The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP015350	Bacillus thuringiensis strain MYBT18246 chromosome, complete genome	5867736	262525	270476	5867736		uncultured_virus(33.33%)	6	NA	NA
WP_000917311.1|262525_262810_+	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	54.8	1.2e-20
WP_001029992.1|262848_264483_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	57.8	1.3e-156
WP_141534831.1|264889_266428_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	31.2	2.6e-21
WP_000833096.1|266814_268140_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	29.4	4.1e-44
WP_000929891.1|268285_268987_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	7.3e-40
WP_000719239.1|268970_270476_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	30.8	5.4e-32
>prophage 2
NZ_CP015350	Bacillus thuringiensis strain MYBT18246 chromosome, complete genome	5867736	293831	302207	5867736		Synechococcus_phage(50.0%)	8	NA	NA
WP_000625682.1|293831_295139_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	25.3	4.9e-21
WP_001170549.1|295227_295947_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	G8EYA2	Synechococcus_phage	44.8	8.0e-50
WP_000278823.1|295939_296194_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_065481564.1|296190_296874_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_065481567.1|296857_299077_+	phosphoribosylformylglycinamidine synthase II	NA	A6N228	Microbacterium_phage	41.2	1.5e-163
WP_000879026.1|299061_300477_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.4	3.3e-55
WP_001262441.1|300582_301623_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	45.9	2.1e-67
WP_000088590.1|301619_302207_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	37.4	9.1e-28
>prophage 3
NZ_CP015350	Bacillus thuringiensis strain MYBT18246 chromosome, complete genome	5867736	326491	428673	5867736	transposase,tail,capsid,terminase,protease,portal,tRNA,integrase,head,plate	Bacillus_phage(62.5%)	114	389402:389430	431094:431122
WP_000086999.1|326491_326782_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_000051441.1|326797_328255_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_001047685.1|328269_329697_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_000977679.1|330256_331162_+	diacylglycerol kinase	NA	A0A1V0SBJ0	Catovirus	30.8	4.1e-27
WP_065481591.1|331302_332049_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_140157274.1|332128_333568_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	NA	NA	NA	NA
WP_000225140.1|333683_335051_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_065481594.1|335043_336495_+	NADP-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000263262.1|336542_336866_+	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_000915109.1|336998_337490_+	DUF4352 domain-containing protein	NA	NA	NA	NA	NA
WP_000007372.1|337535_338765_-	aminopeptidase	NA	NA	NA	NA	NA
WP_001233710.1|338881_339964_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_157686132.1|340501_340666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065481597.1|340652_341720_-|integrase	site-specific integrase	integrase	H0UST3	Bacillus_phage	76.6	1.1e-156
WP_065481602.1|342555_343686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065481605.1|343956_344139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065481608.1|344167_344509_-	helix-turn-helix transcriptional regulator	NA	A0A290GJU0	Caldibacillus_phage	35.3	1.7e-10
WP_065481611.1|344688_344898_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_065481613.1|344964_345153_+	helix-turn-helix transcriptional regulator	NA	W8CYN7	Bacillus_phage	88.7	6.3e-23
WP_065481615.1|345386_345620_+	hypothetical protein	NA	A0A0S2GLB6	Bacillus_phage	70.4	1.6e-20
WP_094194459.1|345605_346395_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_065481624.1|346814_347750_+	hypothetical protein	NA	S6C475	Thermus_phage	60.1	1.4e-102
WP_065481628.1|347764_347980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065481631.1|347979_348777_+	recombination protein RecT	NA	S6AVW6	Thermus_phage	64.3	3.0e-90
WP_065481634.1|348814_349687_+	hypothetical protein	NA	V9QKF6	Oenococcus_phage	41.2	7.7e-39
WP_065481638.1|349686_350988_+	AAA family ATPase	NA	A0A1B1P7G6	Bacillus_phage	42.6	5.2e-92
WP_157686133.1|351052_351256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065481645.1|351262_351688_+	DUF1064 domain-containing protein	NA	A0A2P1JTY5	Anoxybacillus_phage	51.9	2.1e-29
WP_065481648.1|351703_352411_+	2-methylcitrate dehydratase	NA	NA	NA	NA	NA
WP_094194460.1|352376_353117_+	zinc-finger domain-containing protein	NA	A0A2H4JAV2	uncultured_Caudovirales_phage	38.0	4.4e-11
WP_065486036.1|353126_353549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094194461.1|354026_354816_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_065481653.1|355197_355704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065481655.1|355812_356610_+	DNA-binding protein	NA	A0A1Q1PVZ8	Staphylococcus_phage	52.5	2.0e-73
WP_065481659.1|357003_357378_+	ArpU family transcriptional regulator	NA	D2XQ27	Bacillus_virus	34.4	3.2e-10
WP_065481663.1|357719_358481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094194462.1|359546_360715_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.0	1.2e-58
WP_065481672.1|360904_361141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094194463.1|361226_361556_+	HNH endonuclease	NA	A0A1S7FZ53	Listeria_phage	44.8	4.5e-16
WP_065481679.1|361558_361867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065486039.1|362177_362681_+	RNA polymerase subunit sigma-70	NA	A0A1B1P762	Bacillus_phage	37.1	3.7e-09
WP_094194464.1|362664_364335_+|terminase	terminase large subunit	terminase	A0A1B1P766	Bacillus_phage	57.9	3.0e-185
WP_065481685.1|364353_365592_+|portal	phage portal protein	portal	A0A1B1P754	Bacillus_phage	38.3	1.0e-73
WP_065481687.1|365533_366232_+|protease	Clp protease ClpP	protease	D2XR17	Bacillus_phage	46.8	4.3e-40
WP_065481689.1|366245_367367_+|capsid	phage major capsid protein	capsid	R4IBU5	Listeria_phage	49.7	5.2e-96
WP_065481691.1|367380_367692_+	hypothetical protein	NA	A0A1B1P751	Bacillus_phage	41.7	3.4e-13
WP_065481694.1|367691_368057_+|head,tail	phage head-tail adapter protein	head,tail	NA	NA	NA	NA
WP_065481696.1|368034_368415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065481699.1|368404_368815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065481701.1|368815_369385_+|tail	phage tail protein	tail	Q858W9	Listeria_phage	42.2	2.0e-35
WP_065481703.1|369444_369801_+	hypothetical protein	NA	A0A1S7FZ84	Listeria_phage	33.7	6.4e-08
WP_065481706.1|369983_373403_+	hypothetical protein	NA	A0A0S2SXL7	Bacillus_phage	37.3	6.9e-83
WP_065481709.1|373404_374088_+|tail	phage tail protein	tail	A0A1C8EA72	Bacillus_phage	67.3	1.7e-86
WP_065481711.1|374084_376424_+	endopeptidase	NA	A0A1C8E983	Bacillus_phage	89.3	0.0e+00
WP_065481712.1|376438_377527_+|plate	BppU family phage baseplate upper protein	plate	A0A1B1P768	Bacillus_phage	65.6	4.2e-135
WP_065481713.1|377647_377929_+	hypothetical protein	NA	D2XR31	Bacillus_phage	76.9	1.7e-32
WP_065481715.1|377931_378135_+	hypothetical protein	NA	D2XR32	Bacillus_phage	60.6	7.8e-19
WP_065481717.1|378195_379230_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A0A7AQV3	Bacillus_phage	74.9	7.5e-150
WP_065481720.1|379415_379631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094194466.1|379673_380463_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_065481729.1|380492_380738_-|transposase	DDE transposase family protein	transposase	NA	NA	NA	NA
WP_065481731.1|380855_381884_-	collagen-like repeat preface domain-containing protein	NA	NA	NA	NA	NA
WP_065481734.1|382501_383614_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_065481737.1|384617_385445_-	cytosolic protein	NA	A0A2H4J9W9	uncultured_Caudovirales_phage	79.8	1.1e-100
WP_065486040.1|385803_386400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001200491.1|386446_387643_-	NupC family nucleoside transporter	NA	NA	NA	NA	NA
WP_065481740.1|388068_389448_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	46.7	8.5e-117
389402:389430	attL	ATACGACGCATGTGGAGTGTGTGGCTTGG	NA	NA	NA	NA
WP_065481742.1|389506_390631_-|integrase	site-specific integrase	integrase	A0A1B0T6A8	Bacillus_phage	97.6	1.1e-210
WP_094194467.1|391156_391946_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_065481749.1|393759_394899_+	hypothetical protein	NA	H0UST6	Bacillus_phage	36.3	2.5e-61
WP_065481751.1|395186_395372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065481753.1|395382_395730_-	helix-turn-helix transcriptional regulator	NA	S5MUA5	Brevibacillus_phage	38.3	3.9e-10
WP_065481756.1|396887_397238_+	helix-turn-helix domain-containing protein	NA	A0A1B0T6C2	Bacillus_phage	77.6	2.5e-49
WP_065486042.1|397237_397429_+	hypothetical protein	NA	A0A0U3B230	Bacillus_phage	68.5	4.1e-14
WP_065481512.1|398550_399807_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	60.2	5.8e-112
WP_139359406.1|399933_400026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094194468.1|400213_401089_+	ATP-binding protein	NA	A0A0U4K4W7	Exiguobacterium_phage	30.0	6.2e-12
WP_065481758.1|401122_401317_+	hypothetical protein	NA	A0A0U3K3J8	Bacillus_phage	78.1	1.8e-20
WP_065481760.1|401333_401612_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	57.6	7.4e-12
WP_065481763.1|401604_401964_+	cell division protein SepF	NA	A0A1B1P7A1	Bacillus_phage	53.3	5.4e-31
WP_065481766.1|401984_402152_+	DUF3954 domain-containing protein	NA	A0A1B0T6B8	Bacillus_phage	60.4	1.5e-12
WP_065481767.1|402177_402429_+	hypothetical protein	NA	A0A0K2CNP4	Brevibacillus_phage	42.2	6.5e-07
WP_065481768.1|402783_403182_+	hypothetical protein	NA	A0A1B0T6B6	Bacillus_phage	90.9	1.7e-62
WP_065481769.1|405234_405450_-	spore germination protein	NA	A0A2H4J3A3	uncultured_Caudovirales_phage	79.1	5.5e-23
WP_157686134.1|405620_405734_+	DUF3983 domain-containing protein	NA	A0A1B1P7V8	Bacillus_phage	78.4	2.6e-08
WP_065481770.1|406053_406542_+	ArpU family transcriptional regulator	NA	A0A1B0T6C9	Bacillus_phage	84.5	3.7e-75
WP_094194470.1|406538_406838_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0T6D2	Bacillus_phage	91.9	7.7e-31
WP_065481734.1|407110_408223_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_094194471.1|408328_408655_+|integrase	tyrosine-type recombinase/integrase	integrase	H0USV4	Bacillus_phage	95.3	7.3e-51
WP_094194472.1|408862_409108_+	hypothetical protein	NA	A0A1B0T6C4	Bacillus_phage	75.3	9.0e-30
WP_065481772.1|409461_409677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065481775.1|409776_409995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065481778.1|410054_410378_+	hypothetical protein	NA	A0A1B1P7N8	Bacillus_phage	56.8	9.5e-19
WP_065481781.1|410374_410749_+	HNH endonuclease	NA	A0A1C8E9C7	Bacillus_phage	87.8	5.0e-64
WP_065481783.1|410852_411278_+|terminase	P27 family phage terminase small subunit	terminase	A0A1B0T688	Bacillus_phage	87.9	4.4e-64
WP_065481785.1|411274_412999_+|terminase	terminase large subunit	terminase	A0A1B0T685	Bacillus_phage	90.1	3.6e-306
WP_065481788.1|413014_414199_+|portal	phage portal protein	portal	A0A2H4JBS9	uncultured_Caudovirales_phage	95.2	7.6e-215
WP_065481793.1|414188_414770_+|head,protease	HK97 family phage prohead protease	head,protease	A0A1B1P7P1	Bacillus_phage	87.4	1.3e-87
WP_065481795.1|414771_416091_+|capsid	phage major capsid protein	capsid	A0A1C8E976	Bacillus_phage	95.9	3.2e-182
WP_065481798.1|416159_416450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065481800.1|416464_416722_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4J865	uncultured_Caudovirales_phage	80.0	1.2e-32
WP_065481802.1|416702_417035_+	hypothetical protein	NA	A0A1C8E986	Bacillus_phage	88.0	1.2e-48
WP_065481804.1|417024_417354_+	hypothetical protein	NA	A0A1C8E981	Bacillus_phage	81.7	4.2e-46
WP_065481807.1|417353_417731_+	hypothetical protein	NA	A0A2H4JDG0	uncultured_Caudovirales_phage	82.4	6.9e-53
WP_065481810.1|417743_418370_+|tail	phage tail protein	tail	A0A1B1P7Q4	Bacillus_phage	86.5	1.3e-101
WP_065481813.1|418387_418774_+	hypothetical protein	NA	A0A2H4J956	uncultured_Caudovirales_phage	84.4	5.8e-55
WP_065481814.1|419017_422311_+|tail	phage tail tape measure protein	tail	A0A1B0T698	Bacillus_phage	81.1	1.1e-295
WP_065481816.1|422311_422995_+|tail	phage tail protein	tail	A0A1B0T6A0	Bacillus_phage	87.2	7.4e-114
WP_065481819.1|422991_425355_+	endopeptidase	NA	A0A1B0T695	Bacillus_phage	92.0	0.0e+00
WP_065481821.1|426649_426871_+	hypothetical protein	NA	A0A1B1P780	Bacillus_phage	85.9	1.8e-24
WP_065486045.1|426931_427132_+	hypothetical protein	NA	A0A1B2APY8	Phage_Wrath	56.1	1.8e-12
WP_065481824.1|427134_427344_+	hypothetical protein	NA	A0A0S2GM50	Bacillus_phage	63.6	2.7e-19
WP_065481826.1|427418_428441_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A0A7AQV3	Bacillus_phage	71.7	7.2e-145
WP_065481828.1|428478_428673_-	hypothetical protein	NA	A0A1B0T6A3	Bacillus_phage	82.5	7.4e-19
431094:431122	attR	ATACGACGCATGTGGAGTGTGTGGCTTGG	NA	NA	NA	NA
>prophage 4
NZ_CP015350	Bacillus thuringiensis strain MYBT18246 chromosome, complete genome	5867736	611375	679455	5867736	transposase,tail,capsid,terminase,protease,portal,tRNA,integrase,head,plate	Bacillus_phage(71.79%)	60	609239:609259	687738:687758
609239:609259	attL	CTGATTAAAGTTTCACTTTAT	NA	NA	NA	NA
WP_065481944.1|611375_612518_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_000279323.1|612562_613450_+	amidase domain-containing protein	NA	NA	NA	NA	NA
WP_000538147.1|613508_613997_+|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_065481947.1|614124_616194_+	phosphodiesterase	NA	NA	NA	NA	NA
WP_000353273.1|616586_618482_+	PrkA family serine protein kinase	NA	A0MN77	Thermus_phage	35.8	1.2e-100
WP_000503516.1|618934_620110_+	sporulation protein YhbH	NA	A0A140HLI1	Bacillus_phage	43.9	1.5e-24
WP_065481734.1|621132_622245_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_000289526.1|626053_626917_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_065481956.1|627018_628569_-	glycine betaine transporter OpuD	NA	A0A2I7QNT1	Vibrio_phage	25.6	8.9e-22
WP_065481958.1|628815_631701_+	PKD domain-containing protein	NA	NA	NA	NA	NA
WP_065481960.1|631708_632872_-|integrase	site-specific integrase	integrase	A0A0M5M609	Bacillus_phage	70.9	3.3e-162
WP_065481962.1|632939_633365_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A1C8E988	Bacillus_phage	93.6	8.8e-73
WP_061656788.1|633380_633803_-	helix-turn-helix transcriptional regulator	NA	A0A1C8E9A4	Bacillus_phage	89.3	3.3e-64
WP_065481965.1|634127_634262_+	helix-turn-helix transcriptional regulator	NA	A0A0M3ULF9	Bacillus_phage	79.5	8.2e-09
WP_065481968.1|634261_634534_+	DUF771 domain-containing protein	NA	A0A1C8E9B3	Bacillus_phage	87.8	2.0e-41
WP_065481971.1|634593_634785_+	hypothetical protein	NA	A0A1B1P7M3	Bacillus_phage	68.0	1.7e-07
WP_065481973.1|634759_635110_+	hypothetical protein	NA	A0A2H4JBP9	uncultured_Caudovirales_phage	86.2	1.7e-50
WP_157686137.1|635272_635584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065481985.1|635580_635814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065481986.1|635776_636460_+	AAA family ATPase	NA	A0A1B2AQ06	Phage_Wrath	87.6	2.1e-108
WP_065481988.1|636452_636977_+	hypothetical protein	NA	A0A0C5K996	Enterococcus_phage	45.3	1.6e-36
WP_065481997.1|637169_638288_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_065482000.1|638653_639052_+	DUF669 domain-containing protein	NA	A0A1B2AQ07	Phage_Wrath	46.3	1.1e-19
WP_065482002.1|641749_641977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065482004.1|641964_642399_+	hypothetical protein	NA	A0A2H4JFQ6	uncultured_Caudovirales_phage	63.8	1.0e-52
WP_065482005.1|643324_643708_+	hypothetical protein	NA	A0A288WFT8	Bacillus_phage	75.8	8.0e-49
WP_065482006.1|643838_644720_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	E9P639	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	27.2	7.3e-21
WP_065482007.1|644792_645095_+	hypothetical protein	NA	A0A1B0T6C6	Bacillus_phage	85.6	3.0e-43
WP_065482010.1|645091_645484_+	HNH endonuclease	NA	A0A1B0T6C5	Bacillus_phage	94.6	1.5e-71
WP_065482012.1|645566_645992_+|terminase	P27 family phage terminase small subunit	terminase	A0A1C8E969	Bacillus_phage	97.2	3.7e-71
WP_065482016.1|645988_647713_+|terminase	terminase large subunit	terminase	A0A1C8E985	Bacillus_phage	99.3	0.0e+00
WP_065482019.1|647728_648901_+|portal	phage portal protein	portal	A0A1C8E972	Bacillus_phage	99.0	4.6e-220
WP_065482021.1|649069_649327_-	hypothetical protein	NA	A0A1C8E966	Bacillus_phage	74.1	2.8e-29
WP_065482024.1|649399_649981_+|head,protease	HK97 family phage prohead protease	head,protease	A0A1C8EA63	Bacillus_phage	95.3	4.6e-96
WP_065482026.1|649982_651293_+|capsid	phage major capsid protein	capsid	A0A1C8E976	Bacillus_phage	90.9	6.7e-196
WP_065482029.1|651361_651670_+	collagen-like protein	NA	NA	NA	NA	NA
WP_065482031.1|651684_651945_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1B2APX3	Phage_Wrath	86.0	3.6e-37
WP_065482034.1|651922_652255_+|head,tail	head-tail adaptor protein	head,tail	A0A2H4J9Y9	uncultured_Caudovirales_phage	87.2	4.5e-48
WP_016125429.1|652244_652574_+	hypothetical protein	NA	A0A1C8E981	Bacillus_phage	91.7	9.3e-54
WP_065482037.1|652573_652951_+	HK97 gp10 family phage protein	NA	A0A1C8E995	Bacillus_phage	97.6	5.6e-63
WP_065482040.1|652962_653619_+|tail	phage tail protein	tail	A0A1B1P7Q4	Bacillus_phage	88.2	4.6e-105
WP_065482043.1|653630_654017_+	hypothetical protein	NA	A0A1C8E984	Bacillus_phage	96.9	1.4e-64
WP_006927278.1|654055_654244_+	hypothetical protein	NA	A0A1C8E979	Bacillus_phage	98.4	8.2e-31
WP_065482046.1|654260_657554_+|tail	phage tail tape measure protein	tail	A0A1B1P7P9	Bacillus_phage	85.6	0.0e+00
WP_065482050.1|657554_658238_+|tail	phage tail protein	tail	A0A1B0T6A0	Bacillus_phage	96.9	2.2e-126
WP_065482053.1|658234_660577_+	endopeptidase	NA	A0A1B0T695	Bacillus_phage	95.6	0.0e+00
WP_065482056.1|660591_661737_+|plate	BppU family phage baseplate upper protein	plate	A0A1B1P768	Bacillus_phage	53.7	7.1e-101
WP_065482059.1|661800_662001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065482062.1|662004_662208_+	hypothetical protein	NA	A0A1B1P886	Bacillus_phage	63.3	8.6e-18
WP_065482065.1|663524_665075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065482087.1|665087_667499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065482090.1|667981_668290_-	hypothetical protein	NA	A0A0S2GLF3	Bacillus_phage	68.7	7.9e-31
WP_065482093.1|668411_669464_-	cytosolic protein	NA	A0A0S2MVF4	Bacillus_phage	46.7	3.9e-13
WP_063546389.1|670173_670722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000154998.1|670734_672303_+	flotillin family protein	NA	NA	NA	NA	NA
WP_000486195.1|672551_674528_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	51.4	8.4e-17
WP_003269387.1|674672_676280_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_000503464.1|676282_676975_+	response regulator	NA	NA	NA	NA	NA
WP_000880477.1|677021_678326_-	CitMHS family transporter	NA	NA	NA	NA	NA
WP_094194452.1|678665_679455_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
687738:687758	attR	ATAAAGTGAAACTTTAATCAG	NA	NA	NA	NA
>prophage 5
NZ_CP015350	Bacillus thuringiensis strain MYBT18246 chromosome, complete genome	5867736	929352	983466	5867736	transposase,coat	Bacillus_phage(30.0%)	59	NA	NA
WP_000265278.1|929352_929922_-|coat	spore coat protein CotJC	coat	NA	NA	NA	NA
WP_001076510.1|929934_930198_-|coat	spore coat protein CotJB	coat	NA	NA	NA	NA
WP_001046257.1|930206_930422_-|coat	spore coat associated protein CotJA	coat	NA	NA	NA	NA
WP_120460775.1|930470_930884_+	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_023521229.1|930898_931678_+	DUF2935 domain-containing protein	NA	A0A2I2L551	Orpheovirus	35.2	5.3e-39
WP_023521230.1|931696_932509_-	Ku protein	NA	A0A249XRB2	Mycobacterium_phage	31.9	1.4e-29
WP_000733842.1|932861_933143_+	DUF1232 domain-containing protein	NA	NA	NA	NA	NA
WP_023521232.1|933154_933760_+	DedA family protein	NA	NA	NA	NA	NA
WP_001277540.1|933858_934227_+	DUF3992 domain-containing protein	NA	NA	NA	NA	NA
WP_000525819.1|934247_934592_+	DUF3992 domain-containing protein	NA	NA	NA	NA	NA
WP_080672344.1|934648_935074_-	DUF3992 domain-containing protein	NA	NA	NA	NA	NA
WP_023521234.1|935426_937886_+	Purple acid phosphatase/fibronectin domain protein	NA	NA	NA	NA	NA
WP_000435797.1|937965_938169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000838715.1|938380_939784_-	amino acid permease	NA	NA	NA	NA	NA
WP_120460771.1|939954_941166_+	cation:proton antiporter	NA	NA	NA	NA	NA
WP_065482290.1|941290_941605_+	outer surface protein	NA	NA	NA	NA	NA
WP_000648159.1|941634_942498_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_065481734.1|942754_943867_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_000892345.1|944227_945112_+	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_065482293.1|945136_946501_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_023521237.1|946549_947623_+	DUF871 domain-containing protein	NA	NA	NA	NA	NA
WP_001077751.1|947775_948180_+	DoxX family protein	NA	NA	NA	NA	NA
WP_065482296.1|948334_948736_+	DUF4440 domain-containing protein	NA	NA	NA	NA	NA
WP_023521239.1|948735_949221_+	PRK06770 family protein	NA	G3MB13	Bacillus_virus	28.5	1.6e-09
WP_065482299.1|949255_950167_-	DMT family transporter	NA	NA	NA	NA	NA
WP_023521241.1|950372_950867_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_023521242.1|950995_951451_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_065482302.1|951531_952302_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000288069.1|952436_952796_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000796022.1|953184_953529_+	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_000539671.1|953531_953846_+	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_065482304.1|953997_954576_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000742953.1|954788_955991_+	tetracycline resistance MFS efflux pump	NA	NA	NA	NA	NA
WP_065482306.1|956024_956363_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_065482309.1|956532_957072_+	ester cyclase	NA	NA	NA	NA	NA
WP_065482312.1|957095_957644_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_016078064.1|957760_957964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000037549.1|958275_958791_-	type 1 glutamine amidotransferase	NA	NA	NA	NA	NA
WP_065482315.1|958814_960812_-	catalase	NA	A0A2K9L572	Tupanvirus	51.1	2.2e-150
WP_065482317.1|961086_962286_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_001186293.1|962346_963771_-	amino acid permease	NA	NA	NA	NA	NA
WP_153578374.1|963949_964111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000109671.1|964300_965131_+	glutamate racemase	NA	NA	NA	NA	NA
WP_000423688.1|965243_966329_+	DUF3626 domain-containing protein	NA	A0A2H4UV60	Bodo_saltans_virus	24.3	2.5e-07
WP_000213616.1|966408_967848_-	NADP-dependent glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_000953768.1|968461_970222_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	27.7	3.5e-46
WP_065482319.1|970218_972219_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.2	3.2e-40
WP_000732858.1|972513_973311_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000281502.1|973297_973996_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_065482322.1|974024_974759_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	45.3	2.6e-40
WP_000013339.1|974810_975014_-	small acid-soluble spore protein, SasP family	NA	Q77YX0	Bacillus_phage	65.1	6.1e-16
WP_000510477.1|975469_975715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000658108.1|975734_977192_-	YheC/YheD family protein	NA	NA	NA	NA	NA
WP_000242799.1|977212_978265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139359406.1|978451_978544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065481512.1|978670_979927_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	60.2	5.8e-112
WP_065486048.1|980179_981313_+	DUF445 domain-containing protein	NA	NA	NA	NA	NA
WP_000164614.1|981455_981812_+	YlbF/YmcA family competence regulator	NA	NA	NA	NA	NA
WP_094194456.1|982422_983466_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP015350	Bacillus thuringiensis strain MYBT18246 chromosome, complete genome	5867736	1219561	1282176	5867736	transposase,tail,capsid,terminase,protease,portal,head,plate	Bacillus_phage(51.35%)	68	NA	NA
WP_065482552.1|1219561_1220410_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_065482555.1|1220411_1220768_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016082517.1|1220799_1221099_+	DUF2101 family protein	NA	NA	NA	NA	NA
WP_065482557.1|1221339_1222608_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_063535862.1|1222742_1224470_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	47.0	1.6e-11
WP_000727104.1|1225091_1225748_+	S-layer homology domain-containing protein	NA	A0A0E3DEP6	Bacillus_phage	23.9	3.7e-09
WP_113304420.1|1225886_1226654_+	S-layer homology domain-containing protein	NA	NA	NA	NA	NA
WP_065482560.1|1226873_1228463_+	malate synthase A	NA	NA	NA	NA	NA
WP_000787341.1|1228486_1229764_+	isocitrate lyase	NA	NA	NA	NA	NA
WP_065482563.1|1229873_1230665_-	phosphotransferase	NA	NA	NA	NA	NA
WP_001060338.1|1230684_1231179_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000301523.1|1231462_1231666_+	RNA chaperone/antiterminator CspA	NA	Q9AZD3	Lactococcus_phage	64.5	5.6e-17
WP_000356914.1|1231865_1232069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000659558.1|1232415_1232601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000444444.1|1232885_1233467_+	competence protein	NA	NA	NA	NA	NA
WP_000347517.1|1233840_1234434_+	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_065482566.1|1234490_1235054_+	signal peptidase I	NA	NA	NA	NA	NA
WP_065482570.1|1235170_1238686_+	helicase-exonuclease AddAB subunit AddB	NA	NA	NA	NA	NA
WP_065482573.1|1238682_1242408_+	helicase-exonuclease AddAB subunit AddA	NA	G3MA40	Bacillus_virus	25.1	7.6e-19
WP_000255723.1|1242420_1242708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001141570.1|1242845_1243061_-	spore germination protein GerPF	NA	A0A2H4J3A3	uncultured_Caudovirales_phage	82.4	1.5e-25
WP_063546774.1|1243103_1243490_-	spore germination protein GerPE	NA	NA	NA	NA	NA
WP_001052807.1|1243505_1243700_-	spore germination protein GerPD	NA	NA	NA	NA	NA
WP_063546776.1|1243706_1244321_-	spore germination protein GerPC	NA	NA	NA	NA	NA
WP_001012508.1|1244388_1244595_-	spore germination protein GerPB	NA	NA	NA	NA	NA
WP_001111187.1|1244609_1244831_-	spore germination protein GerPA	NA	NA	NA	NA	NA
WP_000462857.1|1244927_1245107_-	aspartyl-phosphate phosphatase Spo0E family protein	NA	NA	NA	NA	NA
WP_120461128.1|1245351_1246254_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_000926859.1|1246288_1246570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000616660.1|1246680_1247871_-	ornithine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	27.7	1.9e-27
WP_000233495.1|1248021_1248390_+	YisL family protein	NA	NA	NA	NA	NA
WP_000616066.1|1248445_1249000_-	DUF2777 domain-containing protein	NA	NA	NA	NA	NA
WP_065482576.1|1249238_1251017_+	asparagine synthase (glutamine-hydrolyzing)	NA	A0A1V0SGM7	Hokovirus	27.1	6.0e-22
WP_065482579.1|1251047_1252451_-	recombinase family protein	NA	A0A2I7SDG6	Paenibacillus_phage	44.8	1.8e-114
WP_000289676.1|1252563_1252782_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_065482581.1|1252797_1253481_-	LexA family transcriptional regulator	NA	A0A2I6PF08	Staphylococcus_phage	30.7	3.8e-17
WP_065482584.1|1253631_1253904_+	helix-turn-helix transcriptional regulator	NA	A0A141E0W0	Streptococcus_phage	50.0	2.3e-10
WP_065482587.1|1254196_1254388_+	hypothetical protein	NA	A0A1B1P7M3	Bacillus_phage	68.0	1.7e-07
WP_065482590.1|1254362_1254713_+	hypothetical protein	NA	A0A2H4JBP9	uncultured_Caudovirales_phage	84.5	8.6e-50
WP_065482597.1|1255183_1255381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065482600.1|1255382_1256066_+	AAA family ATPase	NA	A0A1B2AQ06	Phage_Wrath	89.4	1.1e-109
WP_065482603.1|1256150_1256597_+	hypothetical protein	NA	A0A2K9V4F4	Staphylococcus_phage	52.1	6.7e-31
WP_065482606.1|1257170_1259525_+	DNA primase	NA	A0A1B2AQ05	Phage_Wrath	78.1	0.0e+00
WP_157686141.1|1259784_1260018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065482612.1|1260005_1260434_+	hypothetical protein	NA	A0A2H4JFQ6	uncultured_Caudovirales_phage	71.8	9.5e-59
WP_065482613.1|1260436_1260967_+	nuclease	NA	A0A0S2SXQ1	Bacillus_phage	53.2	4.7e-47
WP_065482005.1|1261368_1261752_+	hypothetical protein	NA	A0A288WFT8	Bacillus_phage	75.8	8.0e-49
WP_065482615.1|1261882_1262764_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	E9P639	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	27.2	2.8e-20
WP_065482619.1|1262836_1263151_+	hypothetical protein	NA	A0A1B0T6C6	Bacillus_phage	88.5	2.8e-47
WP_065482622.1|1263147_1263540_+	HNH endonuclease	NA	A0A1B0T6C5	Bacillus_phage	96.2	2.1e-73
WP_065482625.1|1263622_1264048_+|terminase	P27 family phage terminase small subunit	terminase	A0A1B0T688	Bacillus_phage	88.6	5.2e-65
WP_065482633.1|1267043_1268228_+|portal	phage portal protein	portal	A0A2H4JBS9	uncultured_Caudovirales_phage	95.4	2.2e-214
WP_065482636.1|1268217_1268799_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4J861	uncultured_Caudovirales_phage	88.5	2.4e-89
WP_065482639.1|1268800_1270117_+|capsid	phage major capsid protein	capsid	A0A1C8E976	Bacillus_phage	95.4	1.7e-175
WP_065482642.1|1270184_1270484_+	collagen-like protein	NA	NA	NA	NA	NA
WP_065482645.1|1270498_1270756_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1C8E967	Bacillus_phage	83.5	5.7e-35
WP_065482648.1|1270736_1271069_+	hypothetical protein	NA	A0A1C8E986	Bacillus_phage	85.2	1.7e-47
WP_065482650.1|1271058_1271388_+	hypothetical protein	NA	A0A1B0T6B7	Bacillus_phage	85.3	8.4e-47
WP_065482653.1|1271387_1271765_+	HK97 gp10 family phage protein	NA	A0A1C8E995	Bacillus_phage	82.4	1.5e-52
WP_065482656.1|1271777_1272422_+|tail	phage tail protein	tail	A0A1B1P7Q4	Bacillus_phage	86.6	1.2e-102
WP_065482659.1|1272440_1272827_+	hypothetical protein	NA	A0A2H4J956	uncultured_Caudovirales_phage	82.8	1.1e-53
WP_065482662.1|1273070_1276361_+|tail	phage tail tape measure protein	tail	A0A1B1P7P9	Bacillus_phage	79.0	6.9e-290
WP_065482663.1|1276362_1277046_+|tail	phage tail protein	tail	A0A1C8EA72	Bacillus_phage	77.4	5.9e-103
WP_065482665.1|1277042_1279469_+	endopeptidase	NA	A0A1B1P770	Bacillus_phage	81.9	0.0e+00
WP_065482667.1|1279458_1280613_+|plate	BppU family phage baseplate upper protein	plate	A0A1B1P768	Bacillus_phage	52.9	6.5e-102
WP_065482059.1|1280676_1280877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065482062.1|1280880_1281084_+	hypothetical protein	NA	A0A1B1P886	Bacillus_phage	63.3	8.6e-18
WP_065482672.1|1281141_1282176_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A0A7AQV3	Bacillus_phage	74.6	2.6e-150
>prophage 7
NZ_CP015350	Bacillus thuringiensis strain MYBT18246 chromosome, complete genome	5867736	2006686	2013588	5867736		Bacillus_phage(83.33%)	7	NA	NA
WP_053564725.1|2006686_2008447_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	98.2	1.1e-273
WP_000612415.1|2008487_2009165_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	99.6	3.0e-123
WP_065483250.1|2009161_2010235_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	96.4	4.8e-184
WP_071731001.1|2010259_2010853_-	DUF3139 domain-containing protein	NA	NA	NA	NA	NA
WP_000818985.1|2011043_2011763_+	3-ketoacyl-ACP reductase	NA	W8CYX9	Bacillus_phage	100.0	5.9e-61
WP_000014165.1|2011910_2012582_+	O-methyltransferase	NA	W8CYT3	Bacillus_phage	92.0	1.8e-64
WP_001258527.1|2012715_2013588_+	aminoglycoside 6-adenylyltransferase	NA	A0A1X9I6F2	Streptococcus_phage	44.4	4.0e-64
>prophage 8
NZ_CP015350	Bacillus thuringiensis strain MYBT18246 chromosome, complete genome	5867736	2063474	2071862	5867736	integrase,terminase	Lactococcus_phage(62.5%)	12	2055983:2055996	2069663:2069676
2055983:2055996	attL	AAAAGGATTTGTAA	NA	NA	NA	NA
WP_000536897.1|2063474_2063918_+	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	62.1	4.8e-45
WP_065483273.1|2064315_2065512_-|integrase	site-specific integrase	integrase	Q9AZK8	Lactococcus_phage	45.4	2.8e-100
WP_065483276.1|2065590_2066139_-	helix-turn-helix transcriptional regulator	NA	A0A286QR63	Streptococcus_phage	44.3	4.6e-05
WP_065483279.1|2066285_2066477_+	hypothetical protein	NA	R9QNG3	Lactococcus_phage	47.6	2.2e-07
WP_065483283.1|2066595_2066865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065483286.1|2066881_2067109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065486061.1|2067200_2068022_+	hypothetical protein	NA	Q9AZI6	Lactococcus_phage	49.6	1.7e-67
WP_065483289.1|2068038_2069424_+	hypothetical protein	NA	Q9AZE5	Lactococcus_phage	63.4	1.6e-168
WP_065483292.1|2069811_2070219_+	DUF722 domain-containing protein	NA	A5GYP6	Lactococcus_phage	34.3	1.6e-10
2069663:2069676	attR	AAAAGGATTTGTAA	NA	NA	NA	NA
WP_157686145.1|2070269_2070446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065483295.1|2070628_2071249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065483297.1|2071376_2071862_+|terminase	terminase small subunit	terminase	A7J290	Streptococcus_phage	54.6	6.6e-32
>prophage 9
NZ_CP015350	Bacillus thuringiensis strain MYBT18246 chromosome, complete genome	5867736	2408081	2468287	5867736	transposase,integrase,protease	Bacillus_phage(37.5%)	56	2404954:2404969	2469951:2469966
2404954:2404969	attL	AATAAAAAATTCGTAT	NA	NA	NA	NA
WP_000794825.1|2408081_2408978_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003270543.1|2408977_2409637_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000853593.1|2409895_2410501_+	PRK06770 family protein	NA	NA	NA	NA	NA
WP_000425898.1|2410571_2411438_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_065483516.1|2411567_2412611_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_065483519.1|2412690_2413122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000936604.1|2414583_2414835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065483522.1|2414931_2415834_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262982.1|2415990_2416680_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_000528665.1|2416938_2417826_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_065483524.1|2417852_2418449_+	DUF1349 domain-containing protein	NA	NA	NA	NA	NA
WP_000834774.1|2418670_2420425_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.2	1.8e-47
WP_065483527.1|2420417_2422214_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.7	3.0e-53
WP_065483530.1|2422299_2423073_-	collagen-like protein	NA	A0A285PWR0	Cedratvirus	34.3	1.9e-12
WP_048657278.1|2423502_2423763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065483534.1|2424147_2424930_-	glycosyltransferase family 2 protein	NA	A0A1V0SJD8	Klosneuvirus	31.6	5.9e-22
WP_065483537.1|2425109_2425694_-	LysE family transporter	NA	NA	NA	NA	NA
WP_065483540.1|2425808_2426366_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_065483543.1|2426740_2427364_-	collagen-like protein	NA	NA	NA	NA	NA
WP_001121647.1|2428518_2428809_-	DUF4183 domain-containing protein	NA	NA	NA	NA	NA
WP_065483546.1|2429278_2430574_+	collagen-like repeat preface domain-containing protein	NA	NA	NA	NA	NA
WP_065483548.1|2431125_2431758_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_065483551.1|2431987_2432305_+	DUF5519 family protein	NA	NA	NA	NA	NA
WP_139359406.1|2432514_2432607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065481512.1|2432733_2433990_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	60.2	5.8e-112
WP_065483554.1|2434170_2435481_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_065483556.1|2435458_2436328_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_065486065.1|2436823_2437417_+	methyltransferase domain-containing protein	NA	A0A2P1JQT7	Mycobacterium_phage	32.8	3.0e-10
WP_000137402.1|2437730_2438843_+	toxic anion resistance protein	NA	NA	NA	NA	NA
WP_065483559.1|2438867_2439701_+	DUF3974 domain-containing protein	NA	NA	NA	NA	NA
WP_065483562.1|2439758_2441318_-	family 10 glycosylhydrolase	NA	NA	NA	NA	NA
WP_000865907.1|2441545_2441851_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_065483565.1|2441862_2443146_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_065483568.1|2443224_2443497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065483570.1|2443512_2444667_+	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
WP_000876627.1|2444682_2445576_+	ATPase	NA	NA	NA	NA	NA
WP_000610875.1|2445714_2446263_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_065483572.1|2446333_2447917_+	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_061661061.1|2447991_2448993_+	bifunctional threonine ammonia-lyase/L-serine ammonia-lyase TdcB	NA	NA	NA	NA	NA
WP_065483576.1|2449216_2449687_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_065483579.1|2449826_2451062_+	MFS transporter	NA	A0A2H4UVM2	Bodo_saltans_virus	20.6	3.2e-06
WP_000415089.1|2451214_2451544_-	DUF1232 domain-containing protein	NA	NA	NA	NA	NA
WP_003270559.1|2452979_2454356_+	DEAD/DEAH box helicase	NA	A0A1V0SIR5	Klosneuvirus	36.0	1.5e-57
WP_094194618.1|2455302_2456446_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.2	3.0e-59
WP_000033159.1|2457114_2457327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065483587.1|2458014_2458293_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	62.7	7.9e-14
WP_065483588.1|2458285_2458645_+	cell division protein SepF	NA	A0A1B1P7A1	Bacillus_phage	52.5	4.9e-32
WP_006923988.1|2458663_2458831_+	DUF3954 domain-containing protein	NA	A0A1B1P7U5	Bacillus_phage	66.0	5.2e-13
WP_006923989.1|2458856_2459108_+	hypothetical protein	NA	A0A0K2CNP4	Brevibacillus_phage	43.8	3.8e-07
WP_094194456.1|2459850_2460895_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_006923995.1|2462050_2462437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016122509.1|2462944_2463409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065481512.1|2465599_2466856_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	60.2	5.8e-112
WP_139359406.1|2466982_2467075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065483591.1|2467262_2467745_+	ArpU family transcriptional regulator	NA	H0USV3	Bacillus_phage	83.1	2.7e-70
WP_065483594.1|2467744_2468287_+|integrase	site-specific integrase	integrase	W8CYP1	Bacillus_phage	91.7	4.3e-88
2469951:2469966	attR	AATAAAAAATTCGTAT	NA	NA	NA	NA
>prophage 10
NZ_CP015350	Bacillus thuringiensis strain MYBT18246 chromosome, complete genome	5867736	2613469	2681806	5867736	transposase,bacteriocin,tRNA	Planktothrix_phage(25.0%)	57	NA	NA
WP_000558614.1|2613469_2615023_+|tRNA	lysine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_001128402.1|2615082_2615511_-	cell wall hydrolase	NA	NA	NA	NA	NA
WP_094194461.1|2616413_2617202_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_000238996.1|2617553_2618261_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_015055137.1|2618257_2619241_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_000376270.1|2619560_2620187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065486071.1|2620896_2622525_+	ABC-F type ribosomal protection protein	NA	A0A1B0RXA0	Streptococcus_phage	33.5	4.2e-54
WP_063547369.1|2622545_2623139_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003270612.1|2623693_2624188_+	DUF3267 domain-containing protein	NA	NA	NA	NA	NA
WP_000404443.1|2624503_2625274_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.9	1.6e-32
WP_000144179.1|2625248_2627180_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_063547372.1|2627247_2627916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048657145.1|2627992_2628334_-	DUF3914 domain-containing protein	NA	NA	NA	NA	NA
WP_065483749.1|2628612_2629854_+	lipase	NA	NA	NA	NA	NA
WP_065483752.1|2629941_2630967_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_065483755.1|2631057_2632506_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_003270605.1|2632510_2633425_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_053564403.1|2633731_2634421_+	thiaminase II	NA	NA	NA	NA	NA
WP_002082716.1|2634872_2635136_+	DUF3937 domain-containing protein	NA	NA	NA	NA	NA
WP_065483758.1|2635605_2635935_+|bacteriocin	heterocycloanthracin/sonorensin family bacteriocin	bacteriocin	NA	NA	NA	NA
WP_065483761.1|2636427_2636913_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_065483764.1|2637224_2639612_+	DUF3893 domain-containing protein	NA	NA	NA	NA	NA
WP_065483768.1|2639819_2640587_+	DUF3959 family protein	NA	NA	NA	NA	NA
WP_065483771.1|2640731_2641148_+	DUF3995 domain-containing protein	NA	NA	NA	NA	NA
WP_065483774.1|2641268_2641472_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000362067.1|2641801_2642014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065483777.1|2642223_2643228_+	DUF1835 domain-containing protein	NA	NA	NA	NA	NA
WP_065483779.1|2643373_2643778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065483782.1|2646708_2647341_+	Vat family streptogramin A O-acetyltransferase	NA	A0A2R8FE91	Brazilian_cedratvirus	43.1	2.1e-25
WP_000046095.1|2647411_2647567_+	DUF1540 domain-containing protein	NA	NA	NA	NA	NA
WP_000289124.1|2647670_2648168_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_065483785.1|2648308_2649523_+	cytochrome P450	NA	NA	NA	NA	NA
WP_000766393.1|2650388_2651240_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_065483788.1|2651662_2653450_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_094194523.1|2654720_2655812_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_065483789.1|2656676_2657864_+	UDP-glucosyltransferase	NA	A0A2H4ZK81	Cryptophlebia_leucotreta_granulosis_virus	29.3	8.9e-06
WP_063547418.1|2657955_2658636_-	aspartate/glutamate racemase family protein	NA	NA	NA	NA	NA
WP_065483792.1|2659044_2659593_+	ECF-type riboflavin transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_065483795.1|2659603_2661304_+	energy-coupling factor ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	30.0	4.7e-16
WP_065483798.1|2661296_2662097_+	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_000120182.1|2662233_2662341_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_065483801.1|2662432_2663701_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	29.1	1.6e-24
WP_094194618.1|2665555_2666700_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.2	3.0e-59
WP_043924670.1|2668866_2669331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094194459.1|2669407_2670197_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_065483804.1|2670473_2670938_-	exosporium protein D	NA	NA	NA	NA	NA
WP_000453747.1|2671799_2672033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065483806.1|2672288_2672588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065483809.1|2673043_2673385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094194456.1|2673455_2674499_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_065483812.1|2674680_2675682_-	alpha/beta hydrolase family protein	NA	NA	NA	NA	NA
WP_065483815.1|2676258_2677683_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000447851.1|2677694_2678372_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.0	3.8e-25
WP_000273220.1|2678667_2678850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023522117.1|2679051_2679588_-	DinB family protein	NA	NA	NA	NA	NA
WP_094194525.1|2680346_2680754_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_094194456.1|2680761_2681806_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP015350	Bacillus thuringiensis strain MYBT18246 chromosome, complete genome	5867736	3099521	3179379	5867736	transposase,coat,protease	Bacillus_phage(30.77%)	60	NA	NA
WP_065484257.1|3099521_3101909_-|protease	M6 family metalloprotease domain-containing protein	protease	NA	NA	NA	NA
WP_065484260.1|3102151_3104758_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.4	1.6e-47
WP_065484263.1|3105248_3106106_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_065484273.1|3107237_3107717_-|coat	spore coat protein CotF	coat	NA	NA	NA	NA
WP_065484274.1|3108237_3108996_+	YqcI/YcgG family protein	NA	NA	NA	NA	NA
WP_065484277.1|3109765_3111109_-	amino acid permease	NA	NA	NA	NA	NA
WP_065484280.1|3111485_3111698_-	alpha/beta-type small acid-soluble spore protein	NA	A0A1P8CX76	Bacillus_phage	68.3	3.5e-14
WP_065484283.1|3111973_3112450_+	YndM family protein	NA	NA	NA	NA	NA
WP_065486078.1|3112485_3113001_-	DUF3231 family protein	NA	NA	NA	NA	NA
WP_063547816.1|3113295_3113508_-	small acid-soluble spore protein, SasP family	NA	Q77YX0	Bacillus_phage	61.5	7.1e-15
WP_000649092.1|3113774_3114908_+	glutathione-dependent formaldehyde dehydrogenase	NA	A0A0G2YAX3	Acanthamoeba_polyphaga_mimivirus	28.5	1.3e-14
WP_002164086.1|3115111_3115996_+	manganese catalase family protein	NA	NA	NA	NA	NA
WP_065484285.1|3116084_3117758_+	ribonuclease J	NA	NA	NA	NA	NA
WP_023522375.1|3118061_3118403_-	YolD-like family protein	NA	A0A2H4JEH6	uncultured_Caudovirales_phage	36.0	4.2e-09
WP_065484287.1|3118399_3119665_-	Y-family DNA polymerase	NA	O64031	Bacillus_phage	46.2	1.5e-99
WP_065484289.1|3122080_3123412_-	erythromycin esterase family protein	NA	NA	NA	NA	NA
WP_065484291.1|3123933_3125523_-	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_023522382.1|3125932_3126769_-	bromoperoxidase	NA	R4JMP9	Mycobacterium_phage	27.0	4.5e-12
WP_000131213.1|3127271_3127916_+	hydrolase	NA	NA	NA	NA	NA
WP_065484294.1|3128092_3128737_+	hydrolase	NA	NA	NA	NA	NA
WP_000806856.1|3128733_3129327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023522384.1|3129340_3131176_+	amidohydrolase	NA	NA	NA	NA	NA
WP_023522386.1|3131482_3132361_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000111424.1|3132577_3133021_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_065484298.1|3133967_3136043_-	serine hydrolase	NA	A0A2P1JR59	Mycobacterium_phage	27.0	5.7e-08
WP_065484301.1|3138667_3139618_-	magnesium transporter	NA	NA	NA	NA	NA
WP_065484304.1|3139923_3140949_-	ParM/StbA family protein	NA	A0A0S2MVG2	Bacillus_phage	40.6	2.4e-71
WP_043924679.1|3140984_3141386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065484307.1|3141471_3141858_-	general stress protein	NA	NA	NA	NA	NA
WP_000564622.1|3143074_3143197_-	flavoprotein	NA	NA	NA	NA	NA
WP_065484310.1|3143519_3144623_-	Ger(x)C family spore germination protein	NA	NA	NA	NA	NA
WP_094194456.1|3145969_3147013_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_094194544.1|3147028_3148414_-	spore germination protein	NA	NA	NA	NA	NA
WP_001225224.1|3148871_3149237_+	YxeA family protein	NA	NA	NA	NA	NA
WP_065484314.1|3149324_3150035_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000749744.1|3150138_3150594_-	tryptophan-rich sensory protein	NA	NA	NA	NA	NA
WP_065484317.1|3150705_3152136_-	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	30.7	2.7e-57
WP_000743889.1|3152349_3152919_+	DUF3841 domain-containing protein	NA	NA	NA	NA	NA
WP_000365631.1|3153009_3154227_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_065484320.1|3154526_3155048_-	carbonic anhydrase	NA	NA	NA	NA	NA
WP_065484323.1|3155127_3157734_-	DUF2309 family protein	NA	NA	NA	NA	NA
WP_023522401.1|3157733_3159266_-	NADH dehydrogenase subunit 5	NA	NA	NA	NA	NA
WP_094194456.1|3159700_3160744_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_000798162.1|3161041_3161404_-	DUF2294 domain-containing protein	NA	NA	NA	NA	NA
WP_065484325.1|3161770_3162613_-	polysaccharide deacetylase	NA	NA	NA	NA	NA
WP_065484330.1|3162991_3163552_+	streptothricin N-acetyltransferase SatA	NA	E4ZFP7	Streptococcus_phage	47.7	3.1e-25
WP_065484333.1|3163638_3164550_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_023522410.1|3164829_3165234_-	arsenate reductase (thioredoxin)	NA	A0A2H4PQT9	Staphylococcus_phage	72.2	3.2e-48
WP_065484335.1|3165259_3166300_-	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_023522412.1|3166318_3166756_-	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_065484338.1|3166816_3167122_-	arsenical resistance operon transcriptional regulator ArsR	NA	NA	NA	NA	NA
WP_157686151.1|3167347_3167494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065484342.1|3167603_3168113_-	DinB family protein	NA	NA	NA	NA	NA
WP_065481734.1|3168765_3169878_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_001127750.1|3170751_3170931_+	DUF4083 family protein	NA	NA	NA	NA	NA
WP_065484346.1|3171140_3172355_-	MFS transporter	NA	NA	NA	NA	NA
WP_065484348.1|3172857_3174024_-	serine hydrolase	NA	A0A1D8EXR7	Mycobacterium_phage	28.0	3.3e-21
WP_065484351.1|3174611_3176468_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_001072324.1|3176526_3177093_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_094194456.1|3178334_3179379_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_CP015350	Bacillus thuringiensis strain MYBT18246 chromosome, complete genome	5867736	3200103	3266665	5867736	transposase,protease	Bacillus_phage(29.41%)	51	NA	NA
WP_065481512.1|3200103_3201360_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	60.2	5.8e-112
WP_139359406.1|3201486_3201579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065484387.1|3203583_3204324_-	YrrS family protein	NA	NA	NA	NA	NA
WP_157686152.1|3204561_3204996_-	sodium:proton symporter	NA	NA	NA	NA	NA
WP_023522435.1|3205509_3207594_-	serine hydrolase	NA	A0A2P1JR59	Mycobacterium_phage	24.8	6.0e-05
WP_065484392.1|3207685_3208852_-	serine hydrolase	NA	A0A1D8EXR7	Mycobacterium_phage	26.0	2.4e-19
WP_065484394.1|3210016_3211336_+	septum formation initiator	NA	NA	NA	NA	NA
WP_065484396.1|3211743_3212616_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_065484397.1|3212736_3213606_+	DMT family transporter	NA	NA	NA	NA	NA
WP_023522446.1|3213845_3214151_-	monooxygenase	NA	NA	NA	NA	NA
WP_139359406.1|3214338_3214431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065481512.1|3214557_3215814_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	60.2	5.8e-112
WP_033690982.1|3216158_3216509_-	DoxX family membrane protein	NA	NA	NA	NA	NA
WP_001048563.1|3216835_3217255_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000589728.1|3217730_3218129_-	DUF1259 domain-containing protein	NA	NA	NA	NA	NA
WP_139359406.1|3219370_3219463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065481512.1|3219589_3220846_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	60.2	5.8e-112
WP_065484400.1|3220988_3221459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033695812.1|3221730_3222405_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.5	9.2e-32
WP_065484402.1|3222401_3223775_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	27.5	2.6e-25
WP_001104104.1|3223966_3224182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065484404.1|3224528_3225974_-	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_065484406.1|3226611_3227490_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_065484408.1|3227849_3229187_+	erythromycin esterase family protein	NA	NA	NA	NA	NA
WP_065484410.1|3229531_3230110_+	luciferase	NA	NA	NA	NA	NA
WP_023522453.1|3230225_3232013_+	response regulator	NA	Q6XM27	Feldmannia_irregularis_virus	34.5	6.0e-06
WP_065484413.1|3232176_3234006_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000595170.1|3234022_3234784_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.5	2.0e-35
WP_065484416.1|3234976_3236053_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	29.5	6.4e-19
WP_023522456.1|3236049_3236736_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	40.0	7.1e-40
WP_065484418.1|3236926_3237877_-	class A beta-lactamase	NA	A0A1B0VBP7	Salmonella_phage	43.2	1.1e-51
WP_023522458.1|3238185_3238614_-	DUF5412 domain-containing protein	NA	NA	NA	NA	NA
WP_065484421.1|3239134_3241246_+	TerD family protein	NA	A0A1I9SAC2	Rhodococcus_phage	31.7	2.5e-67
WP_065484423.1|3241457_3244655_-	bifunctional P-450/NADPH--P450 reductase	NA	V5UQK0	Mycobacterium_phage	37.9	4.3e-79
WP_157686153.1|3245228_3246668_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_065484425.1|3247064_3247661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065484428.1|3248041_3249832_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_065484431.1|3250162_3251158_-	D-cysteine desulfhydrase	NA	NA	NA	NA	NA
WP_023522465.1|3251514_3252747_-	DUF4073 domain-containing protein	NA	NA	NA	NA	NA
WP_065484434.1|3252944_3254486_-	serine hydrolase	NA	A0A2P1JR59	Mycobacterium_phage	28.0	5.0e-09
WP_094194550.1|3254696_3255617_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_065484440.1|3255831_3256422_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000851004.1|3256561_3257674_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_000202606.1|3257723_3258395_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.6	1.6e-36
WP_023522472.1|3258394_3259459_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_023522473.1|3259644_3260268_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_065484451.1|3260337_3261597_+	MFS transporter	NA	NA	NA	NA	NA
WP_065484453.1|3261701_3262172_-	DinB family protein	NA	NA	NA	NA	NA
WP_065484455.1|3262372_3263749_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	40.3	1.3e-56
WP_094194461.1|3263892_3264681_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_065481734.1|3265552_3266665_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 13
NZ_CP015350	Bacillus thuringiensis strain MYBT18246 chromosome, complete genome	5867736	3344060	3407111	5867736	transposase,tRNA	Klosneuvirus(20.0%)	55	NA	NA
WP_065484525.1|3344060_3345530_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	G3MB42	Bacillus_virus	39.3	3.0e-67
WP_000845630.1|3345845_3346409_-	maltose O-acetyltransferase	NA	NA	NA	NA	NA
WP_065484526.1|3346606_3347605_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_023522534.1|3347995_3349153_+	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_000411478.1|3349182_3350304_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_000539730.1|3350367_3350616_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_023522535.1|3350825_3351287_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_065484528.1|3351726_3353850_-	collagen-like protein	NA	NA	NA	NA	NA
WP_065484531.1|3353870_3355376_-	collagen-like protein	NA	NA	NA	NA	NA
WP_080672404.1|3355523_3355658_-	ubiquinone biosynthesis protein UbiE	NA	NA	NA	NA	NA
WP_023522539.1|3355688_3356603_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_023522540.1|3356902_3357280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023522541.1|3357356_3357596_+	DUF3923 family protein	NA	NA	NA	NA	NA
WP_000938438.1|3357716_3358265_-	DUF2179 domain-containing protein	NA	NA	NA	NA	NA
WP_023522542.1|3358463_3358877_-	ATP synthase subunit I	NA	NA	NA	NA	NA
WP_000402258.1|3358929_3360258_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_000285635.1|3360377_3360785_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_065481512.1|3361168_3362425_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	60.2	5.8e-112
WP_139359406.1|3362551_3362644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065484533.1|3362831_3363605_+	glycosyltransferase family 2 protein	NA	A0A1V0SJD8	Klosneuvirus	30.8	1.2e-19
WP_023522544.1|3363720_3364488_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_065484536.1|3364489_3365545_+	CDP-glucose 4,6-dehydratase	NA	C7U075	Ostreococcus_tauri_virus	26.4	3.9e-13
WP_023522546.1|3365557_3366781_+	class I SAM-dependent methyltransferase	NA	A0A1V0SJ68	Klosneuvirus	32.2	1.9e-43
WP_023522547.1|3366777_3367701_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A1V0SAI6	Catovirus	23.0	1.5e-08
WP_080672406.1|3367669_3368482_-	glycosyltransferase family 2 protein	NA	A0A1V0SJD8	Klosneuvirus	31.4	3.8e-16
WP_000814762.1|3368968_3369853_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000350943.1|3369870_3370407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065484539.1|3370426_3371248_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_001162791.1|3371443_3371620_+	DUF1272 domain-containing protein	NA	NA	NA	NA	NA
WP_000782228.1|3371685_3372753_-	lactonase family protein	NA	NA	NA	NA	NA
WP_065484542.1|3372873_3374415_-	gluconokinase	NA	NA	NA	NA	NA
WP_001057598.1|3374524_3375850_-	gluconate permease GntP	NA	NA	NA	NA	NA
WP_000667692.1|3376247_3376916_-	fructose-6-phosphate aldolase	NA	A0A0E3HNZ3	Synechococcus_phage	47.5	3.7e-49
WP_001195925.1|3377025_3377919_-	decarboxylating 6-phosphogluconate dehydrogenase	NA	A0A222YX62	Synechococcus_phage	37.2	2.2e-57
WP_065484547.1|3378031_3380026_-	transketolase	NA	NA	NA	NA	NA
WP_023522553.1|3380065_3381550_-	glucose-6-phosphate dehydrogenase	NA	M1UG55	Synechococcus_phage	35.2	3.5e-76
WP_023522554.1|3381914_3382463_-	glucose-6-phosphate dehydrogenase	NA	M4SIY3	Cyanophage	32.4	2.0e-16
WP_065484550.1|3382553_3383507_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_065484552.1|3383520_3384393_-	LLM class oxidoreductase	NA	NA	NA	NA	NA
WP_065484553.1|3384814_3385216_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_065484555.1|3385208_3386207_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_065484559.1|3386266_3387262_+	zinc-dependent alcohol dehydrogenase family protein	NA	K7Z7U2	Megavirus	27.2	6.1e-08
WP_023522558.1|3387681_3388140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023522559.1|3388322_3389117_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_023522560.1|3389907_3391605_-	M4 family metallopeptidase	NA	NA	NA	NA	NA
WP_094194456.1|3391762_3392806_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_094194456.1|3395122_3396166_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_065484562.1|3396647_3398372_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	46.6	9.9e-14
WP_000668221.1|3398825_3399395_-	HAD hydrolase-like protein	NA	NA	NA	NA	NA
WP_023522564.1|3399454_3400552_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	37.2	4.9e-59
WP_023522565.1|3400544_3401282_-	GTP cyclohydrolase II	NA	A0A1V0SE20	Indivirus	40.1	1.2e-24
WP_016124968.1|3401584_3401902_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_094194452.1|3402605_3403395_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_023522566.1|3404044_3405118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094194456.1|3406066_3407111_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 14
NZ_CP015350	Bacillus thuringiensis strain MYBT18246 chromosome, complete genome	5867736	3548820	3661868	5867736	transposase,tail,capsid,terminase,protease,portal,integrase,head,bacteriocin	Bacillus_phage(70.59%)	87	3535263:3535289	3622412:3622438
3535263:3535289	attL	ACATAGCGAATATGCCAAGGTTCATAT	NA	NA	NA	NA
WP_094194456.1|3548820_3549864_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_065484672.1|3550067_3551561_+	spore germination protein	NA	NA	NA	NA	NA
WP_023522660.1|3551562_3552666_+	endospore germination permease	NA	NA	NA	NA	NA
WP_065484674.1|3552662_3553790_+	Ger(x)C family spore germination protein	NA	NA	NA	NA	NA
WP_065484677.1|3554195_3554870_+	papain-like cysteine peptidase	NA	NA	NA	NA	NA
WP_023522663.1|3555433_3556183_+	NTP transferase domain-containing protein	NA	NA	NA	NA	NA
WP_065484680.1|3556203_3558270_+	glycosyl transferase	NA	NA	NA	NA	NA
WP_023522665.1|3558352_3559312_+	NAD(P)-dependent oxidoreductase	NA	A0A2K9L0I7	Tupanvirus	28.4	1.9e-22
WP_023522666.1|3559340_3560429_+	CDP-glucose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	25.7	4.3e-15
WP_063548252.1|3561546_3562662_+	tetratricopeptide repeat protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	55.3	2.5e-111
WP_065484683.1|3562971_3564954_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	34.2	6.7e-14
WP_016118415.1|3565823_3566108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065484686.1|3567638_3568187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065484689.1|3568510_3570832_-	S8 family serine peptidase	NA	NA	NA	NA	NA
WP_065484691.1|3570936_3573303_-	DUF3472 domain-containing protein	NA	NA	NA	NA	NA
WP_065484694.1|3573435_3575676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065484697.1|3576869_3577697_+	cytosolic protein	NA	A0A2H4J6G7	uncultured_Caudovirales_phage	69.9	2.1e-102
WP_065484700.1|3577706_3578327_-	hypothetical protein	NA	H0USY2	Bacillus_phage	95.6	1.8e-111
WP_065484702.1|3578268_3579450_-	cell division protein FtsK	NA	H0USY1	Bacillus_phage	91.6	6.9e-208
WP_016098414.1|3579564_3579747_-	hypothetical protein	NA	Q2I8E2	Bacillus_phage	88.3	1.5e-21
WP_065484704.1|3579743_3580061_-	hypothetical protein	NA	H0USY0	Bacillus_phage	97.1	1.1e-51
WP_065484707.1|3580249_3580465_+	helix-turn-helix transcriptional regulator	NA	A0A288WG80	Bacillus_phage	44.4	1.5e-07
WP_065484709.1|3582964_3583189_-	hypothetical protein	NA	A0A1B1P780	Bacillus_phage	91.9	1.6e-28
WP_157686155.1|3592736_3592913_-	hypothetical protein	NA	Q3HL07	Bacillus_phage	63.8	1.6e-12
WP_065484711.1|3592942_3593260_-	hypothetical protein	NA	W8CYN3	Bacillus_phage	90.4	2.8e-47
WP_006921167.1|3593306_3593912_-|tail	phage major tail protein	tail	A0A2H4J8F3	uncultured_Caudovirales_phage	86.1	3.2e-92
WP_065484714.1|3593912_3594272_-	DUF3168 domain-containing protein	NA	H0USX0	Bacillus_phage	96.6	2.7e-59
WP_000763220.1|3594268_3594703_-	HK97 gp10 family phage protein	NA	H0USW9	Bacillus_phage	97.2	5.6e-75
WP_065484716.1|3594695_3595019_-|head	phage head closure protein	head	H0USW8	Bacillus_phage	95.3	5.3e-54
WP_065484718.1|3595005_3595293_-|head,tail	phage gp6-like head-tail connector protein	head,tail	H0USW7	Bacillus_phage	97.9	1.7e-43
WP_065484721.1|3595313_3596486_-|capsid	phage major capsid protein	capsid	W8CYN2	Bacillus_phage	94.1	4.9e-198
WP_065484724.1|3596523_3597234_-|protease	Clp protease ClpP	protease	W8CYT5	Bacillus_phage	96.2	1.1e-123
WP_065484727.1|3597220_3598474_-|portal	phage portal protein	portal	A0A2H4J371	uncultured_Caudovirales_phage	95.0	4.2e-232
WP_065484730.1|3598662_3600357_-|terminase	terminase large subunit	terminase	A6M948	Geobacillus_virus	63.9	2.2e-207
WP_000532714.1|3600353_3600854_-|terminase	phage terminase small subunit P27 family	terminase	A0A0S2GLF2	Bacillus_phage	74.1	1.4e-64
WP_065484733.1|3601159_3601537_-	HNH endonuclease	NA	A0A0S2GLI5	Bacillus_phage	82.4	5.4e-58
WP_000602688.1|3601786_3602008_-	hypothetical protein	NA	B5LPQ8	Bacillus_virus	78.9	4.6e-25
WP_000377847.1|3602053_3602329_-	hypothetical protein	NA	H0USV6	Bacillus_phage	53.8	4.0e-18
WP_065486084.1|3603789_3604287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065484736.1|3604678_3604897_-	hypothetical protein	NA	H0USV5	Bacillus_phage	67.6	4.0e-21
WP_065484739.1|3605110_3605653_-|integrase	site-specific integrase	integrase	W8CYP1	Bacillus_phage	94.4	4.9e-92
WP_000166150.1|3605652_3606135_-	ArpU family transcriptional regulator	NA	H0USV3	Bacillus_phage	83.8	9.0e-74
WP_000645584.1|3606414_3606537_-	DUF3983 domain-containing protein	NA	NA	NA	NA	NA
WP_001013298.1|3606790_3607036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065484741.1|3608911_3609178_-	hypothetical protein	NA	A0A288WFR1	Bacillus_phage	96.6	1.6e-43
WP_065484744.1|3609403_3609574_-	DUF3954 domain-containing protein	NA	A0A0S2GLF5	Bacillus_phage	92.9	4.8e-22
WP_006929366.1|3609645_3609912_-	hypothetical protein	NA	W8CYZ5	Bacillus_phage	93.2	2.3e-39
WP_065484748.1|3609953_3610766_-	ATP-binding protein	NA	W8CZ50	Bacillus_phage	98.9	3.0e-154
WP_065484751.1|3611941_3612589_-	sigma-70 family RNA polymerase sigma factor	NA	A0A0S2GLJ1	Bacillus_phage	92.6	8.9e-109
WP_065484753.1|3612863_3613178_-	hypothetical protein	NA	A0A0S2GLB6	Bacillus_phage	94.2	5.0e-49
WP_006929382.1|3614103_3614286_-	hypothetical protein	NA	I7J4K2	Bacillus_phage	82.4	3.4e-18
WP_000277643.1|3614302_3614491_-	helix-turn-helix domain-containing protein	NA	A0A1B2APY7	Phage_Wrath	80.6	2.6e-21
WP_065484756.1|3614635_3614881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006929389.1|3615094_3615424_+	helix-turn-helix transcriptional regulator	NA	H0UST7	Bacillus_phage	98.2	2.5e-51
WP_065484762.1|3615844_3617098_-	hypothetical protein	NA	H0UST6	Bacillus_phage	98.9	9.8e-213
WP_006922645.1|3618381_3619443_+|integrase	site-specific integrase	integrase	H0UST3	Bacillus_phage	99.2	2.4e-196
WP_016080733.1|3620364_3621597_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0U4JE28	Exiguobacterium_phage	36.1	8.7e-20
WP_065484765.1|3622347_3623091_-	M15 family metallopeptidase	NA	NA	NA	NA	NA
3622412:3622438	attR	ACATAGCGAATATGCCAAGGTTCATAT	NA	NA	NA	NA
WP_023522679.1|3623349_3623604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065486049.1|3625300_3627187_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	29.5	4.9e-30
WP_157686156.1|3627925_3628162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094194559.1|3628199_3629249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094194459.1|3629358_3630148_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_094194560.1|3630172_3630871_-	hypothetical protein	NA	A0A0U4J920	Pseudomonas_phage	37.5	1.9e-24
WP_023522681.1|3633773_3634127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023522682.1|3634499_3634940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063548274.1|3635558_3636812_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_065484771.1|3637192_3640108_-	PKD domain-containing protein	NA	NA	NA	NA	NA
WP_000109724.1|3640309_3640987_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	45.0	6.2e-20
WP_063548278.1|3641273_3641792_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_065484773.1|3641839_3642748_-	glyoxalase	NA	NA	NA	NA	NA
WP_000488980.1|3642922_3643834_-	VanW family protein	NA	NA	NA	NA	NA
WP_000283711.1|3644263_3644593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065484775.1|3644708_3645785_+	DUF3900 domain-containing protein	NA	NA	NA	NA	NA
WP_016125016.1|3646962_3647088_-	DUF3961 domain-containing protein	NA	NA	NA	NA	NA
WP_016125017.1|3647072_3647405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000869305.1|3647554_3647758_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016123139.1|3647834_3648161_+	hypothetical protein	NA	A0A0S2GLG3	Bacillus_phage	47.2	1.3e-18
WP_016125018.1|3648203_3649301_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B1P878	Bacillus_phage	65.5	5.2e-133
WP_000480958.1|3649297_3649534_-|bacteriocin	bacteriocin biosynthesis protein	bacteriocin	A0A1B0T697	Bacillus_phage	54.1	3.9e-14
WP_065484778.1|3649570_3649939_-	hypothetical protein	NA	A0A0S2MVE0	Bacillus_phage	73.5	2.0e-41
WP_065484784.1|3649950_3655299_-	peptidase S74	NA	A0A0S2MVB4	Bacillus_phage	44.6	0.0e+00
WP_016125021.1|3655295_3656780_-|tail	phage tail family protein	tail	A0A0A7AQV1	Bacillus_phage	54.0	7.2e-138
WP_094194561.1|3656794_3660535_-|tail	phage tail tape measure protein	tail	A6M961	Geobacillus_virus	41.0	1.3e-10
WP_016125023.1|3660597_3660897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016125024.1|3660938_3661313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016125025.1|3661379_3661868_-|tail	phage major tail protein, TP901-1 family	tail	NA	NA	NA	NA
>prophage 15
NZ_CP015350	Bacillus thuringiensis strain MYBT18246 chromosome, complete genome	5867736	3673908	3687176	5867736		uncultured_Caudovirales_phage(40.0%)	17	NA	NA
WP_065484806.1|3673908_3674169_-	helix-turn-helix domain-containing protein	NA	A0A290FZJ4	Caldibacillus_phage	58.0	4.9e-18
WP_157686157.1|3674165_3674336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065484807.1|3674658_3674931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157686158.1|3675056_3675197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065484808.1|3675231_3675762_-	hypothetical protein	NA	A0A2H4J2L4	uncultured_Caudovirales_phage	37.8	6.3e-12
WP_065484810.1|3675761_3676166_-	sigma-70 family RNA polymerase sigma factor	NA	A0A0N9RZI0	Paenibacillus_phage	40.0	8.0e-15
WP_094194562.1|3676170_3678153_-	DNA (cytosine-5-)-methyltransferase	NA	Q02778	Bacillus_phage	36.5	1.5e-101
WP_065486086.1|3678654_3679281_-	hypothetical protein	NA	A0A0N9SJZ0	Paenibacillus_phage	45.8	6.3e-35
WP_065484811.1|3680033_3680738_-	FAD-dependent thymidylate synthase	NA	U5PWA7	Bacillus_virus	66.5	1.7e-84
WP_065484814.1|3680737_3681175_-	alpha/beta hydrolase	NA	A0A2H4IZM2	uncultured_Caudovirales_phage	69.2	5.7e-43
WP_065484815.1|3681174_3681687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065484816.1|3681673_3682450_-	HNH endonuclease	NA	A0A2H4IZM3	uncultured_Caudovirales_phage	52.1	9.5e-73
WP_065484817.1|3682442_3683456_-	hypothetical protein	NA	A0A2H4J7K6	uncultured_Caudovirales_phage	59.2	4.8e-117
WP_065484818.1|3683509_3683770_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065484819.1|3683784_3683940_-	BC1881 family protein	NA	NA	NA	NA	NA
WP_065484821.1|3683936_3684341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065484822.1|3684341_3687176_-	hypothetical protein	NA	A0A0N9S7Z3	Paenibacillus_phage	40.9	3.7e-106
>prophage 16
NZ_CP015350	Bacillus thuringiensis strain MYBT18246 chromosome, complete genome	5867736	3692640	3700681	5867736		Bacillus_phage(50.0%)	10	NA	NA
WP_065484831.1|3692640_3693840_-	hypothetical protein	NA	A0A288WGM1	Bacillus_phage	45.4	9.7e-93
WP_016125072.1|3693954_3694152_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_157686159.1|3694189_3694408_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_157686160.1|3694461_3695430_-	hypothetical protein	NA	A0A2H4J6E6	uncultured_Caudovirales_phage	42.1	8.8e-68
WP_016125074.1|3695417_3695681_-	hypothetical protein	NA	A0A1B1P870	Bacillus_phage	59.1	3.3e-22
WP_065484833.1|3695698_3697042_-	DNA helicase	NA	A0A2H4IZL9	uncultured_Caudovirales_phage	55.8	5.2e-135
WP_065484835.1|3697360_3698551_+	peptidase S8	NA	A0A1B0T6A2	Bacillus_phage	73.7	1.5e-165
WP_065484837.1|3698743_3699508_-	DNA replication protein	NA	A0A0N7GFF0	Paenibacillus_phage	57.6	5.6e-78
WP_065484839.1|3699507_3700215_-	DUF723 domain-containing protein	NA	G9J2C6	Bacillus_phage	51.7	8.5e-12
WP_065484841.1|3700294_3700681_-	hypothetical protein	NA	A0A2H4J134	uncultured_Caudovirales_phage	35.4	6.0e-12
>prophage 17
NZ_CP015350	Bacillus thuringiensis strain MYBT18246 chromosome, complete genome	5867736	3724740	3786478	5867736	transposase,tail,capsid,terminase,protease,portal,integrase,head	Bacillus_phage(83.72%)	64	3748652:3748670	3799331:3799349
WP_065484856.1|3724740_3725448_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.9	5.3e-38
WP_000656237.1|3725935_3726214_-	YhdT family protein	NA	NA	NA	NA	NA
WP_065484858.1|3726487_3727972_+	aldehyde dehydrogenase DhaS	NA	NA	NA	NA	NA
WP_000395352.1|3728022_3728763_-	3-oxoacyl-ACP reductase FabG	NA	NA	NA	NA	NA
WP_001035815.1|3728896_3729046_+	YfhD family protein	NA	NA	NA	NA	NA
WP_000447823.1|3731071_3731497_-	divergent PAP2 family protein	NA	NA	NA	NA	NA
WP_023522694.1|3731575_3732517_-	EamA family transporter RarD	NA	NA	NA	NA	NA
WP_065484860.1|3732609_3732858_-	DUF1294 domain-containing protein	NA	NA	NA	NA	NA
WP_000367304.1|3733040_3733439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065484861.1|3733722_3734772_-	Mrp/NBP35 family ATP-binding protein	NA	NA	NA	NA	NA
WP_000628502.1|3734844_3735081_-	molybdopterin converting factor subunit 1	NA	NA	NA	NA	NA
WP_001248111.1|3735085_3735550_-	molybdopterin synthase catalytic subunit MoaE	NA	NA	NA	NA	NA
WP_065484863.1|3735530_3736838_-	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_065484864.1|3736855_3737872_-	molybdopterin-synthase adenylyltransferase MoeB	NA	NA	NA	NA	NA
WP_065486087.1|3737896_3738676_-	formate/nitrite transporter family protein	NA	NA	NA	NA	NA
WP_023522699.1|3738867_3739884_-	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_065484865.1|3739900_3740698_-	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_000039582.1|3740714_3741059_-	DUF2294 domain-containing protein	NA	NA	NA	NA	NA
WP_023522701.1|3741174_3741657_-	DUF1641 domain-containing protein	NA	NA	NA	NA	NA
WP_065484867.1|3744291_3745368_+	cytosolic protein	NA	A0A0S2MVF4	Bacillus_phage	37.0	2.2e-11
WP_065484868.1|3745368_3745989_-	hypothetical protein	NA	H0USY2	Bacillus_phage	93.7	1.5e-108
WP_065484869.1|3745930_3747112_-	cell division protein FtsK	NA	H0USY1	Bacillus_phage	89.6	2.7e-204
WP_065484872.1|3747224_3747410_-	hypothetical protein	NA	Q2I8E2	Bacillus_phage	86.7	5.8e-21
WP_065484874.1|3747406_3747715_-	hypothetical protein	NA	H0USY0	Bacillus_phage	82.7	2.4e-40
WP_065484876.1|3747889_3748111_+	helix-turn-helix transcriptional regulator	NA	A0A288WG80	Bacillus_phage	47.7	2.0e-07
WP_065484877.1|3748125_3748710_+	type IV secretory system conjugative DNA transfer family protein	NA	A0A288WFT6	Bacillus_phage	72.3	3.3e-78
3748652:3748670	attL	AAGAACAAGTAGATAAGAT	NA	NA	NA	NA
WP_065484878.1|3749522_3749723_+	hypothetical protein	NA	A0A1B0T6A3	Bacillus_phage	80.0	5.5e-17
WP_065484880.1|3749756_3750797_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B1P878	Bacillus_phage	77.0	2.6e-158
WP_065484881.1|3750857_3751061_-	hypothetical protein	NA	A0A1B1P886	Bacillus_phage	65.0	1.1e-17
WP_000151299.1|3751063_3751345_-	hypothetical protein	NA	D2XR31	Bacillus_phage	76.9	1.0e-32
WP_065484882.1|3751451_3755552_-	hypothetical protein	NA	W8CYT7	Bacillus_phage	82.3	0.0e+00
WP_065484884.1|3755548_3757033_-|tail	phage tail protein	tail	W8CYY9	Bacillus_phage	93.7	5.0e-280
WP_065484885.1|3757045_3760894_-|tail	phage tail tape measure protein	tail	A0A2H4J380	uncultured_Caudovirales_phage	84.6	0.0e+00
WP_065484886.1|3761114_3761432_-	hypothetical protein	NA	H0USX2	Bacillus_phage	86.5	8.9e-46
WP_065484888.1|3761480_3762083_-|tail	phage tail protein	tail	W8CYT6	Bacillus_phage	96.0	2.3e-95
WP_065484889.1|3762083_3762443_-	DUF3168 domain-containing protein	NA	A0A0S2GLE3	Bacillus_phage	95.8	2.1e-59
WP_000763223.1|3762439_3762877_-	HK97 gp10 family phage protein	NA	A0A0S2GLH3	Bacillus_phage	100.0	7.9e-77
WP_065484890.1|3762869_3763193_-|head	phage head closure protein	head	H0USW8	Bacillus_phage	97.2	9.7e-56
WP_065484891.1|3763179_3763467_-|head,tail	phage gp6-like head-tail connector protein	head,tail	H0USW7	Bacillus_phage	93.6	2.1e-41
WP_065484893.1|3763487_3764660_-|capsid	phage major capsid protein	capsid	A0A2H4J387	uncultured_Caudovirales_phage	90.0	1.2e-196
WP_094194633.1|3764698_3765292_-|protease	Clp protease ClpP	protease	A0A2H4JC29	uncultured_Caudovirales_phage	85.3	9.4e-89
WP_065484896.1|3765392_3766643_-|portal	phage portal protein	portal	A0A0S2GLJ4	Bacillus_phage	88.5	2.5e-216
WP_065484898.1|3766830_3768525_-|terminase	terminase large subunit	terminase	A6M948	Geobacillus_virus	63.8	2.2e-207
WP_065484899.1|3768521_3769022_-|terminase	phage terminase small subunit P27 family	terminase	A0A0S2GLF2	Bacillus_phage	74.1	1.0e-64
WP_065484901.1|3769350_3769725_-	HNH endonuclease	NA	A0A2H4J3B4	uncultured_Caudovirales_phage	80.6	4.3e-55
WP_030022649.1|3770145_3770358_-	hypothetical protein	NA	A0A0S2GM40	Bacillus_phage	94.3	3.3e-28
WP_065484902.1|3771543_3771741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_030022646.1|3772192_3772438_-	hypothetical protein	NA	W8CYG8	Bacillus_phage	95.1	1.7e-36
WP_065484903.1|3772644_3773187_-|integrase	site-specific integrase	integrase	W8CYP1	Bacillus_phage	98.3	3.0e-94
WP_065484904.1|3773183_3773669_-	ArpU family transcriptional regulator	NA	H0USV3	Bacillus_phage	97.5	3.3e-84
WP_065484906.1|3773819_3774422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065484908.1|3776547_3777018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065484910.1|3777189_3777357_-	DUF3954 domain-containing protein	NA	A0A0S2GLF5	Bacillus_phage	77.8	1.0e-16
WP_065484912.1|3777429_3777696_-	hypothetical protein	NA	A0A0S2GLK4	Bacillus_phage	81.8	5.0e-34
WP_065484914.1|3777692_3777995_-	hypothetical protein	NA	A0A1B1P7W1	Bacillus_phage	52.7	1.5e-18
WP_157686161.1|3777998_3778826_-	ATP-binding protein	NA	D2XQ17	Bacillus_virus	79.4	6.4e-120
WP_065484916.1|3778773_3779676_-	DNA replication protein DnaD	NA	A0A0S2GLI6	Bacillus_phage	75.1	1.5e-117
WP_065484918.1|3780823_3781144_-	hypothetical protein	NA	A0A0S2GLB6	Bacillus_phage	68.7	9.1e-30
WP_065484919.1|3781159_3781921_-	antirepressor	NA	A0A0S2GLP8	Bacillus_phage	69.8	2.0e-91
WP_000549469.1|3782130_3782319_-	helix-turn-helix transcriptional regulator	NA	W8CYN7	Bacillus_phage	90.3	3.3e-24
WP_065484921.1|3782350_3782587_-	helix-turn-helix transcriptional regulator	NA	W8CYU0	Bacillus_phage	92.2	1.3e-33
WP_030022621.1|3782733_3783081_+	helix-turn-helix transcriptional regulator	NA	I7J6V3	Bacillus_phage	92.0	7.0e-52
WP_065486090.1|3783413_3784619_-	hypothetical protein	NA	A0A0U3TNF6	Bacillus_phage	43.8	7.3e-88
WP_065484922.1|3785386_3786478_+|integrase	site-specific integrase	integrase	A0A0S2GLI2	Bacillus_phage	80.1	4.3e-164
3799331:3799349	attR	ATCTTATCTACTTGTTCTT	NA	NA	NA	NA
>prophage 18
NZ_CP015350	Bacillus thuringiensis strain MYBT18246 chromosome, complete genome	5867736	4482894	4543575	5867736	transposase,tail,capsid,terminase,protease,portal,tRNA,integrase,head,plate	Bacillus_phage(48.39%)	61	4475962:4475982	4535438:4535458
4475962:4475982	attL	ACGCTGTTGCTGTCCACCAGA	NA	NA	NA	NA
WP_094194461.1|4482894_4483684_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_065485204.1|4484415_4486800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065485206.1|4486905_4488456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094194574.1|4488691_4490046_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	85.1	1.4e-127
WP_065485212.1|4490119_4491154_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B1P878	Bacillus_phage	74.1	8.3e-149
WP_065485214.1|4491415_4491697_-	hypothetical protein	NA	D2XR31	Bacillus_phage	78.0	4.5e-33
WP_065485216.1|4491817_4492906_-|plate	BppU family phage baseplate upper protein	plate	A0A1B1P768	Bacillus_phage	65.9	1.6e-134
WP_065485219.1|4492920_4495263_-	endopeptidase	NA	A0A1C8E983	Bacillus_phage	89.6	0.0e+00
WP_065485221.1|4495259_4495943_-|tail	phage tail protein	tail	A0A1C8EA72	Bacillus_phage	68.6	1.8e-88
WP_065485224.1|4495944_4499706_-|tail	phage tail tape measure protein	tail	A0A2H4J957	uncultured_Caudovirales_phage	46.8	4.3e-70
WP_065485227.1|4499888_4500257_-	hypothetical protein	NA	A0A1S7FZ84	Listeria_phage	34.6	1.3e-08
WP_065485229.1|4500315_4500885_-|tail	phage tail protein	tail	Q858W9	Listeria_phage	42.1	9.8e-35
WP_065485231.1|4500885_4501296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065485234.1|4501285_4501666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065485236.1|4501643_4502009_-|head,tail	phage head-tail adapter protein	head,tail	NA	NA	NA	NA
WP_065485238.1|4502008_4502320_-	hypothetical protein	NA	A0A1B1P751	Bacillus_phage	41.7	3.4e-13
WP_065485240.1|4502333_4503455_-|capsid	phage major capsid protein	capsid	R4IBU5	Listeria_phage	50.0	8.8e-96
WP_065485242.1|4503468_4504167_-|protease	Clp protease ClpP	protease	D2XR17	Bacillus_phage	46.8	2.5e-40
WP_065485244.1|4504108_4505347_-|portal	phage portal protein	portal	A0A1B1P754	Bacillus_phage	32.3	1.7e-52
WP_065485246.1|4505365_4507033_-|terminase	terminase large subunit	terminase	A0A1B1P766	Bacillus_phage	57.0	6.6e-180
WP_065485248.1|4507016_4507469_-	hypothetical protein	NA	E2ELI1	Clostridium_phage	43.5	1.1e-23
WP_065485250.1|4507644_4507956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065485252.1|4507958_4508285_-	HNH endonuclease	NA	A0A1S7FZ53	Listeria_phage	43.8	2.2e-15
WP_065485254.1|4508369_4508612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065485258.1|4509453_4509741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094194461.1|4510843_4511632_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_065485260.1|4511812_4512388_-	zinc-finger domain-containing protein	NA	A0A0S2MV86	Bacillus_phage	37.4	4.8e-13
WP_094194456.1|4513349_4514394_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_157686165.1|4514925_4515090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065485262.1|4515089_4515521_-	hypothetical protein	NA	A0A2H4JFQ6	uncultured_Caudovirales_phage	71.6	2.1e-58
WP_065485264.1|4515508_4515736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065485265.1|4516054_4518397_-	DNA primase	NA	A0A1B2AQ05	Phage_Wrath	84.2	0.0e+00
WP_065485267.1|4518469_4518946_-	DUF669 domain-containing protein	NA	A0A1B2AQ07	Phage_Wrath	50.0	6.5e-32
WP_065485269.1|4518966_4519638_-	AAA family ATPase	NA	A0A1B2AQ06	Phage_Wrath	94.6	2.9e-118
WP_065482597.1|4519639_4519837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065486099.1|4519833_4520013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065485271.1|4520020_4520233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065485273.1|4520879_4521089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065485275.1|4522450_4522639_-	helix-turn-helix transcriptional regulator	NA	W8CYN7	Bacillus_phage	87.1	4.8e-23
WP_065485277.1|4522706_4522913_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_065485279.1|4523082_4523418_+	helix-turn-helix transcriptional regulator	NA	H0UST7	Bacillus_phage	44.3	2.4e-17
WP_094194636.1|4523831_4525073_-	hypothetical protein	NA	A0A0U3TNF6	Bacillus_phage	49.7	9.4e-107
WP_065485282.1|4525861_4526923_+|integrase	site-specific integrase	integrase	H0UST3	Bacillus_phage	77.9	6.9e-159
WP_000871362.1|4526984_4528262_-	MFS transporter	NA	NA	NA	NA	NA
WP_001052031.1|4528379_4528991_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	62.2	4.5e-70
WP_000021895.1|4529528_4530287_+	DUF1189 domain-containing protein	NA	NA	NA	NA	NA
WP_065481512.1|4530475_4531732_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	60.2	5.8e-112
WP_139359406.1|4531858_4531951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000825415.1|4532137_4532503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016080269.1|4532658_4533771_+	flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase	NA	NA	NA	NA	NA
WP_001054516.1|4533850_4534264_-	transcriptional repressor	NA	NA	NA	NA	NA
WP_000613817.1|4534277_4535111_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_065485283.1|4535110_4535881_-	metal ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.2	3.0e-18
4535438:4535458	attR	ACGCTGTTGCTGTCCACCAGA	NA	NA	NA	NA
WP_000435960.1|4536060_4536939_-	YitT family protein	NA	NA	NA	NA	NA
WP_001048958.1|4537088_4537343_+	DUF2624 domain-containing protein	NA	NA	NA	NA	NA
WP_000912471.1|4537361_4538258_-	deoxyribonuclease IV	NA	A0A2H4UU70	Bodo_saltans_virus	32.1	1.2e-23
WP_065485285.1|4538344_4539736_-	DEAD/DEAH box helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	29.3	3.2e-47
WP_065485287.1|4539916_4540669_+	VrrA protein	NA	NA	NA	NA	NA
WP_000706657.1|4540758_4541709_+	4-hydroxy-3-methylbut-2-enyl diphosphate reductase	NA	NA	NA	NA	NA
WP_000036248.1|4541749_4542871_-	Nif3-like dinuclear metal center hexameric protein	NA	A0A2P1EK93	Megavirus	48.0	4.6e-20
WP_001006547.1|4542867_4543575_-|tRNA	tRNA (adenine(22)-N(1))-methyltransferase TrmK	tRNA	NA	NA	NA	NA
>prophage 19
NZ_CP015350	Bacillus thuringiensis strain MYBT18246 chromosome, complete genome	5867736	4771367	4779047	5867736		Bacillus_phage(33.33%)	9	NA	NA
WP_000221100.1|4771367_4772291_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	44.0	6.9e-46
WP_000247669.1|4772417_4773353_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	26.3	4.9e-23
WP_000018060.1|4773354_4774047_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	38.2	6.3e-36
WP_001014310.1|4774389_4774584_+	YwbE family protein	NA	NA	NA	NA	NA
WP_001255968.1|4774624_4775824_-	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	41.2	5.6e-72
WP_000587824.1|4776115_4776439_+	heme oxygenase	NA	NA	NA	NA	NA
WP_000095598.1|4776507_4777272_-	class B sortase	NA	NA	NA	NA	NA
WP_065485373.1|4777303_4778074_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.6	1.7e-13
WP_001036824.1|4778063_4779047_-	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.9	7.1e-17
>prophage 20
NZ_CP015350	Bacillus thuringiensis strain MYBT18246 chromosome, complete genome	5867736	4976926	4983549	5867736	transposase	Staphylococcus_phage(50.0%)	9	NA	NA
WP_000817275.1|4976926_4978084_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q331V1	Clostridium_botulinum_C_phage	59.0	9.6e-122
WP_004412121.1|4978080_4978431_-|transposase	IS607 family transposase	transposase	Q331V0	Clostridium_botulinum_C_phage	66.7	9.2e-44
WP_001129340.1|4978645_4978795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139359406.1|4978981_4979074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065481512.1|4979200_4980457_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	60.2	5.8e-112
WP_000840869.1|4980595_4980859_-	YtzC family protein	NA	NA	NA	NA	NA
WP_000868033.1|4980970_4981930_+	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	72.0	1.7e-55
WP_000764492.1|4981926_4982499_+	methyltransferase domain-containing protein	NA	A0A2H4PQV0	Staphylococcus_phage	53.4	4.1e-49
WP_000959717.1|4982715_4983549_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.1	1.8e-16
>prophage 21
NZ_CP015350	Bacillus thuringiensis strain MYBT18246 chromosome, complete genome	5867736	5131431	5225585	5867736	transposase,tail,capsid,protease,portal,tRNA,integrase,head,plate,coat	Bacillus_phage(43.59%)	93	5144155:5144187	5208118:5208150
WP_065481512.1|5131431_5132688_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	60.2	5.8e-112
WP_063549376.1|5132976_5133360_+	kinase	NA	NA	NA	NA	NA
WP_000344360.1|5133400_5134024_-	3'-5' exonuclease KapD	NA	NA	NA	NA	NA
WP_000545210.1|5134313_5135639_+	ArsB/NhaD family transporter	NA	NA	NA	NA	NA
WP_000390061.1|5135718_5136186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065485508.1|5136303_5137017_+	DNA alkylation repair protein	NA	NA	NA	NA	NA
WP_065485510.1|5137362_5138739_+|tRNA	glycine--tRNA ligase	tRNA	A0A1V0SIF1	Klosneuvirus	28.1	5.8e-49
WP_001140612.1|5138778_5139162_-	hotdog fold thioesterase	NA	NA	NA	NA	NA
WP_000810334.1|5139257_5140001_+	DUF3298 and DUF4163 domain-containing protein	NA	NA	NA	NA	NA
WP_001253379.1|5140051_5140645_+	biotin transporter BioY	NA	NA	NA	NA	NA
WP_030029053.1|5140690_5141578_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	54.1	4.1e-80
WP_023523269.1|5141685_5143410_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	53.7	1.2e-176
WP_065485511.1|5143553_5144159_+	hypothetical protein	NA	NA	NA	NA	NA
5144155:5144187	attL	TATAAAGTGAAACTTTAATCAGCCCTCACCAAT	NA	NA	NA	NA
WP_023523274.1|5144333_5145818_-	cytosol aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	36.4	2.5e-58
WP_002094181.1|5145963_5146590_-	3D domain-containing protein	NA	A0A0H3UZG2	Geobacillus_virus	43.0	2.1e-14
WP_000027016.1|5146675_5146993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000517993.1|5146989_5147496_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_000856602.1|5147813_5149022_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000829772.1|5149484_5150474_+	NAD(P)/FAD-dependent oxidoreductase	NA	Q9JRK7	Streptococcus_phage	52.4	2.3e-31
WP_065485513.1|5150591_5160794_-	DUF11 domain-containing protein	NA	NA	NA	NA	NA
WP_000606660.1|5161258_5161738_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000391931.1|5161955_5163203_+	MFS transporter	NA	NA	NA	NA	NA
WP_000535246.1|5163220_5164102_-	decarboxylase	NA	NA	NA	NA	NA
WP_065485516.1|5164182_5164644_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_065485518.1|5164968_5166036_+	HTH domain-containing protein	NA	A0A0S2MVF4	Bacillus_phage	78.6	8.3e-11
WP_065485520.1|5166835_5167258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094194582.1|5168010_5169339_-	YncE family protein	NA	NA	NA	NA	NA
WP_065485524.1|5169979_5171023_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B1P878	Bacillus_phage	81.1	8.3e-165
WP_065485526.1|5171084_5171288_-	hypothetical protein	NA	D2XR32	Bacillus_phage	60.6	8.6e-18
WP_065485528.1|5171290_5171572_-	hypothetical protein	NA	D2XR31	Bacillus_phage	74.7	1.9e-31
WP_065485530.1|5171645_5172752_-|plate	BppU family phage baseplate upper protein	plate	A0A1B1P768	Bacillus_phage	52.7	3.5e-105
WP_065485532.1|5172766_5175109_-	endopeptidase	NA	A0A1C8E983	Bacillus_phage	89.2	0.0e+00
WP_065485534.1|5175105_5175789_-|tail	phage tail protein	tail	A0A1C8EA72	Bacillus_phage	67.7	1.2e-87
WP_065485536.1|5175790_5179552_-|tail	phage tail tape measure protein	tail	A0A2H4J957	uncultured_Caudovirales_phage	46.5	8.1e-69
WP_065485227.1|5179734_5180103_-	hypothetical protein	NA	A0A1S7FZ84	Listeria_phage	34.6	1.3e-08
WP_065485538.1|5180161_5180731_-|tail	phage tail protein	tail	Q858W9	Listeria_phage	42.2	7.5e-35
WP_065485540.1|5180731_5181142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065485542.1|5181131_5181512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065485544.1|5181489_5181855_-|head,tail	phage head-tail adapter protein	head,tail	NA	NA	NA	NA
WP_065485546.1|5181854_5182166_-	hypothetical protein	NA	A0A1B1P751	Bacillus_phage	40.5	7.5e-13
WP_065485548.1|5182179_5183301_-|capsid	phage major capsid protein	capsid	A0A1B1P752	Bacillus_phage	51.4	1.1e-95
WP_065485549.1|5183314_5184010_-|protease	Clp protease ClpP	protease	D2XR17	Bacillus_phage	47.1	1.9e-40
WP_065485551.1|5183951_5185190_-|portal	phage portal protein	portal	A0A1B1P754	Bacillus_phage	38.3	1.8e-73
WP_094194452.1|5185648_5186437_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_094194583.1|5187710_5188163_-	hypothetical protein	NA	A0A1S7FYW6	Listeria_phage	40.8	4.6e-11
WP_065485554.1|5188338_5188647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065485556.1|5188649_5188976_-	HNH endonuclease	NA	A0A1S7FZ53	Listeria_phage	44.8	3.4e-16
WP_065485558.1|5189022_5189265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065485560.1|5189331_5189883_-	signal peptidase I	NA	NA	NA	NA	NA
WP_065485561.1|5190281_5190656_-	ArpU family transcriptional regulator	NA	Q9ZXB9	Bacillus_phage	43.1	8.4e-19
WP_065485563.1|5190801_5191344_+|integrase	tyrosine-type recombinase/integrase	integrase	A3F636	Streptococcus_phage	37.8	4.1e-22
WP_065485565.1|5191375_5191858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065485567.1|5193398_5194133_-	sigma-70 family RNA polymerase sigma factor	NA	A0A288WG21	Bacillus_phage	50.0	2.5e-59
WP_065485568.1|5194116_5194539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065485569.1|5194548_5195307_-	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_065485570.1|5195296_5195965_-	2-methylcitrate dehydratase	NA	NA	NA	NA	NA
WP_065485571.1|5195985_5196396_-	DUF1064 domain-containing protein	NA	A0A2P1JTY5	Anoxybacillus_phage	51.1	6.8e-30
WP_157686166.1|5196402_5196606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065485575.1|5196670_5197972_-	DNA helicase	NA	A0A1B1P7G6	Bacillus_phage	42.6	5.8e-91
WP_094194585.1|5197971_5198847_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_065485577.1|5198882_5199680_-	recombination protein RecT	NA	S6AVW6	Thermus_phage	64.2	2.3e-90
WP_065485579.1|5199701_5200637_-	hypothetical protein	NA	S6C475	Thermus_phage	59.2	1.4e-99
WP_065485581.1|5200716_5200911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065485584.1|5200911_5201214_-	hypothetical protein	NA	A0A0S2GLB6	Bacillus_phage	67.6	5.0e-30
WP_023523323.1|5201730_5201919_-	helix-turn-helix transcriptional regulator	NA	A0A0S2GLE9	Bacillus_phage	77.4	1.2e-18
WP_065485587.1|5201963_5202260_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_023523325.1|5202441_5202780_+	helix-turn-helix transcriptional regulator	NA	E9LUL4	Lactobacillus_phage	37.1	3.8e-10
WP_065485590.1|5203250_5204381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065485591.1|5205033_5206095_+|integrase	site-specific integrase	integrase	A0A1B2AQ00	Phage_Wrath	84.7	8.4e-173
WP_000833148.1|5206184_5206538_-	YxeA family protein	NA	A0A0K2CYS5	Paenibacillus_phage	40.2	1.3e-13
WP_003272374.1|5206644_5206830_-	methyltransferase	NA	NA	NA	NA	NA
WP_023523329.1|5207233_5208004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001068190.1|5208917_5209481_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
5208118:5208150	attR	TATAAAGTGAAACTTTAATCAGCCCTCACCAAT	NA	NA	NA	NA
WP_000573830.1|5209586_5209940_-	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7M3	Lake_Baikal_phage	42.3	8.2e-16
WP_000077392.1|5209981_5210848_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_000595026.1|5211094_5211334_-	YuzB family protein	NA	NA	NA	NA	NA
WP_000682065.1|5211686_5212757_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001054089.1|5212990_5213164_+	aspartyl-phosphate phosphatase Spo0E family protein	NA	NA	NA	NA	NA
WP_063246395.1|5213218_5213878_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.6	4.9e-22
WP_000679254.1|5213861_5214659_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_023523332.1|5214859_5215201_-	alkylphosphonate utilization operon protein PhnA	NA	NA	NA	NA	NA
WP_003272364.1|5215711_5216509_-	DUF2628 domain-containing protein	NA	NA	NA	NA	NA
WP_065485593.1|5216835_5217513_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003272363.1|5217611_5218406_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_000248588.1|5218458_5218767_-	YuzD family protein	NA	NA	NA	NA	NA
WP_000431159.1|5218962_5219199_+	NifU family protein	NA	Q58MC7	Prochlorococcus_phage	46.6	2.0e-10
WP_065485595.1|5219517_5219733_+	carbonic anhydrase	NA	NA	NA	NA	NA
WP_065485597.1|5219794_5220796_-|coat	spore coat protein CotS	coat	NA	NA	NA	NA
WP_000665103.1|5220916_5221408_+	phosphatidylglycerophosphatase A	NA	G3MBC5	Bacillus_virus	53.8	3.5e-41
WP_063548937.1|5221431_5221911_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_063548939.1|5222072_5223176_+	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_023523339.1|5223120_5224467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000241506.1|5224472_5225585_+|protease	cysteine protease StiP family protein	protease	NA	NA	NA	NA
>prophage 22
NZ_CP015350	Bacillus thuringiensis strain MYBT18246 chromosome, complete genome	5867736	5233942	5290269	5867736	tail,holin,transposase,capsid,terminase,protease,portal,integrase,head	Bacillus_phage(50.0%)	61	5229593:5229608	5289219:5289234
5229593:5229608	attL	CTACATCTAATACAGT	NA	NA	NA	NA
WP_002094186.1|5233942_5234758_+|protease	YhfC family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000738182.1|5234783_5235215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065485604.1|5235348_5235903_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_000272748.1|5235977_5236457_+	YbaK/EbsC family protein	NA	NA	NA	NA	NA
WP_000166367.1|5236477_5237374_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_065485606.1|5237563_5238547_+	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_000021807.1|5238620_5239352_-	sporulation protein YunB	NA	NA	NA	NA	NA
WP_000248467.1|5239406_5239709_-	DUF1805 domain-containing protein	NA	NA	NA	NA	NA
WP_094194588.1|5239774_5241166_-	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_065485610.1|5241857_5242691_+	cytosolic protein	NA	A0A2H4J6G7	uncultured_Caudovirales_phage	85.6	7.6e-129
WP_065485612.1|5242705_5242996_-	hypothetical protein	NA	A0A1C8E992	Bacillus_phage	85.6	6.7e-40
WP_065485619.1|5243019_5243238_-	hypothetical protein	NA	A0A1C8E991	Bacillus_phage	90.3	3.6e-30
WP_065485621.1|5243376_5244960_+	cytoplasmic protein	NA	A0A2H4J389	uncultured_Caudovirales_phage	48.1	3.1e-30
WP_016109438.1|5244972_5245431_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_065485625.1|5245718_5246831_-	histidine kinase	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	50.0	2.7e-97
WP_065485628.1|5247323_5248259_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0S2MVR5	Bacillus_phage	84.6	2.1e-159
WP_016099116.1|5248258_5248684_-|holin	phage holin family protein	holin	A0A0S2MVC4	Bacillus_phage	97.2	8.3e-71
WP_016099117.1|5248719_5249100_-	hypothetical protein	NA	A0A0S2MVE0	Bacillus_phage	73.3	1.3e-43
WP_065485630.1|5249111_5253497_-	hypothetical protein	NA	A0A0S2MVB4	Bacillus_phage	53.8	0.0e+00
WP_016099119.1|5253493_5254951_-|tail	phage tail family protein	tail	A0A0A7AQV1	Bacillus_phage	59.5	5.2e-173
WP_000415931.1|5258857_5259220_-	hypothetical protein	NA	A0A2H4JAG8	uncultured_Caudovirales_phage	71.7	1.4e-42
WP_065485633.1|5259226_5259820_-|tail	phage tail protein	tail	A0A2H4JDV4	uncultured_Caudovirales_phage	91.8	2.8e-101
WP_065485634.1|5259820_5260156_-	hypothetical protein	NA	A0A2H4JAG4	uncultured_Caudovirales_phage	93.6	3.6e-53
WP_065485635.1|5260152_5260497_-	HK97 gp10 family phage protein	NA	A0A2H4JAH8	uncultured_Caudovirales_phage	79.6	2.2e-45
WP_065485636.1|5260498_5260849_-|head	phage head closure protein	head	D2XR20	Bacillus_phage	87.1	1.9e-52
WP_001243201.1|5260850_5261147_-	hypothetical protein	NA	D2XR19	Bacillus_phage	91.7	4.6e-44
WP_000234860.1|5261159_5262323_-|capsid	phage major capsid protein	capsid	A0A2H4JH29	uncultured_Caudovirales_phage	95.6	2.3e-208
WP_065485639.1|5262342_5263119_-|protease	Clp protease ClpP	protease	R9TLM7	Paenibacillus_phage	52.4	3.3e-57
WP_050428367.1|5263102_5264209_-|portal	phage portal protein	portal	A0A2H4JAJ1	uncultured_Caudovirales_phage	90.1	6.3e-187
WP_065485640.1|5264274_5265930_-|terminase	terminase large subunit	terminase	A0A2H4JHE9	uncultured_Caudovirales_phage	96.4	0.0e+00
WP_000763336.1|5265926_5266283_-	hypothetical protein	NA	A0A2H4JBV9	uncultured_Caudovirales_phage	100.0	3.6e-59
WP_065485642.1|5266435_5266771_-	alpha/beta hydrolase	NA	D2XR61	Bacillus_phage	89.2	6.8e-52
WP_065485644.1|5266794_5267103_-	hypothetical protein	NA	A0A288WFY9	Bacillus_phage	46.5	1.1e-16
WP_139359406.1|5267289_5267382_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065481512.1|5267508_5268765_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	60.2	5.8e-112
WP_065485646.1|5269687_5269963_-	hypothetical protein	NA	H0USV6	Bacillus_phage	52.7	2.0e-17
WP_065485648.1|5272312_5272531_-	hypothetical protein	NA	H0USV5	Bacillus_phage	66.2	5.2e-21
WP_065485650.1|5272990_5273272_-|integrase	tyrosine-type recombinase/integrase	integrase	W8CYP1	Bacillus_phage	88.0	1.0e-37
WP_065485652.1|5273268_5273757_-	ArpU family transcriptional regulator	NA	A0A1B0T6C9	Bacillus_phage	91.4	1.6e-78
WP_113732895.1|5274047_5274161_-	DUF3983 domain-containing protein	NA	A0A1B0T6D3	Bacillus_phage	77.8	4.2e-06
WP_065485654.1|5274465_5274678_-	hypothetical protein	NA	D2XR53	Bacillus_phage	57.5	2.4e-15
WP_065485656.1|5276656_5277193_-	dUTPase	NA	A0A2H4J4W9	uncultured_Caudovirales_phage	91.0	4.5e-90
WP_065485658.1|5277317_5277752_-	hypothetical protein	NA	A0A2H4JBD8	uncultured_Caudovirales_phage	94.4	1.5e-75
WP_139359406.1|5277939_5278032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065481512.1|5278158_5279415_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	60.2	5.8e-112
WP_065485659.1|5280152_5280383_-	hypothetical protein	NA	A0A1C8E9C2	Bacillus_phage	98.7	1.3e-33
WP_065485660.1|5280375_5280855_-	hypothetical protein	NA	A0A1C8E9A8	Bacillus_phage	95.6	6.9e-82
WP_065485661.1|5280866_5281820_-	DnaD domain protein	NA	A0A0S2MVA0	Bacillus_phage	89.9	2.1e-146
WP_065485662.1|5281913_5282252_-	hypothetical protein	NA	A0A0S2MVH7	Bacillus_phage	97.3	2.9e-50
WP_065485664.1|5282184_5282400_-	hypothetical protein	NA	A0A1C8E9A6	Bacillus_phage	91.5	6.7e-29
WP_000178946.1|5282399_5283113_-	hypothetical protein	NA	A0A0S2MV99	Bacillus_phage	99.6	1.9e-128
WP_000453492.1|5283130_5283565_-	hypothetical protein	NA	A0A0S2MVA8	Bacillus_phage	98.6	3.1e-73
WP_001187283.1|5283591_5283780_-	hypothetical protein	NA	A0A2H4J4V8	uncultured_Caudovirales_phage	62.9	2.6e-13
WP_065485666.1|5283791_5284553_-	antirepressor	NA	A0A2H4JBC7	uncultured_Caudovirales_phage	93.3	2.0e-128
WP_065485668.1|5284731_5284920_-	hypothetical protein	NA	R9TQ08	Paenibacillus_phage	69.0	6.1e-18
WP_065485670.1|5284947_5285193_-	helix-turn-helix transcriptional regulator	NA	A0A1B2APZ4	Phage_Wrath	73.3	6.9e-22
WP_065485672.1|5285357_5285984_+	helix-turn-helix domain-containing protein	NA	A0A1B2APZ3	Phage_Wrath	63.2	5.5e-71
WP_065485674.1|5286071_5287115_+|integrase	site-specific integrase	integrase	A0A1J0MF14	Staphylococcus_phage	47.9	1.0e-93
WP_001118824.1|5287181_5288579_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_000009523.1|5288627_5289059_-	iron-sulfur cluster assembly scaffold protein SufU	NA	A0A0K1LS29	Mycobacterium_phage	37.6	1.5e-14
WP_001020767.1|5289048_5290269_-	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	47.6	2.3e-118
5289219:5289234	attR	CTACATCTAATACAGT	NA	NA	NA	NA
>prophage 23
NZ_CP015350	Bacillus thuringiensis strain MYBT18246 chromosome, complete genome	5867736	5363934	5439783	5867736	transposase,tail,holin,capsid,terminase,protease,portal,tRNA,integrase,head	Bacillus_phage(72.92%)	83	5399803:5399824	5437486:5437507
WP_094194456.1|5363934_5364979_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_001022535.1|5367765_5368686_-	Cys-Gln thioester bond-forming surface protein	NA	NA	NA	NA	NA
WP_000793561.1|5368797_5369637_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	56.1	6.4e-83
WP_000100584.1|5369653_5370868_-	MFS transporter	NA	NA	NA	NA	NA
WP_000760481.1|5371190_5371535_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001115309.1|5371970_5372411_+	DUF1641 domain-containing protein	NA	NA	NA	NA	NA
WP_000043199.1|5372455_5373634_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001021094.1|5373829_5375089_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	42.4	6.9e-89
WP_001057106.1|5375457_5376375_-	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_000573647.1|5376757_5377153_-	SET domain-containing protein	NA	NA	NA	NA	NA
WP_065485694.1|5377361_5378864_-	DUF4077 domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	56.1	6.0e-07
WP_065485695.1|5378896_5379955_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_001986875.1|5380271_5380706_+	fluoride efflux transporter CrcB	NA	NA	NA	NA	NA
WP_000568581.1|5380702_5381059_+	fluoride efflux transporter CrcB	NA	NA	NA	NA	NA
WP_000980930.1|5381088_5381328_-	DUF3947 family protein	NA	NA	NA	NA	NA
WP_078994137.1|5381407_5381659_-	DUF3955 domain-containing protein	NA	NA	NA	NA	NA
WP_065485696.1|5381775_5382291_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000834709.1|5382432_5382837_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_016079776.1|5382886_5383843_-	NERD domain-containing protein	NA	NA	NA	NA	NA
WP_065485697.1|5384319_5384877_+	cysteine hydrolase	NA	A0A1V0SL12	Klosneuvirus	27.7	4.2e-06
WP_003313360.1|5384917_5385352_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_065485698.1|5385708_5386674_+	DUF4822 domain-containing protein	NA	NA	NA	NA	NA
WP_000608841.1|5386772_5387204_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000409981.1|5387193_5387490_-	transporter suffix domain-containing protein	NA	NA	NA	NA	NA
WP_000576726.1|5387685_5389224_-	anthrolysin O/cereolysin O family cholesterol-dependent cytolysin	NA	NA	NA	NA	NA
WP_000590061.1|5389648_5390401_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_065485699.1|5390397_5391462_-	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_000042077.1|5391458_5392475_-	iron chelate uptake ABC transporter family permease subunit	NA	A0A2H4IY97	uncultured_Caudovirales_phage	36.8	3.0e-58
WP_000749445.1|5392494_5393511_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_065485700.1|5393893_5394574_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_016123739.1|5395069_5395837_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001123920.1|5396644_5397112_-	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	63.2	5.4e-47
WP_065485702.1|5397238_5399671_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	40.4	1.4e-90
5399803:5399824	attL	GCAACTAGATCTTACCAATCTA	NA	NA	NA	NA
WP_065485703.1|5400163_5401039_+	cytosolic protein	NA	I7ILW0	Bacillus_phage	77.1	1.2e-113
WP_065485705.1|5401041_5401650_-	hypothetical protein	NA	A0A0S2GLL8	Bacillus_phage	80.1	9.3e-92
WP_065485707.1|5401639_5402806_-	DNA translocase FtsK	NA	W8CYG2	Bacillus_phage	80.4	1.4e-181
WP_065485708.1|5402816_5403137_-	hypothetical protein	NA	A0A0S2GLK1	Bacillus_phage	67.0	1.4e-33
WP_060852440.1|5403600_5403825_+	helix-turn-helix transcriptional regulator	NA	A0A1B1P883	Bacillus_phage	78.4	7.7e-28
WP_065485710.1|5405024_5405222_+	hypothetical protein	NA	A0A1B0T6A3	Bacillus_phage	83.1	7.5e-19
WP_065485711.1|5405312_5406065_-	N-acetylmuramoyl-L-alanine amidase	NA	S5M842	Bacillus_phage	78.7	1.8e-73
WP_065486106.1|5406064_5406271_-	hypothetical protein	NA	D2XR32	Bacillus_phage	84.8	1.6e-27
WP_065485712.1|5406279_5406561_-	hypothetical protein	NA	D2XR31	Bacillus_phage	79.1	4.5e-33
WP_065485713.1|5406626_5406851_-	hypothetical protein	NA	A0A1B1P780	Bacillus_phage	86.3	2.5e-26
WP_065485715.1|5408345_5410751_-	endopeptidase	NA	A0A1B1P770	Bacillus_phage	83.4	0.0e+00
WP_065485716.1|5410747_5411431_-|tail	phage tail protein	tail	A0A1B0T6A0	Bacillus_phage	94.7	1.6e-124
WP_065485717.1|5411431_5414956_-|tail	phage tail tape measure protein	tail	A0A1B1P7P9	Bacillus_phage	93.9	0.0e+00
WP_006927278.1|5414972_5415161_-	hypothetical protein	NA	A0A1C8E979	Bacillus_phage	98.4	8.2e-31
WP_065485718.1|5415199_5415586_-	hypothetical protein	NA	A0A1C8E984	Bacillus_phage	97.7	1.8e-64
WP_065485719.1|5415597_5416233_-|tail	phage tail protein	tail	A0A1C8E980	Bacillus_phage	96.7	2.2e-112
WP_065485721.1|5416244_5416622_-	HK97 gp10 family phage protein	NA	A0A1B1P7P3	Bacillus_phage	97.6	5.6e-63
WP_065485723.1|5416621_5416951_-	hypothetical protein	NA	A0A2H4JFJ3	uncultured_Caudovirales_phage	89.9	3.0e-52
WP_065485725.1|5416940_5417273_-	hypothetical protein	NA	A0A1C8E986	Bacillus_phage	94.4	2.3e-52
WP_065485727.1|5417250_5417511_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1B2APX3	Phage_Wrath	84.9	9.6e-38
WP_065485728.1|5417525_5417825_-	collagen-like protein	NA	NA	NA	NA	NA
WP_065485730.1|5417893_5419210_-|capsid	phage major capsid protein	capsid	A0A1C8E976	Bacillus_phage	92.9	3.6e-197
WP_065485732.1|5419211_5419793_-|head,protease	HK97 family phage prohead protease	head,protease	A0A1C8EA63	Bacillus_phage	96.4	2.7e-96
WP_065485733.1|5419782_5420049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065485735.1|5420023_5421226_-|portal	phage portal protein	portal	A0A1C8E972	Bacillus_phage	96.6	1.0e-214
WP_065485736.1|5421241_5422966_-|terminase	terminase large subunit	terminase	A0A1C8E985	Bacillus_phage	92.0	0.0e+00
WP_065485738.1|5422962_5423388_-|terminase	P27 family phage terminase small subunit	terminase	A0A1C8E969	Bacillus_phage	93.6	3.5e-69
WP_065485739.1|5423471_5423864_-	HNH endonuclease	NA	A0A2H4JFG4	uncultured_Caudovirales_phage	90.0	6.0e-68
WP_065485740.1|5423860_5424154_-	hypothetical protein	NA	A0A1B1P7N8	Bacillus_phage	76.3	8.6e-35
WP_065485744.1|5425455_5425968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065485746.1|5425979_5426252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065485748.1|5426657_5427200_-|integrase	site-specific integrase	integrase	A0A1B0T6D2	Bacillus_phage	93.9	3.5e-90
WP_065485749.1|5427196_5427682_-	ArpU family transcriptional regulator	NA	H0USV3	Bacillus_phage	80.7	9.4e-71
WP_127064183.1|5427984_5428098_-	DUF3983 domain-containing protein	NA	A0A1B0T6D3	Bacillus_phage	86.5	9.9e-08
WP_065485750.1|5428313_5428517_+	hypothetical protein	NA	A0A2H4J3A3	uncultured_Caudovirales_phage	65.4	3.2e-12
WP_065485752.1|5428641_5429451_-	phage antirepressor KilAC domain-containing protein	NA	A0A2H4JAT4	uncultured_Caudovirales_phage	52.5	5.2e-74
WP_065485753.1|5429484_5429652_-	DUF3954 domain-containing protein	NA	A0A0S2GLF5	Bacillus_phage	63.0	2.3e-13
WP_065485754.1|5429690_5429957_-	hypothetical protein	NA	A0A0S2GLK4	Bacillus_phage	59.1	9.8e-22
WP_065485755.1|5429953_5430241_-	hypothetical protein	NA	A0A1B1P7W1	Bacillus_phage	48.4	6.0e-17
WP_065485757.1|5430254_5431118_-	ATP-binding protein	NA	A0A1B0T6C3	Bacillus_phage	63.7	1.5e-90
WP_065485758.1|5431068_5431887_-	replication protein	NA	A0A1P8VVR3	Streptococcus_phage	45.7	6.8e-21
WP_023523419.1|5432956_5433145_-	helix-turn-helix transcriptional regulator	NA	W8CYN7	Bacillus_phage	90.3	5.7e-24
WP_065485760.1|5433212_5433419_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_065485279.1|5433588_5433924_+	helix-turn-helix transcriptional regulator	NA	H0UST7	Bacillus_phage	44.3	2.4e-17
WP_065485764.1|5434339_5435533_-	helix-turn-helix transcriptional regulator	NA	A0A0U3TNF6	Bacillus_phage	51.4	2.1e-108
WP_065485766.1|5436373_5437435_+|integrase	site-specific integrase	integrase	H0UST3	Bacillus_phage	74.8	4.6e-155
WP_000976874.1|5437496_5438240_-	carboxylesterase	NA	NA	NA	NA	NA
5437486:5437507	attR	GCAACTAGATCTTACCAATCTA	NA	NA	NA	NA
WP_000557266.1|5438397_5438631_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_000078304.1|5438725_5439418_-	LrgB family protein	NA	NA	NA	NA	NA
WP_000673222.1|5439414_5439783_-|holin	CidA/LrgA family holin-like protein	holin	NA	NA	NA	NA
>prophage 24
NZ_CP015350	Bacillus thuringiensis strain MYBT18246 chromosome, complete genome	5867736	5471825	5545440	5867736	transposase,holin,tail,capsid,terminase,protease,portal,head,bacteriocin,plate	Bacillus_phage(45.24%)	77	NA	NA
WP_001267308.1|5471825_5472206_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_000394744.1|5472321_5472771_-	DUF4275 family protein	NA	NA	NA	NA	NA
WP_065485787.1|5472830_5475707_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	57.1	0.0e+00
WP_000400987.1|5475712_5477689_-	excinuclease ABC subunit B	NA	NA	NA	NA	NA
WP_065485789.1|5477840_5478272_-	DUF4362 domain-containing protein	NA	NA	NA	NA	NA
WP_000025200.1|5478316_5478937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000260342.1|5478933_5479695_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000524131.1|5479796_5480024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000538364.1|5480171_5480369_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_023523453.1|5480666_5481689_-	YeiH family putative sulfate export transporter	NA	NA	NA	NA	NA
WP_053563369.1|5481839_5482733_+	LysR family transcriptional regulator	NA	A0A2H4J8I9	uncultured_Caudovirales_phage	42.5	2.5e-08
WP_065481512.1|5482906_5484163_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	60.2	5.8e-112
WP_139359406.1|5484289_5484382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001219212.1|5484569_5484938_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000497599.1|5484942_5485482_+	flavodoxin family protein	NA	NA	NA	NA	NA
WP_023523456.1|5485490_5485850_+	macrolide efflux pump	NA	NA	NA	NA	NA
WP_000637523.1|5485950_5486262_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000944629.1|5486327_5488043_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	31.4	9.1e-60
WP_016085217.1|5488355_5489558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065485791.1|5489649_5491134_-	PDZ domain-containing protein	NA	A0A0R6PIZ1	Moraxella_phage	27.4	1.1e-21
WP_065485793.1|5491204_5492098_-	cell division ABC transporter permease FtsX	NA	NA	NA	NA	NA
WP_000594319.1|5492087_5492774_-	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	37.9	4.1e-27
WP_000727971.1|5493059_5493383_-	cytochrome c-551	NA	NA	NA	NA	NA
WP_098852422.1|5493822_5494921_-	peptide chain release factor 2	NA	NA	NA	NA	NA
WP_000579372.1|5495065_5497573_-	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
WP_000671189.1|5497845_5498388_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_001990088.1|5498711_5498909_-	cold shock protein CspC	NA	Q9AZD3	Lactococcus_phage	67.7	9.8e-19
WP_071713846.1|5499035_5499740_-	ComF family protein	NA	NA	NA	NA	NA
WP_065485795.1|5500911_5501739_+	cytosolic protein	NA	A0A2H4J6G7	uncultured_Caudovirales_phage	80.2	7.9e-118
WP_065485797.1|5501873_5502584_-	DUF1282 family protein	NA	NA	NA	NA	NA
WP_065485799.1|5502696_5503896_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_000631624.1|5503892_5504573_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.1	6.9e-35
WP_065485801.1|5504569_5505763_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_006922886.1|5506044_5506368_+|bacteriocin	circular bacteriocin, circularin A/uberolysin family	bacteriocin	NA	NA	NA	NA
WP_065485804.1|5506451_5508158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006922881.1|5508162_5508672_+	stage II sporulation protein M	NA	NA	NA	NA	NA
WP_065485806.1|5508685_5509234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065485808.1|5509223_5509862_+	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_065485809.1|5510216_5511269_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1C8E990	Bacillus_phage	90.0	1.6e-184
WP_033692567.1|5511265_5511496_-|bacteriocin	bacteriocin biosynthesis protein	bacteriocin	A0A1B1P7Q9	Bacillus_phage	97.4	3.7e-33
WP_065485810.1|5511559_5512825_-|plate	BppU family phage baseplate upper protein	plate	A0A1B0T696	Bacillus_phage	75.0	3.7e-175
WP_065485811.1|5512839_5515182_-	endopeptidase	NA	A0A1B1P7P0	Bacillus_phage	96.7	0.0e+00
WP_065485813.1|5515178_5515862_-|tail	phage tail protein	tail	A0A1B1P7Q0	Bacillus_phage	96.0	1.2e-124
WP_065485815.1|5515863_5519154_-|tail	phage tail tape measure protein	tail	A0A1B1P7P9	Bacillus_phage	81.4	1.1e-295
WP_065485817.1|5519397_5519784_-	hypothetical protein	NA	A0A2H4J956	uncultured_Caudovirales_phage	82.8	1.1e-53
WP_065485819.1|5519802_5520447_-|tail	phage tail protein	tail	A0A1B1P7Q4	Bacillus_phage	86.1	3.6e-102
WP_065485820.1|5520458_5520836_-	HK97 gp10 family phage protein	NA	A0A2H4JDG0	uncultured_Caudovirales_phage	80.0	4.9e-51
WP_065482650.1|5520835_5521165_-	hypothetical protein	NA	A0A1B0T6B7	Bacillus_phage	85.3	8.4e-47
WP_065485821.1|5521154_5521487_-|head,tail	head-tail adaptor protein	head,tail	A0A1C8E986	Bacillus_phage	87.0	1.5e-48
WP_065485826.1|5521464_5521725_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1B2APX3	Phage_Wrath	88.4	4.3e-38
WP_065485829.1|5521739_5522057_-	collagen-like protein	NA	NA	NA	NA	NA
WP_065485831.1|5522125_5523445_-|capsid	phage major capsid protein	capsid	A0A1C8E976	Bacillus_phage	95.6	5.2e-180
WP_065485833.1|5523446_5524028_-|head,protease	HK97 family phage prohead protease	head,protease	A0A1B1P7P1	Bacillus_phage	89.0	5.4e-89
WP_065485835.1|5524017_5525202_-|portal	phage portal protein	portal	A0A1C8E972	Bacillus_phage	97.4	4.8e-217
WP_065485836.1|5525217_5526942_-|terminase	terminase large subunit	terminase	A0A1C8E985	Bacillus_phage	92.5	0.0e+00
WP_065485837.1|5526938_5527364_-|terminase	P27 family phage terminase small subunit	terminase	A0A1C8E969	Bacillus_phage	92.9	2.9e-68
WP_065485838.1|5527467_5527842_-	HNH endonuclease	NA	A0A1C8E9C7	Bacillus_phage	87.8	1.9e-63
WP_065486108.1|5528865_5529849_-	class A beta-lactamase	NA	NA	NA	NA	NA
WP_065486110.1|5530248_5530644_-	hypothetical protein	NA	A0A2H4JFW6	uncultured_Caudovirales_phage	77.9	2.1e-52
WP_094194592.1|5530738_5531230_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_065485839.1|5531828_5532368_-	nuclease	NA	A0A0S2SXQ1	Bacillus_phage	53.7	2.3e-49
WP_065485840.1|5532364_5532799_-	hypothetical protein	NA	A0A2H4JFQ6	uncultured_Caudovirales_phage	68.1	1.3e-55
WP_065485842.1|5533063_5535436_-	DNA primase	NA	A0A1B2AQ05	Phage_Wrath	68.4	5.2e-311
WP_065485843.1|5535508_5535988_-	DUF669 domain-containing protein	NA	A0A1B2AQ07	Phage_Wrath	45.6	2.8e-27
WP_065485844.1|5536007_5536532_-	hypothetical protein	NA	A0A0C5K996	Enterococcus_phage	46.0	7.4e-37
WP_065485849.1|5536524_5537208_-	AAA family ATPase	NA	A0A1B2AQ06	Phage_Wrath	89.0	1.1e-109
WP_065485851.1|5537213_5537405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023523491.1|5537875_5538226_-	hypothetical protein	NA	A0A2H4JBP9	uncultured_Caudovirales_phage	86.2	2.3e-50
WP_065485855.1|5538400_5538634_-	hypothetical protein	NA	A0A1B1P7N2	Bacillus_phage	70.7	2.7e-23
WP_065485856.1|5538646_5538883_-	helix-turn-helix transcriptional regulator	NA	A0A2H4JE95	uncultured_Caudovirales_phage	89.7	9.3e-32
WP_065485859.1|5539079_5539736_+	helix-turn-helix domain-containing protein	NA	A0A1B1P7L1	Bacillus_phage	90.4	8.7e-112
WP_065486114.1|5539757_5541110_+	recombinase family protein	NA	A0A2H4J992	uncultured_Caudovirales_phage	82.6	3.1e-212
WP_065485861.1|5541142_5541544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065485862.1|5541670_5543101_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A2H4PQY6	Streptomyces_phage	37.2	2.0e-12
WP_000400857.1|5543249_5543564_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000684727.1|5543725_5544568_-	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	40.8	6.1e-17
WP_065485863.1|5544804_5545440_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	40.6	6.2e-38
>prophage 25
NZ_CP015350	Bacillus thuringiensis strain MYBT18246 chromosome, complete genome	5867736	5813320	5858204	5867736	transposase,holin,protease	Streptococcus_phage(14.29%)	38	NA	NA
WP_094194459.1|5813320_5814109_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_000104901.1|5814360_5814792_-|holin	antiholin-like murein hydrolase modulator LrgA	holin	NA	NA	NA	NA
WP_065486010.1|5814924_5815665_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_065481734.1|5816254_5817367_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_094194456.1|5820204_5821248_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_065486013.1|5821807_5823376_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	23.9	1.6e-15
WP_065486014.1|5823737_5824808_-	nitric oxide synthase oxygenase	NA	NA	NA	NA	NA
WP_000094037.1|5825025_5825652_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	53.2	2.6e-57
WP_043924732.1|5825740_5826634_-	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_000540540.1|5826730_5827321_-	acetamide transporter	NA	NA	NA	NA	NA
WP_016079559.1|5827692_5828094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065486015.1|5828664_5829681_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	51.9	2.1e-96
WP_001099728.1|5829865_5830513_-	hemolysin III family protein	NA	NA	NA	NA	NA
WP_029443708.1|5830677_5831238_+	DUF1836 domain-containing protein	NA	NA	NA	NA	NA
WP_065486016.1|5831278_5832724_-	ATP-dependent RNA helicase DbpA	NA	A0A1V0SBR7	Catovirus	34.4	2.2e-59
WP_000432447.1|5833198_5834182_+	GMP reductase	NA	G3MBI2	Bacillus_virus	84.7	3.4e-160
WP_065486018.1|5834288_5836106_+	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	38.2	1.4e-119
WP_000713633.1|5836143_5837022_-	radical SAM protein	NA	NA	NA	NA	NA
WP_001027003.1|5839054_5839534_-	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_001052833.1|5839593_5839779_-	CxxH/CxxC protein	NA	NA	NA	NA	NA
WP_065486019.1|5839832_5841008_-|protease	serine protease	protease	W5SAB9	Pithovirus	31.9	1.0e-09
WP_065486021.1|5841071_5841866_-	MBL fold metallo-hydrolase	NA	A0A0C5AJ83	Bacteriophage	35.3	6.1e-43
WP_000383720.1|5841849_5842692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000061569.1|5842672_5843989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000755367.1|5843985_5845827_-	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	35.0	8.9e-37
WP_000971865.1|5845830_5846538_-	cell wall metabolism DNA-binding response regulator WalR	NA	W8CYM9	Bacillus_phage	42.7	7.6e-45
WP_000100230.1|5847331_5848621_-	adenylosuccinate synthase	NA	L7Y4J5	Megavirus	36.2	9.5e-70
WP_001286147.1|5848836_5850186_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	52.3	2.5e-121
WP_000864223.1|5850213_5850660_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_001113779.1|5850656_5852630_-	DHH family phosphoesterase	NA	NA	NA	NA	NA
WP_000814844.1|5852708_5853644_-	YybS family protein	NA	NA	NA	NA	NA
WP_000918873.1|5853724_5853958_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_065486023.1|5854003_5854525_-	single-stranded DNA-binding protein	NA	A0A290GHL8	Caldibacillus_phage	61.8	1.8e-51
WP_001233781.1|5854551_5854842_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_000524670.1|5855033_5856134_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_000435486.1|5856249_5856447_-	DUF951 domain-containing protein	NA	NA	NA	NA	NA
WP_065486025.1|5856467_5857349_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_001020708.1|5857607_5858204_+|protease	spore protease YyaC	protease	A0A0A8WIQ6	Clostridium_phage	39.4	2.8e-24
>prophage 1
NZ_CP015356	Bacillus thuringiensis strain MYBT18246 plasmid p101287, complete sequence	101287	9803	65012	101287	transposase	Bacillus_phage(15.38%)	44	NA	NA
WP_094194461.1|9803_10593_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_065487013.1|13481_14300_+	5'-nucleotidase, lipoprotein e(P4) family	NA	NA	NA	NA	NA
WP_094194713.1|15071_16784_+	ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	25.6	3.0e-18
WP_065487015.1|16776_18561_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.7	9.5e-52
WP_065487017.1|18827_19373_-	topology modulation protein	NA	A0A097BYE2	Leuconostoc_phage	42.1	5.1e-33
WP_065487020.1|19441_20764_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	40.6	2.9e-90
WP_094194704.1|20885_21689_-	glutamate ligase	NA	NA	NA	NA	NA
WP_094194705.1|21678_22545_-	TIM barrel protein	NA	NA	NA	NA	NA
WP_065487022.1|22541_23408_-	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_065487024.1|23722_24748_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_065487026.1|24731_25991_+	S-adenosylmethionine synthetase	NA	NA	NA	NA	NA
WP_065487028.1|26013_26967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065487030.1|26963_28037_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_065487032.1|28071_29289_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_065487034.1|29388_30570_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_001224536.1|33977_34601_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	29.3	9.8e-12
WP_065487036.1|35226_35478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065481872.1|36273_37710_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_065487040.1|38023_38185_+	DUF3797 domain-containing protein	NA	A0A0H3UYX0	Geobacillus_virus	62.3	1.1e-15
WP_065487043.1|38425_38932_+	zinc-finger domain-containing protein	NA	A0A2H4JAV2	uncultured_Caudovirales_phage	29.9	1.7e-09
WP_065487045.1|40082_40511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065487048.1|40747_41032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094194706.1|41464_41860_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_065487052.1|42899_43268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094194714.1|43566_43872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094194707.1|43928_45097_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.4	6.2e-60
WP_094194709.1|45506_46295_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_065487055.1|46495_46768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065487056.1|46949_47576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065487058.1|47949_48267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065487060.1|48266_49043_-	ParA family protein	NA	A0A1X9I765	Streptococcus_phage	44.0	5.4e-44
WP_065481853.1|49448_50705_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	60.8	2.3e-113
WP_157686202.1|50900_51071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065487062.1|51144_51351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065487064.1|51406_51781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065487066.1|51942_52233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065487069.1|53173_54613_+	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_065486618.1|55244_56906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065486616.1|57387_58029_-	recombinase family protein	NA	A0A1B0VBM1	Salmonella_phage	32.7	1.8e-13
WP_065486387.1|58388_59036_+	VanZ family protein	NA	NA	NA	NA	NA
WP_065487071.1|59680_60943_+|transposase	IS21 family transposase	transposase	A0A059NT83	Lactococcus_phage	30.8	8.2e-42
WP_065487073.1|61038_62451_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_065487076.1|62602_63355_+	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	46.1	2.7e-56
WP_065487078.1|63599_65012_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP015355	Bacillus thuringiensis strain MYBT18246 plasmid p109822, complete sequence	109822	3747	79003	109822	integrase,tRNA,transposase	Streptococcus_phage(72.73%)	57	32259:32318	80184:80865
WP_065484856.1|3747_4455_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.9	5.3e-38
WP_065486867.1|4914_5577_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	58.6	4.1e-69
WP_065486869.1|5643_5931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065486870.1|5977_6883_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_065486872.1|7179_7887_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.0	1.5e-37
WP_065486874.1|8119_8806_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	63.4	9.5e-77
WP_065486878.1|10445_11675_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	47.4	1.5e-80
WP_065486880.1|12040_13363_+	HBL/NHE enterotoxin family protein	NA	NA	NA	NA	NA
WP_065486882.1|13599_14808_+	HBL/NHE enterotoxin family protein	NA	NA	NA	NA	NA
WP_065486884.1|15047_16133_+	HBL/NHE enterotoxin family protein	NA	NA	NA	NA	NA
WP_065486886.1|17064_17346_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_065486888.1|17482_18583_-	endospore germination permease	NA	NA	NA	NA	NA
WP_065486890.1|18617_19802_-	Ger(x)C family spore germination protein	NA	NA	NA	NA	NA
WP_065486892.1|19801_21340_-	spore germination protein	NA	NA	NA	NA	NA
WP_065486874.1|22083_22770_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	63.4	9.5e-77
WP_157686196.1|22853_23876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065486894.1|23917_25096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065486895.1|25192_25522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065486874.1|26117_26804_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	63.4	9.5e-77
WP_065486896.1|27201_27414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065486898.1|28148_28790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065486874.1|29429_30116_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	63.4	9.5e-77
WP_065486901.1|30372_30921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157686201.1|31224_31923_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	35.7	6.8e-22
32259:32318	attL	GGTTCTGTTGCAAAGTTTTCTAAATGAGACTACACTCTAGAAAAAAGAGTAAGGAGAATC	NA	NA	NA	NA
WP_065486905.1|32322_33015_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	65.4	1.1e-72
WP_065486907.1|33453_34002_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_065486909.1|33958_34489_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065486913.1|35897_36143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065486915.1|36504_37944_+	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_157686197.1|38073_38331_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_065486874.1|38396_39083_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	63.4	9.5e-77
WP_065486917.1|39152_39617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065486919.1|40533_41220_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	62.9	3.6e-76
WP_065486920.1|41619_42531_-	HBL/NHE enterotoxin family protein	NA	NA	NA	NA	NA
WP_065486996.1|42728_43868_-	alpha-helical pore-forming toxin family protein	NA	NA	NA	NA	NA
WP_065486922.1|44218_45442_-	alpha-helical pore-forming toxin family protein	NA	NA	NA	NA	NA
WP_065486923.1|45488_46796_-	HBL/NHE enterotoxin family protein	NA	NA	NA	NA	NA
WP_065486925.1|48404_49853_+	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_065486927.1|51445_52132_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	63.4	9.5e-77
WP_065486929.1|52555_53746_-	peptidase C1	NA	A0A2L2DJ06	Acanthamoeba_polyphaga_mimivirus	26.6	4.0e-14
WP_065486931.1|54949_55375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065486933.1|55376_56564_-	ParM/StbA family protein	NA	NA	NA	NA	NA
WP_065486937.1|59885_60440_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_065486874.1|60837_61524_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	63.4	9.5e-77
WP_065486939.1|61954_64582_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_157686198.1|64604_65291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065486943.1|65954_67277_+	MFS transporter	NA	NA	NA	NA	NA
WP_065486945.1|67787_69227_+	NADP-dependent glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_065486947.1|69488_70232_+	SDR family oxidoreductase	NA	A0A2P0VP75	Tetraselmis_virus	28.7	4.1e-09
WP_065486874.1|70491_71177_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	63.4	9.5e-77
WP_094194456.1|72499_73543_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	29.8	7.1e-31
WP_065486954.1|73668_73875_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_065486956.1|73999_74635_+	helix-turn-helix transcriptional regulator	NA	S5MCH5	Brevibacillus_phage	32.3	2.4e-13
WP_065486874.1|74860_75548_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	63.4	9.5e-77
WP_065486958.1|75613_76615_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_065486960.1|77020_78205_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A142F1N9	Bacillus_phage	23.7	8.9e-06
WP_065486962.1|78295_79003_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.5	4.0e-38
80184:80865	attR	GGTTCTGTTGCAAAGTTTTCTAAATGAGACTACACTCTAGAAAAAAGAGTAAGGAGAATCACAAATGCGATATTTTAAAGGGAAACAGTTCAAAAAAGATATTATTTTGGTAGCCGTTGGCTACTATTGTCGCTTTTCTTTAAGCTATCGTGATGTCTCTGAAATTTTGAACGAACGTGGTATTTCCGTTCATCCAACAACGATTATGCGCTGGGTTCATGAATATGGCCACCTGATCTATCAAATTTGGAAGAAGAAAAATAAAAGCGTACAACTATCTTGGAAATTGGATGAGACTTATATAAAAGTCAAAGGGGAATGGCGTTACCTGTATCGTGCAATTGATAAAGAAGGGTACACATTGGATATTCAACTTCGTAAAAAACGGAATCATCAGGCTGCATATGCCTTTATGAAAAGGTTAGTAAAAACATTTGGGGAACCAACGGTTCTAACAACAGACAAAGCACCAGCGTTACTATGTGCATTTAAGAAATTAAAAGAAGAAGGTCTTTATAAACACACAAATCATTGTACAGTCAAATATTTGAACAATCTTATCGAACAAGATCATAGGCATATAAAACGGCGTTTTGCTAAATCCGCAGGATTTCAAAGTATTCGTCACGCTTCACGTACTTTGAAAGGAATTGAAACCGTTCATGCTCTATATAAGAAAAAC	NA	NA	NA	NA
>prophage 1
NZ_CP015354	Bacillus thuringiensis strain MYBT18246 plasmid p120416, complete sequence	120416	9994	85740	120416	integrase,transposase	Bacillus_phage(35.0%)	59	13639:13654	82723:82738
WP_065486151.1|9994_10681_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	59.0	2.4e-72
WP_065486148.1|11459_12038_+	recombinase family protein	NA	A0A219Y9V9	Aeromonas_phage	39.7	1.4e-28
WP_065486707.1|12373_12562_-	DUF2187 family protein	NA	NA	NA	NA	NA
WP_065486709.1|12809_13127_+	hypothetical protein	NA	A0A2H4JAV2	uncultured_Caudovirales_phage	42.1	7.4e-16
13639:13654	attL	CACTTGTTTTAGAAAT	NA	NA	NA	NA
WP_065486711.1|13955_15467_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_065486849.1|15466_16207_+	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	37.5	8.8e-36
WP_065486713.1|16765_17209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094194689.1|17736_19335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065486715.1|19564_20623_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_157686194.1|20664_21864_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_065486853.1|22342_23470_+	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_000070738.1|24971_25859_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_065486719.1|26098_27535_+	DUF2252 family protein	NA	NA	NA	NA	NA
WP_065486721.1|28135_28894_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	46.2	4.6e-56
WP_065486723.1|28907_29300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065486151.1|29379_30066_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	59.0	2.4e-72
WP_065486854.1|30222_30477_-	SET domain-containing protein	NA	NA	NA	NA	NA
WP_065486725.1|31670_32789_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_065486727.1|33709_34282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065486728.1|38480_39404_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_065486730.1|39843_40503_-	recombinase family protein	NA	A0A1B0VBM1	Salmonella_phage	33.5	2.0e-15
WP_157686195.1|42579_43758_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_065486732.1|43892_46766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065486734.1|47222_47774_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	48.3	6.3e-39
WP_065486736.1|47956_50929_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	24.0	4.4e-70
WP_065486741.1|53255_53570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065486744.1|53751_54345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065486747.1|54358_55513_-	glycoside hydrolase	NA	A0A1S5SEZ8	Streptococcus_phage	36.0	3.7e-49
WP_065486749.1|55575_58020_-	Isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_065486752.1|58016_58529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065486754.1|58588_61171_-	recombinase RmuC	NA	A0A1S5SF64	Streptococcus_phage	28.1	1.1e-85
WP_065486755.1|61130_61679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078176905.1|61697_61946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065486758.1|61967_62939_-	conjugal transfer protein	NA	NA	NA	NA	NA
WP_065486760.1|62985_63360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065486762.1|63428_63662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065486856.1|63683_63905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065486765.1|63916_64123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065486767.1|64127_64967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065486769.1|64973_67811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065486771.1|67846_68059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065486773.1|68126_68357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065486243.1|69433_71254_-	hypothetical protein	NA	A0A0U4J920	Pseudomonas_phage	29.0	2.3e-29
WP_065486777.1|73390_73621_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_094194690.1|73755_74157_+	helix-turn-helix transcriptional regulator	NA	A0A1J0MG99	Staphylococcus_phage	41.3	4.6e-07
WP_157686192.1|74406_74580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065486778.1|74582_75764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065486779.1|76218_77199_+	Replicase RepFR55	NA	NA	NA	NA	NA
WP_065486781.1|78324_79260_+|integrase	site-specific integrase	integrase	A0A1B1P793	Bacillus_phage	45.3	6.3e-71
WP_065486859.1|79471_79966_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_065486783.1|80226_81285_+	ParM/StbA family protein	NA	A0A1B1P8B7	Bacillus_phage	34.0	3.9e-45
WP_065486786.1|81253_81631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065486788.1|81668_82139_-	DUF559 domain-containing protein	NA	NA	NA	NA	NA
WP_065486790.1|82650_82875_+	helix-turn-helix transcriptional regulator	NA	A0A1B1P883	Bacillus_phage	39.2	3.2e-05
82723:82738	attR	ATTTCTAAAACAAGTG	NA	NA	NA	NA
WP_065486792.1|82937_83156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065486794.1|83169_83826_-	hypothetical protein	NA	A0A1B1P7T2	Bacillus_phage	65.7	2.8e-78
WP_065486796.1|83809_84982_-	DNA translocase FtsK	NA	W8CYG2	Bacillus_phage	72.4	2.8e-161
WP_065486797.1|84988_85312_-	hypothetical protein	NA	A0A1B1P7T1	Bacillus_phage	70.1	6.1e-34
WP_065486799.1|85323_85740_-	hypothetical protein	NA	A0A1B1P7T3	Bacillus_phage	73.0	2.5e-48
>prophage 1
NZ_CP015353	Bacillus thuringiensis strain MYBT18246 plasmid p120510, complete sequence	120510	9224	56438	120510	transposase	Bacillus_phage(54.55%)	45	NA	NA
WP_065486542.1|9224_10637_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_023523644.1|11222_12398_+	ParM/StbA family protein	NA	NA	NA	NA	NA
WP_065486543.1|12440_12854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155251536.1|13112_13259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065486544.1|13255_14356_-	tetratricopeptide repeat protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	39.9	5.1e-64
WP_065486546.1|14912_15209_+	hypothetical protein	NA	H0USY0	Bacillus_phage	43.2	1.6e-12
WP_000156991.1|15210_15396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065486548.1|15497_16679_+	cell division protein FtsK	NA	H0USY1	Bacillus_phage	56.1	3.2e-128
WP_043924922.1|16617_17235_+	hypothetical protein	NA	H0USY2	Bacillus_phage	44.7	2.1e-35
WP_016112081.1|17252_17477_-	helix-turn-helix transcriptional regulator	NA	A0A0S2MVM0	Bacillus_phage	50.7	7.8e-12
WP_065486550.1|18338_18560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157686183.1|18757_18973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065486552.1|18956_19481_-	NADH dehydrogenase	NA	NA	NA	NA	NA
WP_065486554.1|19537_20752_-	PcfB family protein	NA	NA	NA	NA	NA
WP_065486686.1|20992_21724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065486556.1|21739_23056_+	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_065486558.1|23232_23439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065486560.1|23467_23995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065486562.1|24264_25377_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_065486563.1|26070_27024_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_065484856.1|27227_27935_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.9	5.3e-38
WP_065486564.1|27940_28540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157686184.1|30747_31293_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_065486567.1|32018_32714_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	38.1	3.1e-35
WP_065486569.1|32710_34495_+	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	32.3	2.1e-27
WP_065486571.1|34678_35521_+	polysaccharide deacetylase	NA	NA	NA	NA	NA
WP_065486572.1|35613_36309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065486574.1|36716_37406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065486576.1|37486_38893_+	MBOAT family protein	NA	A0A125RNP0	Pseudomonas_phage	32.1	2.8e-59
WP_065486577.1|38945_40085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065486579.1|40245_40743_+	DUF4358 domain-containing protein	NA	NA	NA	NA	NA
WP_065486580.1|41647_42463_-	5'-nucleotidase, lipoprotein e(P4) family	NA	NA	NA	NA	NA
WP_065486582.1|43232_43718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157686185.1|43949_44123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065486584.1|44171_44933_-	membrane protein insertase YidC	NA	NA	NA	NA	NA
WP_065486586.1|44925_45243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065486590.1|46227_48072_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_065486592.1|48088_48850_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.2	2.7e-32
WP_065486593.1|49724_51386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065486594.1|51870_52530_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	37.2	2.2e-22
WP_065486595.1|52846_53059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065486597.1|53299_54394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065486598.1|54642_54978_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065486599.1|55162_55450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065486601.1|55496_56438_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP015352	Bacillus thuringiensis strain MYBT18246 plasmid p142098, complete sequence	142098	1924	68643	142098	transposase,integrase	Streptococcus_phage(50.0%)	56	26598:26621	67502:67525
WP_065486309.1|1924_2611_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	56.4	1.8e-67
WP_065486521.1|3236_4451_-	peptidase S8	NA	A0A1B0T6A2	Bacillus_phage	48.2	1.6e-90
WP_094194456.1|6212_7256_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	29.8	7.1e-31
WP_065486314.1|7492_8773_+	HBL/NHE enterotoxin family protein	NA	NA	NA	NA	NA
WP_065486316.1|8824_10021_+	HBL/NHE enterotoxin family protein	NA	NA	NA	NA	NA
WP_065486317.1|10726_10942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065486319.1|11387_11648_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_065486321.1|11712_13134_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_065486322.1|13350_13707_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_065486323.1|13882_14539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065486325.1|14587_14869_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	65.3	8.3e-11
WP_065486522.1|14934_15123_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_065486327.1|15150_15381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065486329.1|15410_15713_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_065486330.1|15771_16080_+	50S ribosomal protein L7ae	NA	NA	NA	NA	NA
WP_065486332.1|16494_17448_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_065486333.1|17811_18168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065486334.1|18315_18531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065486338.1|19580_20519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065481872.1|21024_22461_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_094194666.1|24123_25419_+	exosporium leader peptide-containing protein	NA	NA	NA	NA	NA
WP_065486341.1|25564_26272_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.4	2.4e-38
26598:26621	attL	ACATAAAATTTCACGTACCATATT	NA	NA	NA	NA
WP_065486342.1|26725_27631_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_065486344.1|28081_28705_+|transposase	IS6 family transposase	transposase	A0A1X9I6E7	Streptococcus_phage	46.1	1.7e-35
WP_065486346.1|28708_29395_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	59.0	1.4e-72
WP_065486348.1|29665_30013_-	YxeA family protein	NA	A0A0K2CYS5	Paenibacillus_phage	38.7	4.1e-12
WP_065486350.1|30075_31929_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_065486351.1|31945_32707_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.3	2.5e-33
WP_065486353.1|33268_33793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065486527.1|34409_34619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065486354.1|34667_35630_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_065486355.1|36600_37287_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	58.6	1.6e-71
WP_065486357.1|37353_37815_-	DUF4158 domain-containing protein	NA	NA	NA	NA	NA
WP_065486358.1|38379_39066_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	40.9	1.8e-43
WP_065486360.1|39062_40142_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	26.6	3.2e-18
WP_065486362.1|40546_41308_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.5	2.9e-34
WP_065486363.1|41324_43178_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_065486365.1|43542_43752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065486355.1|43878_44565_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	58.6	1.6e-71
WP_065485328.1|45006_46419_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_065486366.1|47008_47704_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	9.8e-37
WP_094194667.1|47911_49006_-	HBL/NHE enterotoxin family protein	NA	NA	NA	NA	NA
WP_065486369.1|49337_50465_-	HBL/NHE enterotoxin family protein	NA	NA	NA	NA	NA
WP_065486371.1|50523_51726_-	HBL/NHE enterotoxin family protein	NA	NA	NA	NA	NA
WP_065486373.1|52308_53661_-	HBL/NHE enterotoxin family protein	NA	NA	NA	NA	NA
WP_065486375.1|54015_54207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094194669.1|55157_55865_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_157686179.1|55722_56433_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.3	9.3e-51
WP_065486380.1|56582_57701_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_065486382.1|58304_58991_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	58.6	7.8e-71
WP_065486384.1|59095_60802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065486387.1|63698_64346_-	VanZ family protein	NA	NA	NA	NA	NA
WP_065486389.1|64821_65031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065486390.1|65063_66026_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_065486391.1|66402_67344_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_065484856.1|67935_68643_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.9	5.3e-38
67502:67525	attR	AATATGGTACGTGAAATTTTATGT	NA	NA	NA	NA
>prophage 2
NZ_CP015352	Bacillus thuringiensis strain MYBT18246 plasmid p142098, complete sequence	142098	83625	136243	142098	transposase	Bacillus_phage(37.5%)	59	NA	NA
WP_065486413.1|83625_83976_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_065486414.1|84472_84637_-	aspartyl-phosphate phosphatase Spo0E family protein	NA	NA	NA	NA	NA
WP_065486416.1|84750_85032_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	59.0	4.8e-11
WP_065486418.1|85055_85289_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_065486420.1|85345_85621_-	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	60.7	1.9e-20
WP_065484856.1|86108_86816_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.9	5.3e-38
WP_030030322.1|87324_87795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065486422.1|87857_88688_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_065486424.1|88733_89198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065486425.1|89384_89588_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016112095.1|89779_90274_+	helix-turn-helix transcriptional regulator	NA	A0A1W6JPS3	Staphylococcus_phage	41.3	3.4e-07
WP_065486426.1|90631_91861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065486427.1|92508_93009_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_065486431.1|93612_94794_+	ParM/StbA family protein	NA	NA	NA	NA	NA
WP_065486433.1|94849_95293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157686180.1|95609_95756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065486435.1|95752_96847_-	tetratricopeptide repeat protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	38.6	2.9e-67
WP_065486437.1|97313_97820_-	NADH dehydrogenase	NA	NA	NA	NA	NA
WP_065486439.1|97891_99094_-	DUF3801 domain-containing protein	NA	NA	NA	NA	NA
WP_065486441.1|99357_100068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065486443.1|100084_101407_+	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_016110577.1|101493_101694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061656495.1|101830_102127_+	hypothetical protein	NA	H0USY0	Bacillus_phage	43.7	4.9e-14
WP_065486445.1|102128_102314_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065486447.1|102415_103597_+	cell division protein FtsK	NA	H0USY1	Bacillus_phage	56.5	1.3e-126
WP_065486449.1|103535_104153_+	hypothetical protein	NA	Q2LIA9	Bacillus_phage	44.7	6.9e-34
WP_065486450.1|104157_104382_-	DNA-binding protein	NA	A0A0S2MVM0	Bacillus_phage	50.0	2.7e-12
WP_065486452.1|105224_105446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157686181.1|105681_105858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065486129.1|105900_106095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065486454.1|106084_106321_-	hypothetical protein	NA	A0A1B1P789	Bacillus_phage	35.4	4.6e-07
WP_065486131.1|106396_106624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065486456.1|107026_107356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065486457.1|107546_108089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065486459.1|108672_109710_-	hypothetical protein	NA	J7Q326	Aeropyrum_coil-shaped_virus	29.0	1.1e-15
WP_065486461.1|109723_109954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065486463.1|110183_111932_-	sulfate permease	NA	A0A2H4J153	uncultured_Caudovirales_phage	26.4	1.6e-40
WP_065486465.1|111959_112541_-	carbonic anhydrase	NA	NA	NA	NA	NA
WP_094194675.1|113113_113950_-	ribonuclease	NA	A0A2P0VMP9	Tetraselmis_virus	36.6	1.0e-24
WP_065486467.1|114311_115424_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_065486470.1|116070_116580_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_065486472.1|117402_119235_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_065486475.1|119251_120013_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.3	1.3e-34
WP_065486478.1|120701_121367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065486482.1|122243_123059_-	5'-nucleotidase, lipoprotein e(P4) family	NA	NA	NA	NA	NA
WP_065486485.1|123709_124195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065486531.1|124723_125260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065486488.1|125432_125804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065486490.1|126124_126586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065486493.1|126662_127184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065486495.1|127289_128681_+	alkaline phosphatase	NA	NA	NA	NA	NA
WP_065486499.1|129445_130087_-	recombinase family protein	NA	A0A1B0VBM1	Salmonella_phage	33.7	2.2e-14
WP_065486346.1|130566_131253_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	59.0	1.4e-72
WP_065486501.1|131415_132828_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_065486503.1|132923_133718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157686182.1|133805_133961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065486504.1|134172_134541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065486506.1|134876_135089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094194676.1|135453_136243_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP015360	Bacillus thuringiensis strain MYBT18246 plasmid p14456, complete sequence	14456	8483	14309	14456		Bacillus_phage(66.67%)	7	NA	NA
WP_065487315.1|8483_9803_-	replication protein	NA	B5LPT8	Bacillus_virus	63.0	7.3e-134
WP_065487316.1|10168_10699_+	DUF3967 domain-containing protein	NA	NA	NA	NA	NA
WP_065487318.1|10976_12008_+	ParM/StbA family protein	NA	A0A1B1P8B7	Bacillus_phage	84.0	4.2e-169
WP_065487320.1|11967_12294_+	peptidylprolyl isomerase	NA	D2XQ05	Bacillus_virus	64.8	3.4e-32
WP_065487322.1|12724_13756_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0A7AQV3	Bacillus_phage	72.6	2.7e-147
WP_065487324.1|13815_14025_-	hypothetical protein	NA	A0A0S2GM50	Bacillus_phage	69.4	1.2e-19
WP_065487325.1|14027_14309_-	hypothetical protein	NA	D2XR31	Bacillus_phage	78.0	1.0e-32
>prophage 1
NZ_CP015351	Bacillus thuringiensis strain MYBT18246 plasmid p150790, complete sequence	150791	4715	73421	150791	integrase,transposase,bacteriocin	Streptococcus_phage(30.43%)	56	25849:25908	46559:46644
WP_065486126.1|4715_5834_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_065486128.1|6176_6392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157686170.1|6625_6802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065486129.1|6844_7039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065486130.1|7028_7265_-	hypothetical protein	NA	A0A1B1P789	Bacillus_phage	35.4	4.6e-07
WP_065486131.1|7340_7568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029441146.1|7970_8300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139359406.1|9230_9323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065481512.1|9449_10706_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	60.2	5.8e-112
WP_094194644.1|10933_11425_-	zinc-finger domain-containing protein	NA	I7ILX4	Bacillus_phage	36.8	1.4e-08
WP_157686175.1|12727_13024_+|transposase	transposase	transposase	Q716C2	Shigella_phage	41.1	4.2e-13
WP_157686171.1|13025_13268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157686176.1|13323_14502_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_065485082.1|14865_15738_-|integrase	tyrosine-type recombinase/integrase	integrase	S5M9V8	Brevibacillus_phage	27.5	8.5e-22
WP_065485081.1|15910_18895_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	23.2	5.1e-66
WP_065486138.1|19602_20607_+	ETX/MTX2 family pore-forming toxin	NA	NA	NA	NA	NA
WP_065486139.1|20719_21073_-|transposase	IS6 family transposase	transposase	A0A1X9I6E7	Streptococcus_phage	50.9	1.4e-10
WP_065486140.1|21248_21899_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	59.6	1.9e-66
WP_094194646.1|22254_22665_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_065486141.1|22681_23434_-	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	34.5	3.1e-36
25849:25908	attL	TTTCCTTTAAAATATCTCATGTATCATTCTCCTCAACACATTTTCCCTACAGTTTAGCTT	NA	NA	NA	NA
WP_157686172.1|26463_27468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065486148.1|27522_28101_-	recombinase family protein	NA	A0A219Y9V9	Aeromonas_phage	39.7	1.4e-28
WP_065486151.1|28879_29566_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	59.0	2.4e-72
WP_094194663.1|31990_32908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094194648.1|33773_34073_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_094194459.1|36054_36843_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_065486159.1|37769_38942_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A142F1N9	Bacillus_phage	23.7	6.8e-06
WP_065486160.1|39274_39493_+	alpha/beta-type small acid-soluble spore protein	NA	A0A1P8CX76	Bacillus_phage	62.1	2.7e-17
WP_094194649.1|40834_42193_+	DEAD/DEAH box helicase	NA	E5ER62	Bathycoccus_sp._RCC1105_virus	31.5	1.2e-41
WP_094194650.1|42474_43264_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_065486164.1|44792_45971_+	FtsW/RodA/SpoVE family cell cycle protein	NA	NA	NA	NA	NA
WP_065486166.1|46598_47285_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	59.6	7.1e-72
46559:46644	attR	AAGCTAAACTGTAGGGAAAATGTGTTGAGGAGAATGATACATGAGATATTTTAAAGGAAAACAGTTCAAGAAAGACATTATTTTAG	NA	NA	NA	NA
WP_094194651.1|47958_48747_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_094194653.1|49585_49852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065486168.1|50212_50392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157686173.1|50624_50801_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_065486170.1|51050_51968_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_157686177.1|53366_54545_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_065486172.1|54873_55728_-	DEAD/DEAH box helicase family protein	NA	E5ES65	Bathycoccus_sp._RCC1105_virus	28.0	2.1e-20
WP_065486173.1|55835_57416_-	DEAD/DEAH box helicase family protein	NA	M1I405	Paramecium_bursaria_Chlorella_virus	29.1	4.5e-05
WP_065486175.1|57922_59356_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_065486176.1|59683_60370_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	58.6	4.1e-72
WP_065486178.1|60796_61678_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_094194655.1|62137_62350_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_157686174.1|62297_62615_-|transposase	transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	32.9	5.9e-05
WP_065486180.1|62514_62949_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
WP_065486181.1|63132_63741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094194657.1|64151_64918_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	42.7	2.3e-23
WP_065486186.1|65093_65300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065486189.1|66577_67216_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.4	2.7e-09
WP_065486191.1|67205_67754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065486193.1|67767_68277_-	stage II sporulation protein M	NA	NA	NA	NA	NA
WP_065486196.1|68281_69988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016106960.1|70069_70393_-|bacteriocin	circular bacteriocin, circularin A/uberolysin family	bacteriocin	NA	NA	NA	NA
WP_094194658.1|71097_72286_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	36.7	9.2e-35
WP_065486202.1|72734_73421_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	59.6	1.6e-71
>prophage 1
NZ_CP015358	Bacillus thuringiensis strain MYBT18246 plasmid p46701, complete sequence	46701	10523	39287	46701	capsid,protease,tail,terminase,portal,plate,head,transposase,integrase	Bacillus_phage(52.17%)	33	21151:21191	25353:25393
WP_065487212.1|10523_11297_+	ParA family protein	NA	A0A0K2FLP4	Brevibacillus_phage	28.5	1.6e-16
WP_065487214.1|11297_11663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065487216.1|11739_11931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065487218.1|11944_12211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065487219.1|12250_12796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065487220.1|13373_13631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065487221.1|13648_14680_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0A7AQV3	Bacillus_phage	72.9	6.5e-146
WP_065487222.1|14739_14943_-	hypothetical protein	NA	D2XR32	Bacillus_phage	59.1	1.7e-18
WP_065485214.1|14945_15227_-	hypothetical protein	NA	D2XR31	Bacillus_phage	78.0	4.5e-33
WP_065487224.1|15352_16435_-|plate	BppU family phage baseplate upper protein	plate	A0A1B1P768	Bacillus_phage	66.5	9.3e-135
WP_065487226.1|16449_18792_-	endopeptidase	NA	A0A1C8E983	Bacillus_phage	87.3	0.0e+00
WP_065487228.1|18788_19472_-|tail	phage tail protein	tail	A0A1C8EA72	Bacillus_phage	67.7	2.0e-87
WP_065487230.1|19473_21078_-	hypothetical protein	NA	A0A1B1P764	Bacillus_phage	39.8	8.4e-07
21151:21191	attL	TAGGGGTAGTGAGACGGTTCGTGCTCTAGTCCGTCAGATTA	NA	NA	NA	NA
WP_065485081.1|21293_24278_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	23.2	5.1e-66
WP_065485082.1|24450_25323_+|integrase	tyrosine-type recombinase/integrase	integrase	S5M9V8	Brevibacillus_phage	27.5	8.5e-22
WP_065487232.1|25364_27479_-	hypothetical protein	NA	A0A2H4J957	uncultured_Caudovirales_phage	46.3	4.1e-70
25353:25393	attR	TAATCTGACGGACTAGAGCACGAACCGTCTCACTACCCCTA	NA	NA	NA	NA
WP_065485227.1|27661_28030_-	hypothetical protein	NA	A0A1S7FZ84	Listeria_phage	34.6	1.3e-08
WP_065487234.1|28088_28658_-|tail	phage tail protein	tail	Q8W5Z9	Listeria_phage	42.9	8.8e-36
WP_065487236.1|28658_29069_-	hypothetical protein	NA	R4IBU7	Listeria_phage	35.9	1.4e-11
WP_065487238.1|29058_29439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065487240.1|29425_29782_-|head,tail	phage head-tail adapter protein	head,tail	NA	NA	NA	NA
WP_065487242.1|29781_30093_-	hypothetical protein	NA	A0A1B1P751	Bacillus_phage	40.5	9.8e-13
WP_065487245.1|30106_31228_-|capsid	phage major capsid protein	capsid	A0A1B1P752	Bacillus_phage	51.4	1.8e-96
WP_065487246.1|31241_31940_-|protease	Clp protease ClpP	protease	D2XR17	Bacillus_phage	46.3	7.3e-40
WP_065487248.1|31881_33123_-|portal	phage portal protein	portal	A0A1B1P754	Bacillus_phage	38.2	1.0e-73
WP_065487250.1|33138_34806_-|terminase	terminase large subunit	terminase	A0A1B1P766	Bacillus_phage	56.6	1.6e-178
WP_065487252.1|34789_35239_-	hypothetical protein	NA	E2ELI1	Clostridium_phage	43.5	4.4e-22
WP_065487254.1|35415_35727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065487256.1|35729_36056_-	HNH endonuclease	NA	Q8W5V3	Listeria_phage	44.3	4.2e-14
WP_065487258.1|36140_36380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065487262.1|37223_37508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065487264.1|38321_38756_-	transcriptional regulator	NA	E5DV97	Deep-sea_thermophilic_phage	54.4	9.4e-38
WP_065487266.1|38780_39287_-	zinc-finger domain-containing protein	NA	A0A2H4JAV2	uncultured_Caudovirales_phage	31.8	1.8e-11
