3473671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003815341.1|3473853_3474276_-	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
WP_010931387.1|3474285_3475686_-	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_003817813.1|3475728_3476634_-	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_010931386.1|3476732_3478274_-	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_003815348.1|3478308_3478848_-	F0F1 ATP synthase subunit delta	NA	NA	NA	NA	NA
WP_010931385.1|3478860_3479331_-	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
WP_003815363.1|3479468_3479711_-	F0F1 ATP synthase subunit C	NA	NA	NA	NA	NA
WP_003815364.1|3479827_3480709_-	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_003815365.1|3480781_3481102_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_023852617.1|3481953_3482904_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_003815367.1|3484227_3485004_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_010931383.1|3485038_3486811_+	M61 family metallopeptidase	NA	NA	NA	NA	NA
WP_010931382.1|3486812_3487715_-	NAD(P)/FAD-dependent oxidoreductase	NA	G3MA85	Bacillus_virus	24.0	1.9e-08
WP_003817821.1|3487839_3488199_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_010931381.1|3488230_3489193_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	64.5	4.6e-93
WP_005012067.1|3489291_3490242_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931380.1|3490254_3491190_-	D-2-hydroxyacid dehydrogenase family protein	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	27.7	6.4e-15
WP_010931379.1|3491249_3492089_-	thiol:disulfide interchange protein DsbC	NA	NA	NA	NA	NA
WP_010931378.1|3492085_3493255_-	UbiH/UbiF family hydroxylase	NA	NA	NA	NA	NA
WP_003815379.1|3493251_3494541_-	murein transglycosylase A	NA	NA	NA	NA	NA
WP_003815381.1|3494583_3494958_-	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_023852620.1|3495072_3495801_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_010931377.1|3495808_3496513_+	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
WP_010931376.1|3496776_3498297_+	anthranilate synthase component I	NA	S4VT78	Pandoravirus	32.1	9.0e-43
WP_003815390.1|3498352_3498916_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	62.1	1.1e-65
WP_003817833.1|3498934_3499966_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	42.7	7.4e-73
WP_010931375.1|3499962_3500751_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	53.0	5.1e-66
WP_019247413.1|3500771_3500930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014905441.1|3500926_3501916_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012067.1|3503672_3504623_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931374.1|3505845_3506748_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003814312.1|3506749_3507604_-	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
WP_010931373.1|3507650_3508760_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_010931372.1|3508770_3509289_-	flavin reductase family protein	NA	NA	NA	NA	NA
WP_003814302.1|3509318_3509951_-	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_003814300.1|3510022_3510682_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_023852703.1|3510678_3511818_-	MFS transporter	NA	NA	NA	NA	NA
WP_019247745.1|3512167_3513040_+|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_010931370.1|3513195_3513933_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010931369.1|3513935_3515567_-	AMP-binding protein	NA	NA	NA	NA	NA
WP_010931368.1|3515662_3516652_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010927020.1|3516648_3517359_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010931363.1|3517454_3518471_-|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
>prophage 25
NZ_CP015771	Bordetella pertussis strain UT25Sm1 chromosome, complete genome	4124767	3536215	3581286	4124767	tRNA,transposase	Escherichia_phage(20.0%)	38	NA	NA
WP_010930525.1|3536215_3537232_+|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
WP_003814252.1|3537316_3537568_-	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_003814250.1|3537571_3538387_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_010931362.1|3538499_3539378_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_003820957.1|3539489_3541253_-|tRNA	glutamine--tRNA ligase/YqeY domain fusion protein	tRNA	A0A222YZ70	Escherichia_phage	50.0	5.0e-162
WP_010931361.1|3541368_3542709_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_010931360.1|3542705_3543761_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_010927010.1|3543777_3545202_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_003814239.1|3545201_3545903_-	response regulator	NA	W8CYM9	Bacillus_phage	36.6	5.6e-32
WP_010930179.1|3547407_3548358_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_023994844.1|3548453_3549425_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010931357.1|3549429_3550110_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_003814742.1|3550247_3550640_+	OsmC family protein	NA	NA	NA	NA	NA
WP_023994644.1|3550747_3551764_-|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
WP_003814739.1|3552003_3552789_-	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_010931356.1|3552883_3554293_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_010927090.1|3554303_3555104_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_010931355.1|3555124_3555895_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_010931354.1|3555937_3556405_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	50.7	5.6e-36
WP_005013747.1|3556401_3557352_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003818344.1|3559300_3560179_-	fatty acid desaturase	NA	NA	NA	NA	NA
WP_019247959.1|3561105_3564084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013747.1|3564437_3565388_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931353.1|3565384_3566473_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_010931352.1|3566508_3567372_-	3-alpha,7-alpha, 12-alpha-trihydroxy-5-beta-cholest-24-enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_010931351.1|3568511_3568901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014486103.1|3568904_3569687_-	crotonase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_047122778.1|3569720_3570506_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_010931349.1|3570781_3571921_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010931348.1|3571917_3572709_+	ATP-binding cassette domain-containing protein	NA	A0A1M7XV31	Cedratvirus	29.4	1.7e-08
WP_010931347.1|3572705_3573455_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.8	1.9e-09
WP_010931346.1|3573451_3574324_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_004566224.1|3574323_3575325_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003808195.1|3575321_3576485_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_003808193.1|3576510_3577194_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_019247312.1|3577147_3578482_+	AMP-binding protein	NA	NA	NA	NA	NA
WP_010931344.1|3578474_3579569_+	CoA transferase	NA	NA	NA	NA	NA
WP_005012067.1|3580335_3581286_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 26
NZ_CP015771	Bordetella pertussis strain UT25Sm1 chromosome, complete genome	4124767	3600197	3677506	4124767	tRNA,integrase,protease,transposase	Bacillus_phage(22.22%)	57	3647334:3647352	3667222:3667240
WP_023995489.1|3600197_3601148_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931335.1|3601246_3602722_-	M81 family metallopeptidase	NA	NA	NA	NA	NA
WP_010931334.1|3604309_3605197_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_010931333.1|3605199_3606141_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_010931332.1|3606186_3607752_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010931331.1|3609529_3610855_-	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_010931330.1|3611037_3612495_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	21.1	7.6e-15
WP_003816386.1|3612458_3612956_-	dihydrofolate reductase	NA	A0A140HLG8	Bacillus_phage	38.9	3.0e-24
WP_010931328.1|3612986_3613958_-	thymidylate synthase	NA	J7KKN7	Erwinia_phage	33.3	4.8e-50
WP_023994724.1|3614010_3614442_-	OsmC family protein	NA	NA	NA	NA	NA
WP_010931327.1|3614571_3615240_+	2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase	NA	NA	NA	NA	NA
WP_003808448.1|3615968_3617072_+	glycosyl transferase	NA	NA	NA	NA	NA
WP_010931326.1|3617177_3618452_+	Vi polysaccharide biosynthesis UDP-N-acetylglucosamine C-6 dehydrogenase TviB	NA	NA	NA	NA	NA
WP_010930472.1|3618463_3619489_+	Vi polysaccharide biosynthesis UDP-N-acetylglucosaminuronic acid C-4 epimerase TviC	NA	A0A2K9L4U8	Tupanvirus	44.2	4.7e-72
WP_010931325.1|3619490_3620861_+	membrane protein	NA	NA	NA	NA	NA
WP_010931324.1|3620861_3621998_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_010931323.1|3622044_3623970_+	asparagine synthase (glutamine-hydrolyzing)	NA	A0A2K9R7N5	Dishui_lake_phycodnavirus	29.0	1.0e-27
WP_010931322.1|3623966_3625088_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_010931321.1|3625084_3626239_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_010931320.1|3626235_3627366_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_003808462.1|3627373_3628939_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_010931319.1|3628945_3630328_-	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	31.6	6.2e-51
WP_003808465.1|3630606_3631218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010931317.1|3631309_3632725_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_003818936.1|3632742_3633453_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_010931316.1|3633449_3634772_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_023853096.1|3634917_3636813_+	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_003818932.1|3636938_3638252_-	fumarylacetoacetase	NA	NA	NA	NA	NA
WP_003818930.1|3638360_3639659_-	homogentisate 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_010931314.1|3639841_3640750_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003808487.1|3640759_3640969_-	DUF2783 domain-containing protein	NA	NA	NA	NA	NA
WP_003808489.1|3640980_3642660_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_010931313.1|3642761_3643715_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_010925978.1|3643805_3644633_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	NA	NA	NA	NA
WP_050818131.1|3644631_3646518_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_003818921.1|3646514_3647114_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_010931311.1|3647162_3648062_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
3647334:3647352	attL	CTGCCTGGCGTGGCCGAGT	NA	NA	NA	NA
WP_010931310.1|3648270_3649221_+	ribose-phosphate pyrophosphokinase	NA	A0A2K9L8D8	Tupanvirus	35.5	7.3e-43
WP_029443719.1|3649343_3649958_+	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_010931308.1|3650086_3650683_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_010931307.1|3650679_3651462_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_010931306.1|3651534_3652626_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_010931305.1|3652905_3654033_+|integrase	site-specific integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	33.6	1.4e-48
WP_010931304.1|3654374_3655421_+	Fic family protein	NA	NA	NA	NA	NA
WP_019247951.1|3655931_3658688_+	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_010931301.1|3661656_3662868_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_076879586.1|3662864_3663065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013747.1|3663051_3664002_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_077274087.1|3664018_3664513_+	DUF4276 family protein	NA	NA	NA	NA	NA
WP_019247740.1|3664516_3664774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019248455.1|3665317_3666229_+	UvrD-helicase domain-containing protein	NA	NA	NA	NA	NA
WP_029443992.1|3666310_3666595_+	ATP-dependent helicase	NA	A0A1V0SIN4	Klosneuvirus	34.1	6.8e-05
WP_010929591.1|3667378_3668329_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
3667222:3667240	attR	ACTCGGCCACGCCAGGCAG	NA	NA	NA	NA
WP_019247178.1|3668747_3671312_-	autotransporter domain-containing protein	NA	NA	NA	NA	NA
WP_019247179.1|3671356_3673210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014905963.1|3673542_3675114_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005012067.1|3676555_3677506_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 28
NZ_CP015771	Bordetella pertussis strain UT25Sm1 chromosome, complete genome	4124767	3794675	3858508	4124767	tRNA,protease,transposase	Pseudomonas_phage(30.0%)	54	NA	NA
WP_005012067.1|3794675_3795626_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012067.1|3795724_3796675_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931247.1|3796773_3797637_-	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_010931246.1|3797633_3798533_-	TonB family protein	NA	NA	NA	NA	NA
WP_014486102.1|3798570_3800454_-	RNB domain-containing ribonuclease	NA	NA	NA	NA	NA
WP_010931244.1|3800525_3801119_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_003814955.1|3801129_3802500_-	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_023853327.1|3802582_3803131_+	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_003814953.1|3803209_3803644_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_003814952.1|3803733_3804183_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_003814951.1|3804192_3805539_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_010931242.1|3806504_3807602_+	DUF3426 domain-containing protein	NA	NA	NA	NA	NA
WP_010931241.1|3807613_3808555_+	carbohydrate kinase family protein	NA	NA	NA	NA	NA
WP_010931240.1|3808727_3809231_+	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_003814943.1|3809511_3809751_+	acyl carrier protein	NA	NA	NA	NA	NA
WP_019248818.1|3809728_3810904_+	D-alanyl-lipoteichoic acid biosynthesis protein DltD	NA	NA	NA	NA	NA
WP_010931239.1|3811033_3812161_+	membrane-bound O-acyltransferase	NA	A0A125RNP0	Pseudomonas_phage	30.8	3.7e-25
WP_023853325.1|3812180_3813635_+	D-alanine--poly(phosphoribitol) ligase	NA	A0A2K9L3I8	Tupanvirus	25.1	7.3e-26
WP_023853329.1|3813642_3814203_-	YggT family protein	NA	NA	NA	NA	NA
WP_010931236.1|3814356_3814884_-	histone H1-like DNA-binding protein	NA	NA	NA	NA	NA
WP_003814929.1|3815201_3816398_-	ribonucleotide-diphosphate reductase subunit beta	NA	A0A2H4P762	Pseudomonas_phage	28.9	1.0e-33
WP_010931235.1|3816419_3819347_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2H4P767	Pseudomonas_phage	43.9	3.4e-171
WP_019247415.1|3819652_3822715_-	indolepyruvate ferredoxin oxidoreductase family protein	NA	NA	NA	NA	NA
WP_003814925.1|3823276_3823729_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_023998238.1|3823930_3824440_+	lipoprotein	NA	NA	NA	NA	NA
WP_010931233.1|3824508_3825696_+	MFS transporter	NA	NA	NA	NA	NA
WP_033446281.1|3825699_3827106_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_010931231.1|3827241_3829701_+	bifunctional acetate--CoA ligase family protein/GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005012067.1|3829697_3830648_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931229.1|3831716_3833213_+	membrane protein	NA	NA	NA	NA	NA
WP_003820592.1|3833329_3834718_+	ATP-dependent RNA helicase DbpA	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	33.5	4.6e-54
WP_003820593.1|3834823_3835213_+	VOC family protein	NA	NA	NA	NA	NA
WP_003820594.1|3835224_3835917_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_010931228.1|3835931_3836768_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_010931227.1|3836770_3837580_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.9	2.6e-33
WP_010931226.1|3838836_3839511_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_023853313.1|3839524_3840076_-	ribosome-associated protein	NA	NA	NA	NA	NA
WP_004567741.1|3840134_3841499_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_004567739.1|3841840_3842938_+	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010927106.1|3843233_3843662_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_010931224.1|3843671_3844064_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_003820599.1|3844252_3845317_+	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_010931223.1|3845353_3846100_+	membrane protein	NA	NA	NA	NA	NA
WP_003814883.1|3846187_3846559_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	56.9	4.7e-30
WP_010931222.1|3846628_3847765_-	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
WP_010931221.1|3847770_3849186_-	M23 family metallopeptidase	NA	A8ATH6	Listeria_phage	46.9	1.9e-18
WP_005012067.1|3849277_3850228_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814877.1|3850495_3851725_+|tRNA	tyrosine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003820605.1|3851760_3852417_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_003814873.1|3852636_3853884_+	serine hydroxymethyltransferase	NA	A0A219YCZ0	Aeromonas_phage	52.7	1.1e-99
WP_003814871.1|3854041_3854524_+	transcriptional repressor NrdR	NA	NA	NA	NA	NA
WP_023853315.1|3855518_3856082_-	isochorismatase family protein	NA	NA	NA	NA	NA
WP_047122802.1|3856287_3857412_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	33.3	3.8e-38
WP_005015810.1|3857557_3858508_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 29
NZ_CP015771	Bordetella pertussis strain UT25Sm1 chromosome, complete genome	4124767	3923469	3983122	4124767	transposase,tRNA	Bacillus_virus(25.0%)	56	NA	NA
WP_003813026.1|3923469_3924585_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_003813022.1|3924685_3925504_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_010931185.1|3925601_3926213_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_010931184.1|3926372_3927749_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	47.5	2.2e-109
WP_003813017.1|3927811_3928270_+	cytochrome c	NA	NA	NA	NA	NA
WP_003813013.1|3928354_3929050_-	cytochrome b561	NA	NA	NA	NA	NA
WP_003813010.1|3929111_3929393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010931182.1|3929955_3930708_+	DUF3053 domain-containing protein	NA	NA	NA	NA	NA
WP_003813006.1|3930752_3931829_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_005012067.1|3931825_3932776_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_014486100.1|3932878_3933541_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_019249309.1|3933635_3933806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003818702.1|3935162_3936359_+	CoA transferase	NA	NA	NA	NA	NA
WP_014486098.1|3936379_3937183_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_019247598.1|3937263_3937560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019247597.1|3937590_3938154_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014486097.1|3938194_3939052_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003818698.1|3939059_3939809_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.5	6.2e-29
WP_014486096.1|3939830_3940703_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_014486095.1|3940731_3941511_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_014486094.1|3941544_3942342_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003808978.1|3944996_3945389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024000675.1|3945382_3946243_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003818691.1|3946246_3947209_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_014486089.1|3947985_3948675_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.8	4.8e-12
WP_010930208.1|3949535_3950486_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931181.1|3950835_3951705_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010926062.1|3951775_3952471_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_010931179.1|3952460_3952970_+	nucleoside deaminase	NA	NA	NA	NA	NA
WP_010931178.1|3952966_3954187_+	MFS transporter	NA	NA	NA	NA	NA
WP_010931177.1|3954134_3955037_-	transcriptional regulator GcvA	NA	NA	NA	NA	NA
WP_023997744.1|3955923_3957210_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931176.1|3957248_3958622_+	amidase	NA	NA	NA	NA	NA
WP_010931175.1|3958660_3959362_-	riboflavin synthase	NA	NA	NA	NA	NA
WP_010931174.1|3959660_3960650_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_003809010.1|3960750_3961212_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_010931173.1|3961227_3961776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010931172.1|3961917_3963393_-	acyl--CoA ligase	NA	Q75ZG1	Hepacivirus	25.6	3.0e-35
WP_010931171.1|3963498_3964590_+	DUF2817 domain-containing protein	NA	NA	NA	NA	NA
WP_010931170.1|3964593_3965376_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_010931169.1|3965385_3966174_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	40.0	1.1e-33
WP_010931168.1|3967299_3967734_-	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_010931167.1|3967730_3968741_-	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_003809025.1|3968784_3969711_-	VOC family protein	NA	NA	NA	NA	NA
WP_003809026.1|3969997_3970366_+	DUF861 domain-containing protein	NA	NA	NA	NA	NA
WP_023853143.1|3970582_3971533_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013747.1|3971631_3972582_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931165.1|3972626_3975053_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	33.8	1.2e-86
WP_010931164.1|3975101_3975794_+	HD domain-containing protein	NA	A0A1D6Y7U0	Golden_Marseillevirus	29.9	4.7e-07
WP_010931163.1|3975866_3977066_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_003819549.1|3977083_3977989_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010931162.1|3978104_3979034_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_010931161.1|3979059_3980406_+	MFS transporter	NA	NA	NA	NA	NA
WP_019247888.1|3980418_3981183_+	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	26.5	3.1e-12
WP_010931159.1|3981196_3981979_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_005012067.1|3982171_3983122_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 30
NZ_CP015771	Bordetella pertussis strain UT25Sm1 chromosome, complete genome	4124767	3986673	4033956	4124767	transposase	Bacillus_virus(33.33%)	40	NA	NA
WP_010930176.1|3986673_3987624_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_019247492.1|3988009_3988552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|3989587_3990538_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_019247402.1|3990779_3991148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019248356.1|3991193_3992318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003820818.1|3993452_3994193_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010931155.1|3994296_3994917_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_076879634.1|3995020_3995971_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931154.1|3995967_3998076_-	AsmA family protein	NA	NA	NA	NA	NA
WP_023996698.1|3998220_3998832_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_003820813.1|3998911_3999376_-	redox-sensitive transcriptional activator SoxR	NA	NA	NA	NA	NA
WP_019248355.1|3999651_3999837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010931153.1|3999888_4000641_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_010931152.1|4000647_4001910_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_023852748.1|4001951_4003190_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_003820806.1|4004267_4005395_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.3	1.2e-23
WP_003814524.1|4005405_4006233_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_010931150.1|4006219_4007086_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_010931149.1|4008452_4008857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033446288.1|4009219_4010131_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_003820799.1|4010145_4010856_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010931147.1|4010852_4012097_+	DUF521 domain-containing protein	NA	NA	NA	NA	NA
WP_003820797.1|4012098_4012533_+	DUF126 domain-containing protein	NA	NA	NA	NA	NA
WP_003814535.1|4012561_4012867_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_005012067.1|4012965_4013916_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_023994659.1|4013972_4015121_-	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_010930176.1|4015201_4016152_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931144.1|4016683_4017481_-	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_019247918.1|4017528_4018182_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003814544.1|4018138_4019227_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	36.4	8.7e-32
WP_003814547.1|4019391_4021617_-	glycoside hydrolase family 31 protein	NA	NA	NA	NA	NA
WP_023852715.1|4023894_4024791_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_010929591.1|4024911_4025862_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931141.1|4025858_4027550_-	AMP-binding protein	NA	A0A2H4PQU7	Staphylococcus_phage	28.1	9.4e-33
WP_010931140.1|4027611_4028808_+	amidohydrolase	NA	NA	NA	NA	NA
WP_003814552.1|4028821_4029700_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010929220.1|4029806_4030853_+	YeiH family putative sulfate export transporter	NA	NA	NA	NA	NA
WP_003814554.1|4030916_4031327_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_003814555.1|4031337_4032810_+	magnesium transporter	NA	NA	NA	NA	NA
WP_005012067.1|4033005_4033956_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
